Composition for miRNA detection based on infinite zipper hybridization chain reaction, fluorescent biosensor as well as construction method and application of fluorescent biosensor

Abstract

The invention discloses a composition for miRNA detection based on an infinite zipper hybridization chain reaction (ZHCR), a fluorescent biosensor as well as a construction method and application of the fluorescent biosensor. According to the invention, HCR and PER are combined, a single-stranded DNA product generated by PER is used as a track for fixing hairpins, and ZH1 and ZH2 are generated by respectively reacting and combining with legged hairpins H1-l and H2-l of HCR; a target recognition unit is further designed according to the miRNA sequence, after the target miRNA is combined with the target recognition unit, a closed chain falls off, an initiation sequence is exposed, ZH2 and ZH1 are initiated to generate ZHCR, and a fluorescence signal is generated. The preparation of the reaction substrate and the sequence design are simple, and the free hairpin can be positioned on a long track, so that the reaction rate is improved, isothermal, rapid and sensitive amplification of miRNA in vitro is realized, and a new platform with a prospect can be provided for efficient imaging and in-vitro detection of miRNA in living cells.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a composition for detecting miRNA based on infinite zipper hybridization chain reaction, a fluorescent biosensor, and a construction method and application thereof. Background Art

[0002] A variety of small molecule biomarkers in the human body play a key role in early disease screening, drug guidance, auxiliary diagnosis and prognosis assessment. MicroRNA (miRNA) is a class of short non-coding single-stranded RNA (about 22 nucleotides) that plays an important role in gene expression regulation by targeting messenger RNA (mRNAs) at the post-transcriptional level or degrading the transcripts of its target genes. With its high sensitivity and specificity, it has been studied as an emerging biomarker for cancer diagnosis, prognosis and treatment monitoring.

[0003] Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) has long been the gold standard for miRNA detection. Unlike long RNA species (e.g., mRNA), short miRNAs require a special reversal process to facilitate the amplified sequence for PCR amplification and detection, and require precise temperature control, specified instruments, and long detection times. As an alternative to thermal cycling-based qPCR that requires complex analytical procedures and instruments, many isothermal assays have been developed to advance miRNA detection, such as rolling circle amplification, hybridization chain reaction, and catalytic hairpin assembly isothermal amplification. Although these detection methods have the advantages of being simple or even instrument-free, they have limitations such as high background signals and nonspecific amplification, relatively slow kinetics, and low sensitivity. Hybridization chain reaction (HCR) is a toehold-mediated strand displacement reaction (TMSD) reaction that has attracted much attention due to its advantages such as enzyme-free, isothermal, and high amplification efficiency. The currently proposed HCR-based confined nanoassemblies, such as locating hairpins, tetrahedrons, and triangular prisms, can accelerate the reaction of DNA nanoassemblies. Although they can position free hairpins to increase the local concentration of reactants, they still have some disadvantages, such as complex substrate preparation, and the self-entanglement of locating hairpins may cause nonspecific hybridization and steric hindrance. For example, the method proposed by predecessors to independently fix two hairpin probes in their respective tracks, however, this method has a limited number of combined hairpins, and the size of the assembly formed is small, and the mobility is high, so the residence time in the cell may be shortened, increasing the possibility of the probe being expelled from the cell. Summary of the invention

[0004] In view of the shortcomings of the prior art mentioned above, the purpose of the present invention is to provide a composition for miRNA detection based on infinite zipper hybridization chain reaction, a fluorescent biosensor and a construction method and application thereof, which are used to solve a series of problems of current confined nanoassembly based on HCR, such as: complex substrate preparation; nonspecific hybridization and steric hindrance caused by alternating hairpins in adjacent positions; or a limited number of bound hairpins, resulting in a small size of the assembly formed, a high mobility, and a possible shortened residence time in the cell, which increases the possibility of the probe being expelled from the cell.

[0005] To achieve the above-mentioned object and other related objects, the present invention provides a composition for detecting miRNA in a first aspect, comprising a first component, a second component and a third component;

[0006] The first component includes a primer;

[0007] The second component includes a legged hairpin H1-1 and a legged hairpin H2-1;

[0008] The primer generates a linear single-stranded DNA through a primer exchange reaction (PER), wherein the linear single-stranded DNA contains a repeated short DNA sequence; the linear single-stranded DNA hybridizes with a plurality of the legged hairpins H1-1 to form a DNA double-stranded ZH1, and the linear single-stranded DNA hybridizes with a plurality of the legged hairpins H2-1 to form a DNA double-stranded ZH2;

[0009] The third component includes a double-stranded DNA IMB; or, the third component includes a single-stranded DNA IM and a closed strand B; or, the third component includes a priming strand I, a miRNA recognition sequence M and a closed strand B;

[0010] The double-stranded DNA IMB includes the single-stranded DNA IM and the closed strand B, and the single-stranded DNA IM includes the priming strand I and the miRNA recognition sequence M; the miRNA recognition sequence M is partially or completely complementary to the nucleotide sequence of the target miRNA;

[0011] After the miRNA recognition sequence M binds to the target miRNA, the closed strand B in the DNA double strand IMB will fall off, exposing the initiator strand I, which then undergoes an infinite zipper hybridization chain reaction (ZHCR) with the DNA double strand ZH1 and the DNA double strand ZH2 in turn to form a long zipper DNA polymer.

