Outer circular DNA and application thereof in high metastatic triple negative breast cancer

Abstract

The invention belongs to the technical field of disease diagnosis and treatment, and particularly relates to outer circular DNA and application thereof in high-metastatic triple negative breast cancer. The nucleotide sequence of the external circular DNA (GALNT3circle) provided by the invention is shown as SEQ ID NO: 1, the expression of the external circular DNA (GALNT3circle) in high-metastatic triple-negative breast cancer cells is remarkably up-regulated, and the external circular DNA (GALNT3circle) can be used as a diagnostic marker of the high-metastatic triple-negative breast cancer to distinguish the high-metastatic triple-negative breast cancer from low-metastatic triple-negative breast cancer, and is strong in specificity and high in sensitivity; by destroying the outer circular DNA, the expression of the GALNT3 gene can be reduced, the metastasis of the high-metastatic triple-negative breast cancer can be inhibited, the GALNT3 is over-expressed on the basis of destroying the outer circular DNA, the metastasis of the high-metastatic triple-negative breast cancer is promoted, and a new target is provided for the treatment of the high-metastatic triple-negative breast cancer.

Description

Technical Field

[0001] The present invention belongs to the technical field of disease diagnosis and treatment, and specifically relates to an exocyclic DNA and an application thereof in highly metastatic triple-negative breast cancer. Background Art

[0002] Triple-negative breast cancer (TNBC) is a particularly aggressive type of breast cancer, accounting for approximately 10-15% of all breast cancer cases. Its main characteristics are the lack of expression of estrogen receptor (ER), progesterone receptor (PR), and epidermal growth factor receptor 2 (HER2), as well as poor differentiation and high recurrence rate. Compared with hormone receptor-positive or HER2-positive breast cancer, TNBC has limited response to targeted therapy and immunotherapy, with a median survival time of only 13 months. Therefore, innovative research methods are urgently needed to deeply explore the potential mechanisms of TNBC progression and develop more effective diagnosis and treatment strategies.

[0003] Extra-circular DNA (eccDNAs) refers to circular DNA molecules derived from chromosomes, with the number of base pairs ranging from hundreds to thousands. But once formed, they may be independent of chromosomal DNA. eccDNAs can carry complete genetic information, especially oncogenes with high copy numbers and transcription levels. Upregulation of oncogenes through eccDNAs contributes to tumor growth. Through pan-cancer analysis of ATAC sequencing libraries from 23 tumor types, more than 18,000 eccDNAs have been identified, many of which carry known oncogene drivers. In addition, studies have reported that in prostate cancer, there are a large number of eccDNAs, which act as mobile transcription enhancers and promote tumor progression. eccDNAs have also been widely found in 29 different types of cancer.

[0004] Although the relationship between eccDNAs and tumor progression has been studied to some extent, breast cancer patients, especially highly metastatic triple-negative breast cancer patients, and eccDNAs and their clinical significance still need further exploration, and the prediction sensitivity and accuracy of eccDNAs markers related to metastasis of highly metastatic triple-negative breast cancer need to be further improved. Screening and obtaining appropriate eccDNAs molecules abnormally expressed in highly metastatic triple-negative breast cancer as molecular markers for prognosis and diagnosis of highly metastatic triple-negative breast cancer, and using them as diagnostic targets for highly metastatic triple-negative breast cancer is an important direction for triple-negative breast cancer research. Summary of the invention

[0005] The purpose of the present invention is to provide an exocircular DNA and its application in highly metastatic triple-negative breast cancer, to achieve the monitoring progress and prognosis judgment of highly metastatic triple-negative breast cancer, to distinguish highly metastatic triple-negative breast cancer from low metastatic triple-negative breast cancer, to specifically detect highly metastatic triple-negative breast cancer, to provide a new therapeutic target for highly metastatic triple-negative breast cancer, and to effectively treat highly metastatic triple-negative breast cancer.

[0006] The present invention provides an exocyclic DNA, the exocyclic DNA is named GALNT3 circle , the nucleotide sequence is shown in SEQ ID NO:1.

[0007] The present invention also provides the use of the exocyclic DNA described in the above technical solution in preparing a product for regulating the expression level of the GALNT3 gene.

[0008] The present invention also provides the use of a substance for detecting the expression level of the exocyclic DNA or GALNT3 gene described in the above technical solution in the preparation of a product for monitoring the progression and / or judging the prognosis of highly metastatic triple-negative breast cancer.

[0009] Preferably, the expression level of the exocircular DNA or GALNT3 gene increases with the progression of the stage of highly metastatic triple-negative breast cancer;

[0010] The prognostic judgment includes one or more of the clinical outcome of the prognostic subject, the treatment effect of the prognostic subject, and the survival of the prognostic subject.

[0011] The present invention also provides the use of a substance for detecting the expression level of the exocyclic DNA or GALNT3 gene described in the above technical solution in the preparation of a product for diagnosing highly metastatic triple-negative breast cancer.