[0012] In some embodiments, the nucleotide sequence of the primer is shown as SEQ ID NO.3.

[0013] In some embodiments, the first component further comprises a catalytic hairpin and / or a clean hairpin G (Clean.G), the nucleotide sequence of the catalytic hairpin is shown in SEQ ID NO.1 or SEQ ID NO.2, and the nucleotide sequence of the clean hairpin G is shown in SEQ ID NO.4. Wherein, Clean.G has a template of C, and its 3' end can be extended thereon. During the initial incubation, there is a small amount of dGTP contamination in the dATP, dTTP and dCTP solutions, and the addition of Clean.G can be used as a strategy to filter out a small amount of contaminated nucleotides, so that these contaminated nucleotides can stop extending.

[0014] In some embodiments, the nucleotide sequence of the linear single-stranded DNA is shown as SEQ ID NO.5.

[0015] In some embodiments, the nucleotide sequence of the legged hairpin H1-1 includes fragment 1, fragment 2 and fragment 3 connected in sequence from the 5' end to the 3' end, the nucleotide sequence of the legged hairpin H2-1 includes fragment 4, fragment 2 and fragment 1 connected in sequence from the 5' end to the 3' end, the nucleotide sequence of fragment 1 includes GTTAAGTTGTGTTAAGTTGT, the nucleotide sequence of fragment 2 includes 0 to 10 consecutive bases T, the nucleotide sequence of fragment 3 includes the nucleotide sequence shown in SEQ ID NO.6, and the nucleotide sequence of fragment 4 includes the nucleotide sequence shown in SEQ ID NO.7.

[0016] In some embodiments, the nucleotide sequence of the legged hairpin H1-1 contains a nucleotide sequence as shown in SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15 or SEQ ID NO.17.

[0017] In some embodiments, the nucleotide sequence of the hairpin H2-1 comprises a nucleotide sequence as shown in SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.16 or SEQ ID NO.18.

[0018] In a specific embodiment, the nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO.9, and the nucleotide sequence of the hairpin H2-1 comprises the nucleotide sequence shown in SEQ ID NO.10.

[0019] In a specific embodiment, the nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO.11, and the nucleotide sequence of the hairpin H2-1 comprises the nucleotide sequence shown in SEQ ID NO.12.

[0020] In a specific embodiment, the nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO. 13, and the nucleotide sequence of the hairpin H2-1 comprises the nucleotide sequence shown in SEQ ID NO. 14. In a specific embodiment, the nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO. 15, and the nucleotide sequence of the hairpin H2-1 comprises the nucleotide sequence shown in SEQ ID NO. 16.

[0021] In a specific embodiment, the nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO.17, and the nucleotide sequence of the hairpin H2-1 comprises the nucleotide sequence shown in SEQ ID NO.18.

[0022] In some embodiments, the nucleotide sequence of the priming chain I is shown as SEQ ID NO.19.

[0023] In some embodiments, the target miRNA is selected from at least one of miR-221, miR-222, miR-375, miR-141 or miR-146b, but is not limited thereto.

[0024] In some embodiments, when the target miRNA is miR-221, the nucleotide sequence of the single-stranded DNA IM is as shown in SEQ ID NO.30, and the nucleotide sequence of the closed strand B is as shown in SEQ ID NO.25.

[0025] In some embodiments, when the target miRNA is miR-222, the nucleotide sequence of the single-stranded DNA IM is shown as SEQ ID NO.31, and the nucleotide sequence of the closed strand B is shown as SEQ ID NO.26.

[0026] In some embodiments, when the target miRNA is miR-375, the nucleotide sequence of the single-stranded DNA IM is as shown in SEQ ID NO.32, and the nucleotide sequence of the closed strand B is as shown in SEQ ID NO.27.

[0027] In some embodiments, when the target miRNA is miR-141, the nucleotide sequence of the single-stranded DNA IM is as shown in SEQ ID NO.33, and the nucleotide sequence of the closed strand B is as shown in SEQ ID NO.28.

[0028] In some embodiments, when the target miRNA is miR-146b, the nucleotide sequence of the single-stranded DNA IM is as shown in SEQ ID NO.34, and the nucleotide sequence of the closed strand B is as shown in SEQ ID NO.29.

[0029] In some embodiments, the first component further comprises at least one of the following components: a buffer, a buffering agent, a deoxynucleoside triphosphate (dNTP), and a DNA polymerase. The deoxynucleoside triphosphate (dNTP) includes but is not limited to adenine deoxynucleotide (dATP), thymine deoxynucleotide (dTTP), cytosine deoxynucleotide (dCTP), etc.

[0030] In some embodiments, the buffer is selected from at least one of PBS buffer and Tris buffer, but is not limited thereto. The Tris buffer comprises the following components: 0.8M NaCl, 20mM Tris, PH=7.6.

[0031] In some embodiments, the buffer is selected from magnesium sulfate, but is not limited thereto.

[0032] In some embodiments, the DNA polymerase is selected from BST Warm Start 2.0 polymerase, but is not limited thereto.

[0033] In some embodiments, the legged hairpins H1-1 and H2-1 are respectively labeled with a fluorescent group and a quenching group, or the legged hairpin H1-1 is labeled with a fluorescent group and a quenching group; the fluorescent group is selected from FAM, HEX, TET, ROX, TAMRA, JOE, Cy, etc., for example, at least one of 6-FAM, 6-HEX, 6-TET, 6-ROX, 6-TAMRA, 6-JOE, Cy3, and Cy5, and the quenching group is selected from at least one of BHQ1 and BHQ2, but is not limited thereto.

[0034] In some embodiments, the nucleotide sequence shown in SEQ ID NO. 11, 13 or 15 is labeled with a fluorescent group, and the nucleotide sequence shown in SEQ ID NO. 12, 14 or 16 is labeled with a quenching group.

[0035] In a specific embodiment, the nucleotide sequence shown in SEQ ID NO. 17 is labeled with a fluorescent group and a quenching group.

[0036] The second aspect of the present invention provides a method for constructing a fluorescent biosensor for miRNA detection based on infinite zipper hybridization chain reaction using the composition described in the first aspect, comprising the following steps:

[0037] (1) constructing a primer exchange reaction system, subjecting the primers to a primer exchange reaction to generate a linear single-stranded DNA product;

[0038] (2) incubating the primer exchange reaction product with the legged hairpins H1-1 and H2-1 to generate double-stranded DNA ZH1 and double-stranded DNA ZH2;

[0039] (3) The double-stranded DNA ZH1 and the double-stranded DNA ZH2 are incubated with the double-stranded DNA IMB to construct the fluorescent biosensor.

[0040] In some embodiments, the primer exchange reaction process in step (1) includes: the catalytic hairpin and the cleaning hairpin G are first mixed and incubated with DNA polymerase and deoxynucleoside triphosphates, and then the primer is added and incubated continuously to obtain a linear single-stranded DNA product.

[0041] In some embodiments, in the primer exchange reaction system of step (1), the concentration of the catalytic hairpin is 0.125 μM to 1 μM, preferably 1 μM.

[0042] In some embodiments, in the primer exchange reaction system of step (1), the concentration of DNA polymerase is 0.2 units / μl to 1.6 units / μl, preferably 8 units / μl, where units / μl is abbreviated as u / μl.

[0043] In some embodiments, in step (1), the incubation temperature is 37°C.

[0044] In some embodiments, in step (1), the catalytic hairpin and the cleaning hairpin G are mixed with DNA polymerase and deoxynucleoside triphosphates and incubated for 10 min to 15 min.

[0045] In some embodiments, in step (1), the incubation time after the primer is added is 2 hours.

[0046] In some embodiments, step (1) further comprises: heating to inactivate the enzyme after the incubation is completed, the heating temperature is 80° C., and the heating time is 15 min to 20 min.

[0047] In some embodiments, in step (2), the incubation temperature is 37° C. and the incubation time is 2 h.

[0048] In some embodiments, in the reaction system in step (2), the concentration of the legged hairpin H1-1 is 0.1 μM to 2.5 μM, and the concentration of the legged hairpin H2-1 is 0.1 μM to 2.5 μM.

[0049] In some embodiments, step (2) further comprises: the legged hairpin H1-1 and the legged hairpin H2-1 are annealed and then incubated with the primer exchange reaction product, the annealing temperature is preferably 95° C., and the annealing time is preferably 5 min.

[0050] In some embodiments, in step (3), the incubation temperature is 37° C. and the incubation time is 0.5 h to 1 h.

[0051] In some embodiments, in step (3), the concentration of the double-stranded DNA IMB is 10nM to 50nM, preferably 20nM to 50nM.

[0052] The third aspect of the present invention provides a fluorescent biosensor for detecting miRNA based on infinite zipper hybridization chain reaction constructed according to the method described in the second aspect.

[0053] The fourth aspect of the present invention provides a miRNA detection method, using the composition described in the first aspect and / or the fluorescent biosensor described in the third aspect.

[0054] The fifth aspect of the present invention provides use of the composition described in the first aspect, and / or the method described in the second aspect, and / or the fluorescent biosensor described in the third aspect in the preparation of miRNA detection reagents.

[0055] As described above, the composition for detecting miRNA based on infinite zipper hybridization chain reaction, fluorescent biosensor and its construction method and application of the present invention have the following beneficial effects:

[0056] The present invention proposes a confined nano-DNA self-assembled fluorescent biosensor based on ZHCR with miRNA as the target, which can provide a promising new method for efficient imaging of miRNA in living cells and detection of clinical samples, and has good detection performance. It has certain potential application value in effectively distinguishing thyroid cancer and normal people in clinical serum samples, as well as in the auxiliary diagnosis of other diseases.

[0057] (1) The present invention combines HCR with PER, uses the single-stranded DNA product generated by PER as the track for fixing the hairpin, and designs the hairpins H1-1 and H2-1 with legs on the basis of the hairpins H1 and H2 of the classic HCR, and then reacts and combines the track with H1-1 and H2-1 to generate ZH1 and ZH2, so that the free hairpins H1-1 and H2-1 are anchored on the track respectively, and the local concentration between the hairpins is significantly increased. After adding the target, the collision frequency between the hairpins can be increased, thereby significantly increasing the reaction rate, and producing a more efficient and sensitive amplification than HCR. At the same time, the single-stranded track preparation method is simple, and after positioning the hairpins H1-1 and H2-1 with legs on the long track, the target is introduced, and the fluorescent signal output can be quickly generated. Therefore, compared with traditional HCR, the reaction speed is significantly improved.

[0058] (2) Compared with other confined nanoassembly methods, the substrate preparation and sequence design of the present invention are very simple. The separate preparation of the legged hairpins H1-1 and H2-1 avoids the high background signal caused by the nonspecific hybridization of the hairpins. In addition, the infinitely extended DNA chain of PER allows more free hairpins to be positioned, solving the problems existing in the current confined nanoassembly.

[0059] (3) Based on the programmability of nucleic acids, the present invention also designs a target recognition unit that can react under different target conditions to form long zipper-like DNA polymers and increase the size of the assembly, thereby facilitating the intracellular detection and imaging of miRNAs.

[0060] (4) Compared with the existing gold standard RT-qPCR for detecting miRNA, the detection method established based on the present invention does not require complex instruments and equipment, does not require reversal, and the process of detecting miRNA is only carried out under isothermal and enzyme-free conditions at 37°C. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 This is a technical schematic diagram of the ZHCR-based fluorescent biosensor for detecting miRNA in the present invention.

[0062] Figure 2 Schematic diagram of PER reaction (a), the result of gel electrophoresis characterization of PER (b), and the optimization results of catalytic hairpin and DNA polymerase concentration of PER (c, d).

[0063] Figure 3 The results of gel electrophoresis characterization of ZH1 and ZH2 formed by the combination of PER products with different concentrations of H1-l (a) and H2-l (b), respectively.

[0064] Figure 4Figure 2 shows the feasibility verification results of classical HCR and HCR-1 (a), the fluorescence kinetic signal comparison of ZHCR-1 and HCR-1 from on-off (b), the fluorescence kinetic signal comparison of HCR-1 and four groups of ZHCR-1-0T, ZHCR-1-5T, and ZHCR-1-10T from three times from on-off (c) and the kinetic reaction rate constant results of the four groups (d), and the fluorescence kinetic results comparison of HCR-1 and ZHCR-1-5T groups from three times from off-on (e, f).

[0065] Figure 5 The signal-to-noise ratio when different concentrations of legged hairpins were added to the ZHCR-l-5T group (a), the sensitivity detection result when different concentrations of initiator chains were added (b), and the linear relationship analysis result (c).

[0066] Figure 6 Feasibility verification results of miR-221 and miR-222 detection after the introduction of IMB into the ZHCR-l-5T group (a, b), optimization results of IMB concentration (c), sensitivity detection results at different miRNA concentrations (d, e) and linear relationship analysis results (f, g).

[0067] Figure 7 This is a graph showing the specific detection results of different miRNAs after the introduction of different IMBs into the ZHCR-l-5T group. DETAILED DESCRIPTION

[0068] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0069] In the present invention, unless otherwise specified, the term "plurality" means two or more.

[0070] The character " / " indicates that the objects before and after are in an "or" relationship. For example, A / B means: A or B.

[0071] The term "and / or" is a description of the association relationship between objects, indicating that three relationships can exist. For example, A and / or B means: A or B, or, A and B.

[0072] In addition, unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0073] Example 1

[0074] 1. Experimental Materials

[0075] Agarose, dATP, dTTP, dCTP, PBS, and all oligonucleotides purified by HPLC were purchased from Bio-Tech (Shanghai, China). 6× loading buffer and 20-200 bp DNA Marker were purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China). DNA Cycle pure Kit was purchased from omega Bio-Tek (Guangzhou, China). ZHCR probe assembly was performed in reaction buffer (0.8 M NaCl, 20 mM Tris, pH = 7.6). BST 2.0 Warm Start DNA polymerase was purchased from New England Biolabs (Beijing, China). Deionized water (≥18 MΩ, Millipore Bedford, MA, USA) was used in all experiments.

[0076] The nucleotide sequences involved in the present invention are shown in Table 1 and Table 2.

[0077] Table 1 DNA nucleotide sequences involved in the PER reaction system

[0078]

[0079] Table 2 DNA nucleotide sequences involved in HCR and ZHCR reaction systems

[0080]

[0081]

[0082] 2. Experimental Instruments

[0083] Fluorescence spectra were measured on a F-4700 (Hitachi, Japan) fluorescence spectrophotometer (Hitachi, Japan). Native polyacrylamide gel electrophoresis (PAGE) was performed on an electrophoresis instrument (Bio-Rad, USA), and image analysis was performed on a Chemi-DocXRS system (Bio-Rad, USA). The concentration of purified PER products was quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).

[0084] 3. Experimental process

[0085] 1. Construction of a fluorescent biosensor for detecting miRNA based on infinite zipper hybridization chain reaction (ZHCR)

[0086] 1.1 Technical Principle:

[0087] like Figure 1 As shown, first, a linear single-stranded DNA was prepared using PER. This single-stranded DNA was composed of a repetitive short DNA sequence. The prepared single-stranded DNA was used as a track for fixing the hairpin, and hybridized and combined with the legged hairpins H1-1 and H2-1 respectively. Since the single-stranded DNA was composed of a repetitive sequence, it could combine with several H1-1 and H2-1 to form ZH1 and ZH2.

[0088] Then, in order to identify different miRNAs, based on the programmability of nucleic acids, the target recognition unit (IMB) is designed according to the miRNA sequence. The IMB is a double-stranded chain consisting of a chain (IM) synthesized by the initiator chain (Initiator, I) and the miRNA recognition sequence (M) and a closed chain (Blocker, B).

[0089] The hairpin with legs is modified with a fluorescent group and a quenching group to detect miRNA by detecting the change of the fluorescence signal. Due to the different modification positions of the fluorescent group and the quenching group, the change of the fluorescence signal during the fluorescence detection process has the following two situations:

[0090] When the fluorescence signal shows a reverse signal from on to off, the fluorescent group FAM and the quenching group BHQ1 are modified at the corresponding positions of the DNA sequence of the legged hairpins H1-1 and H2-1, respectively. At this time, in the absence of the target, ZH1 and ZH2 can exist stably and the fluorescence signal can be detected. When the target miRNA is present, after the miRNA binds to the IMB, the closed chain falls off, exposing the initiating chain, and the initiating chain first reacts with ZH2 and then with ZH1 to undergo ZHCR, and the hairpins H1-1 and H2-1 are opened to form a long zipper DNA polymer, and the fluorescent group and the quenching group are close to each other, and the fluorescence signal is quenched.

[0091] When the fluorescence signal shows a positive signal from nothing to something (off-on), the fluorescent group FAM and the quenching group BHQ1 are modified at the corresponding positions of the DNA sequence of the hairpin with legs H1-1. At this time, in the absence of the target, ZH1 and ZH2 can exist stably, and the fluorescence signal is quenched. When the target miRNA is present, after the miRNA binds to the IMB, the closed chain falls off, exposing the initiating chain, and the initiating chain first undergoes ZHCR with ZH2 and then with ZH1, and the hairpin H1-1 is opened to form a long zipper-type DNA polymer, generating a fluorescence signal.

[0092] 1.2. Preparation process:

[0093] (1) Constructing a PER reaction system and obtaining a PER product

[0094] Take PBS (10μl, 10×), MgSO4 (10μl, 100mM), dNTP (10μl, 6mM), Hairpin 1 / 2 (10μl, 10μM), Clean.G (10μ1, 1μM), BST Warm Start 2.0 polymerase (10μl, 8units / μl), react at 37℃ for 15min, then add primer (10μl, 10μM), add 30μl ddH2O to a total volume of 100μl, incubate at 37℃ for 2h, then heat to 80℃ and incubate for 20min to inactivate the enzyme. The resulting reaction system was purified using a DNA purification kit, and the purified PER product was quantified using nanodrop.

[0095] (2) Construction of HCR and HCR-1 systems to prepare zipper-type ZH1 and ZH2

[0096] The hairpins H1 and H2, and the legged hairpins H1-1 and H2-1 were annealed (95°C, 5 min) and then cooled to room temperature.

[0097] H1 (5 μM) and H2 (5 μM) were added to the initiator chain, the concentration ratio of hairpin to initiator chain was 10:1, and the reaction was incubated at 37°C for 1 h to construct the HCR system.

[0098] H1-1 (5 μM) and H2-1 (5 μM) were added to the initiator chain, the concentration ratio of hairpin to initiator chain was 10:1, and the reaction was incubated at 37°C for 1 h to construct the HCR-1 system.

[0099] H1-1 (5 μM) and H2-1 (5 μM) were incubated with purified and quantified PER product (final concentration of 38.5 ng / ul) at 37°C for 2 h to generate ZH1 (2.5 μM) and ZH2 (2.5 μM) to prepare for ZHCR-1.

[0100] (3) Construction of ZHCR-1 system

[0101] After preparing ZH1 (2.5 μM) and ZH (2.5 μM), the initiator chain was added, and the concentration ratio of hairpin to initiator chain was 10:1, and then incubated at 37°C for 1 hour, and the fluorescence endpoint signal was detected. At the same time, the fluorescence kinetics of the ZHCR-l system was analyzed, and it was found that the reaction was basically completed in 30 minutes.

[0102] 1.3 Fluorescence detection

[0103] Take 100 μl of the above reactants and add them to a quartz cuvette, and measure them using a fluorescence spectrophotometer, which specifically includes the following steps:

[0104] (1) Fluorescence cuvette cleaning: Soak the fluorescence cuvette in alcohol and clean it with DEPC water;

[0105] (2) Setting parameters: set the excitation wavelength to 520 nm, the emission wavelength range to 490-600 nm, and the voltage to 650 V;

[0106] (3) Zero adjustment: Add DEPC water to the fluorescence cuvette to adjust the zero;

[0107] (4) Perform detection: Add the reaction solution into the fluorescent cuvette and click on the detection button to obtain the fluorescent signal.

[0108] 2. Verify the feasibility of the PER system:

[0109] like Figure 2 As shown in a, using PER, after continuous primer cycling, a single-stranded DNA product with a repetitive sequence can be produced. Because of the lack of G bases, the sequence structure of this product is simplified, reducing the possibility of forming a secondary structure.

[0110] PAGE was used to verify the feasibility of the PER system. The results are as follows Figure 2 b, where

[0111] Lane markers are 20bp-500bp DNA markers;

[0112] Lane 1 is primer;

[0113] Lane 2 is clean.G;

[0114] Lane 3 is primer+hairpin1;

[0115] Lane 4 is primer+hairpin2;

[0116] Lane 5: primer+hairpin1+clean.G;

[0117] Lane 6: primer+hairpin2+clean.G;

[0118] Lane 7: primer+hairpin1+clean.G++dNTP(A, C, T);

[0119] Lane 8 is primer+hairpin2+clean.G++dNTP(A, C, T).

[0120] from Figure 2b can be seen: Lane 1 is primer. Due to the short sequence, the corresponding band in Lane 1 cannot be seen. Lane 2 is clean.G. Lanes 3 and 4 correspond to primer+hairpin1 / hairpin2, respectively. Lanes 5 and 6 correspond to primer+clean.G+hairpin1 / hairpin2, respectively. In the absence of complete reactants, no migrating bands are formed on the above lanes. Lanes 7 and 8 are primer+clean.G+dNTP(A, C, T)+hairpin1 / hairpin2. In the presence of all reactants, obvious bands can be seen, indicating that PER is successfully carried out. Hairpin1 and hairpin2 represent hairpins with different modifications, and both can carry out PER reaction. The 3' end of the hairpin of Hairpin1 contains reverse dT modification, which can prevent extension on the unbound region of the 5' end of its primer. The subsequent PER selects hairpin1 for execution.

[0121] The hairpin1 concentration of the PER system was optimized by PAGE. The results are as follows Figure 2 c, where

[0122] Lane marker is 20-500bp DNA marker;

[0123] Lane 1, 0.125 μM hairpin1;

[0124] Lane 2, 0.25 μM hairpin1;

[0125] Lane 3, 0.5 μM hairpin1;

[0126] Lane 4, 1 μM hairpin1;

[0127] according to Figure 2 As shown in c, the final concentration of hairpin1 in the subsequent PER system was selected to be 1 μM.

[0128] PAGE was used to optimize the concentration of BST 2.0WarmStart polymerase in the PER system. The results are as follows: Figure 2 d, where

[0129] Lane marker is 20-500bp DNA marker;

[0130] Lane 1: 0.2u / ul polymerase;

[0131] Lane 2: 0.4u / ul polymerase;

[0132] Lane 3: 0.8u / ul polymerase;

[0133] Lane 4 is 1.6u / ul polymerase;

[0134] according to Figure 2 As shown in d, the final concentration of BST 2.0WarmStart polymerase in the subsequent PER system was selected to be 0.8u / ul.

[0135] 3. Hairpin concentration optimization:

[0136] After completing the feasibility verification of PER and optimizing the concentration of hairpin1 and polymerase, PER was purified and quantified. While other reaction conditions remained unchanged, the concentration of hairpin was changed, and the quantified PER product was combined with hairpins H1-1 and H2-1 of different concentrations to prepare ZH1( Figure 3 a) and ZH2( Figure 3 b) and characterized by PAGE. Figure 3 As shown in a, 3b, as the hairpin concentration increases, the band changes and becomes more and more obvious. Considering the comprehensive reagent cost, a final hairpin concentration of 2.5 μM was selected.

[0137] 4. In order to verify that the legged hairpins H1-1 and H2-1 designed on the hairpins H1 and H2 of the classic HCR can smoothly carry out the hybridization chain reaction, the feasibility of the HCR-1 system was verified and compared with the classic HCR, as well as the advantages of the ZHCR-1 and HCR-1 systems after combining with the track:

[0138] In order to prove that the legged hairpin bound to the track can undergo a hybridization chain reaction, HCR-1 was first compared with HCR. The PAGE characterization results are shown in Figure 4 a, where

[0139] Lane marker is 20-500bp DNA marker;

[0140] Lane 1 is H1-1;

[0141] Lane 2 is H2-1;

[0142] Lane 3: H1-1+H2-1;

[0143] Lane 4: H1-1+H2-1+initiator;

[0144] Lane 5 is H1;

[0145] Lane 6 is H2;

[0146] Lane 7 is H1+H2;

[0147] Lane 8 is H1+H2+initiator;

[0148] from Figure 4 a As can be seen: in the HCR system, lanes 5 and 6 are H1 and H2 respectively, and lanes 7 and 8 represent the comparison of the absence and presence of the initiator chain, respectively. In the absence of the initiator chain, the two hairpins are stably present, and in the presence of the initiator chain, bands are produced. The HCR-1 system sets the same lanes, which also verifies that the legged hairpin can smoothly carry out the hybridization chain reaction. Since the sequence of the legs in the legged hairpin is complementary to the sequence of the PER product, the legged hairpin combines with the PER product to form a long zipper-type DNA polymer, and the reaction rate is higher than that of the classical HCR.

[0149] After verifying that HCR-1 can be successfully carried out, the hairpins H1-1 and H2-1 with legs are connected to the PER product respectively to verify ZHCR-1. Figure 4 As shown in b, the on-off fluorescence kinetics results show that ZHCR-l exhibits a faster fluorescence quenching rate and a lower fluorescence baseline than HCR-l, which indicates that positioning the free legged hairpin on the track increases the local concentration of the legged hairpin, thereby increasing the reaction rate.

[0150] Next, T bases were added to the legged hairpins H1-1 and H2-1 to avoid tight arrangement between the sequences, thereby providing more space for extension during the reaction. In order to explore whether the distance between the legged hairpin and the track affects the reaction rate, different numbers of T bases (0T, 5T, 10T) were added to the legged hairpin, and different distance groups ZHCR-1-0T, ZHCR-1-5T and ZHCR-1-10T were set up and compared with the kinetics of HCR-1. It can be seen that Figure 4 As shown in c, 4d, the reaction rate is fastest when the distance between the legged hairpin and the track is 5T.

[0151] Based on the optimized distance from the legged hairpin to the track, a 5-T base group was selected for subsequent experiments. Figure 4 e, 4f, the three kinetic repetitions of ZHCR-l-5T were compared with the three kinetics of classic HCR from off-on results, and ZHCR-l-5T showed a faster reaction rate and higher fluorescence signal. The ZHCR-l-5T group was selected, and hereinafter referred to as ZHCR.

[0152] 5. Optimization of ZHCR system conditions

[0153] Having proved the advantages of ZHCR, the following is to optimize the conditions of the ZHCR system. First, the signal-to-noise ratio under different hairpin concentration conditions is compared, such as Figure 5As shown in a, with the increase of concentration, the signal-to-noise ratio did not change much. In order to save reagent costs, a final concentration of 200 nM was selected. Then the sensitivity of ZHCR was tested, as shown in Figure 5 As shown in b and 5c, different concentrations of the initiator chain were set at 0nM, 0.01nM, 0.1nM, 1nM, 5nM, 10nM, 15nM, 20nM, 30nM, and 50nM, and it was found that there was a linear relationship in the range of 0.01nM to 20nM.

[0154] 6. Feasibility verification of ZHCR detection of miRNA

[0155] After the introduction of the target recognition unit IMB, the feasibility of ZHCR in detecting miR-221 and miR-222 was verified ( Figure 6 a, 6b), and after verifying its feasibility, we explored the fluorescence signal detection under different IMB concentrations. It can be seen that when ≥20nM, the fluorescence signal tends to be stable ( Figure 6 c), as well as the sensitivity (Figure d, e) and linearity (Figure f, g) under different miRNA concentrations, it was found that the miRNA concentration also has a linear relationship in the range of 0.01nM to 20nM. At the same time, the specific detection of different miRNAs (miR-221, miR-222, miR-375, miR-141, miR-146b) was also investigated when different IMBs (IMB-221, IMB-222, IMB-375, IMB-141, IMB-146b) were introduced into ZHCR. Figure 7 As shown, the orthogonal specificity results showed that under different IMB conditions, only when the corresponding miRNA was added could the reaction be triggered to produce a fluorescent signal, proving that the system had good specificity.

[0156] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. A composition for detecting miRNA, characterized in that: comprising a first component, a second component and a third component; The first component includes a primer; The second component includes a legged hairpin H1-1 and a legged hairpin H2-1; The primer generates a linear single-stranded DNA through primer exchange reaction, and the linear single-stranded DNA contains a repeated short DNA sequence; the linear single-stranded DNA hybridizes with a plurality of the legged hairpins H1-1 to form a DNA double-stranded ZH1, and the linear single-stranded DNA hybridizes with a plurality of the legged hairpins H2-1 to form a DNA double-stranded ZH2; The third component includes a double-stranded DNA IMB; or, the third component includes a single-stranded DNA IM and a closed strand B; or, the third component includes a priming strand I, a miRNA recognition sequence M and a closed strand B; The double-stranded DNA IMB includes the single-stranded DNA IM and the closed strand B, and the single-stranded DNA IM includes the priming strand I and the miRNA recognition sequence M; the miRNA recognition sequence M is partially or completely complementary to the nucleotide sequence of the target miRNA; After the miRNA recognition sequence M binds to the target miRNA, the closed strand B in the DNA double strand IMB will fall off, exposing the initiator strand I, which then undergoes an infinite zipper-type hybridization chain reaction with the DNA double strand ZH2 and the DNA double strand ZH1 in turn to form a long zipper-type DNA polymer.

2. The composition for detecting miRNA according to claim 1, characterized in that: The nucleotide sequence of the primer is shown in SEQ ID NO.3; And / or, the first component further comprises a catalytic hairpin and / or a cleaning hairpin G, the nucleotide sequence of the catalytic hairpin is shown in SEQ ID NO.1 or SEQ ID NO.2, and the nucleotide sequence of the cleaning hairpin G is shown in SEQ ID NO.4; And / or, the nucleotide sequence of the linear single-stranded DNA is as shown in SEQ ID NO.5; And / or, the nucleotide sequence of the legged hairpin H1-1 includes fragment 1, fragment 2 and fragment 3 sequentially connected from the 5' end to the 3' end, the nucleotide sequence of the legged hairpin H2-1 includes fragment 4, fragment 2 and fragment 1 sequentially connected from the 5' end to the 3' end, the nucleotide sequence of fragment 1 includes GTTAAGTTGTGTTAAGTTGT, the nucleotide sequence of fragment 2 includes 0 to 10 consecutive bases T, the nucleotide sequence of fragment 3 includes the nucleotide sequence shown in SEQ ID NO.6, and the nucleotide sequence of fragment 4 includes the nucleotide sequence shown in SEQ ID NO.7; And / or, the nucleotide sequence of the priming chain I is shown in SEQ ID NO.19; And / or, the target miRNA is selected from at least one of miR-221, miR-222, miR-375, miR-141 or miR-146b.

3. The composition for detecting miRNA according to claim 1, characterized in that: The nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15 or SEQ ID NO.17; And / or, the nucleotide sequence of the legged hairpin H2-1 contains the nucleotide sequence shown in SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.16 or SEQ ID NO.

18.

4. The composition for detecting miRNA according to claim 2, characterized in that: When the target miRNA is miR-221, the nucleotide sequence of the DNA single strand IM is shown as SEQ ID NO.30, and the nucleotide sequence of the closed strand B is shown as SEQ ID NO.25; And / or, when the target miRNA is miR-222, the nucleotide sequence of the single-stranded DNA IM is as shown in SEQ ID NO.31, and the nucleotide sequence of the closed strand B is as shown in SEQ ID NO.26; And / or, when the target miRNA is miR-375, the nucleotide sequence of the single-stranded DNA IM is as shown in SEQ ID NO.32, and the nucleotide sequence of the closed strand B is as shown in SEQ ID NO.27; And / or, when the target miRNA is miR-141, the nucleotide sequence of the DNA single strand IM is as shown in SEQ ID NO.33, and the nucleotide sequence of the closed strand B is as shown in SEQ ID NO.28; And / or, when the target miRNA is miR-146b, the nucleotide sequence of the DNA single strand IM is as shown in SEQ ID NO.34, and the nucleotide sequence of the closed strand B is as shown in SEQ ID NO.

29.

5. The composition for detecting miRNA according to claim 1, characterized in that: The first component further comprises at least one of the following ingredients: a buffer, a buffering agent, deoxynucleoside triphosphates, and a DNA polymerase; And / or, the legged hairpins H1-1 and H2-1 are respectively labeled with a fluorescent group and a quenching group, or the legged hairpin H1-1 is labeled with a fluorescent group and a quenching group.

6. A method for constructing a fluorescent biosensor for miRNA detection based on infinite zipper hybridization chain reaction using the composition according to any one of claims 1 to 5, characterized in that: The steps include: (1) constructing a primer exchange reaction system, and subjecting the primers to a primer exchange reaction to generate a linear single-stranded DNA product; (2) incubating the primer exchange reaction product with the legged hairpins H1-1 and H2-1 to generate double-stranded DNA ZH1 and double-stranded DNA ZH2; (3) The double-stranded DNA ZH1 and the double-stranded DNA ZH2 are incubated with the double-stranded DNA IMB to construct the fluorescent biosensor.

7. The method according to claim 6, characterized in that: The primer exchange reaction process in step (1) includes: the catalytic hairpin and the cleaning hairpin G are first mixed and incubated with DNA polymerase and deoxynucleoside triphosphates, and then the primer is added and incubated continuously to obtain a linear single-stranded DNA product; and / or, in the primer exchange reaction system of step (1), the concentration of the catalytic hairpin is 0.125 μM to 1 μM; and / or, in the primer exchange reaction system of step (1), the concentration of DNA polymerase is 0.2 units / μl~1.6 units / μl; And / or, in the reaction system of step (2), the concentration of the legged hairpin H1-1 is 0.1 μM ~ 2.5 μM, and the concentration of the legged hairpin H2-1 is 0.1 μM ~ 2.5 μM; And / or, in step (3), the concentration of the double-stranded DNA IMB is 10 nM~50 nM.

8. A fluorescent biosensor for miRNA detection based on infinite zipper hybridization chain reaction constructed according to the method described in any one of claims 6 to 7.

9. A miRNA detection method, characterized in that: Using the composition according to any one of claims 1 to 5, and / or the fluorescent biosensor according to claim 8.

10. Use of the composition according to any one of claims 1 to 5, and / or the method according to claims 6 to 7, and / or the fluorescent biosensor according to claim 8 in preparing a miRNA detection reagent.

Images