[0012] Preferably, the exocircular DNA or GALNT3 gene is significantly upregulated in patients with highly metastatic triple-negative breast cancer.

[0013] The present invention also provides the use of a substance for detecting the expression level of the exocyclic DNA or GALNT3 gene described in the above technical solution in the preparation of a product for distinguishing highly metastatic triple-negative breast cancer from low metastatic triple-negative breast cancer.

[0014] The present invention also provides the use of the substance for inhibiting the expression of the exocyclic DNA or GALNT3 gene described in the above technical solution in the preparation of a product for treating highly metastatic triple-negative breast cancer.

[0015] The present invention also provides shRNA for inhibiting the expression of the outer circular DNA or GALNT3 gene described in the above technical solution, wherein the shRNA includes shLig3-1 and / or shLig3-2;

[0016] The target sequence of shLig3-1 is shown in SEQ ID NO: 2;

[0017] The target sequence of shLig3-2 is shown in SEQ ID NO:3.

[0018] The present invention also provides the use of the shRNA described in the above technical solution in preparing a product for treating highly metastatic triple-negative breast cancer.

[0019] Beneficial effects:

[0020] The present invention analyzes highly metastatic triple-negative breast cancer cells and low metastatic triple-negative breast cancer cells and finds a differentially expressed exocircular DNA (GALNT3 circle ), compared with low metastatic triple-negative breast cancer cells, it is significantly upregulated in highly metastatic triple-negative breast cancer cells, and its nucleotide sequence is shown in SEQ ID NO: 1. The exocyclic DNA provided by the present invention can be used as a diagnostic marker for highly metastatic triple-negative breast cancer, accurately distinguishing highly metastatic triple-negative breast cancer from low metastatic triple-negative breast cancer, with strong specificity and high sensitivity; and provides a new therapeutic target for highly metastatic triple-negative breast cancer. The results of the embodiment show that by regulating the expression of the exocyclic DNA, the expression of the GALNT3 gene can be regulated, knocking down the exocyclic DNA can reduce the expression level of the GALNT3 gene, inhibiting the metastasis of highly metastatic triple-negative breast cancer, and overexpressing the exocyclic DNA can increase the expression level of the GALNT3 gene and promote the metastasis of highly metastatic triple-negative breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0022] Figure 1 The results of transwell assay for 231 and 231-H cells;

[0023] Figure 2 Results of tail vein lung metastasis of 231 and 231-H cells;

[0024] Figure 3 This is the eccDNA detection result of 231-H cells;

[0025] Figure 4 This is the result of transcriptome sequencing of 231-H cells;

[0026] Figure 5 It is the intersection of 231-H cell eccDNA detection and transcriptome sequencing;

[0027] Figure 6 For 231-H cells GALNT3 circle Sanger sequencing and gel image results;

[0028] Figure 7 The expression level of GALNT3 gene mRNA in 468, 231 and 231-H cells and the results of Western Blot detection;

[0029] Figure 8 The results of fluorescence in situ hybridization of 231 and 231-H cells;

[0030] Fig. 9 Knockdown of GALNT3 in 231-H cells circle The results of fluorescence in situ hybridization of the cells were analyzed;

[0031] Fig.10 Knockdown of GALNT3 in 231-H cells circle The expression level of GALNT3 gene mRNA and Western Blot detection results;

[0032] Fig.11 The expression levels of GALNT3 gene mRNA in different cells and the Western Blot detection results in Example 4;

[0033] Fig.12 The transwell detection results of different cells in Example 4;

[0034] Fig.13 The results of tail vein lung metastasis of different cells in Example 4;

[0035] Fig.14 GALNT3 in highly metastatic triple-negative breast cancer of different malignant degrees circle Results of fluorescence in situ hybridization detection (A) and scoring (B) of cells;

[0036] Fig.15 GALNT3 circle ROC curve for the diagnosis of highly metastatic triple-negative breast cancer;

[0037] Fig.16 The expression level of GALNT3 gene mRNA in EMT6 and 4T1 cells and the results of Western Blot detection;

[0038] Fig.17 The results of transwell assays of EMT6 and 4T1 cells in mice;

[0039] Fig.18 Knockdown of GALNT3 in 4T1 cells circle Post-GALNT3circle and GALNT3 gene mRNA expression levels and Western Blot results;

[0040] Fig.19 Knockdown of GALNT3 in 4T1 cells circle Then the results of transwell assay in mice;

[0041] in, Figures 1 to 19 In the table, * indicates P < 0.05; *** indicates P < 0.001; **** indicates P < 0.0001. DETAILED DESCRIPTION

[0042] The present invention provides an exocyclic DNA, the exocyclic DNA is named GALNT3 circle , the nucleotide sequence is shown in SEQ ID NO:1.

[0043] The present invention analyzes highly metastatic triple-negative breast cancer cells and low metastatic triple-negative breast cancer cells and finds that the above-mentioned exo-circular DNA is differentially expressed in highly metastatic triple-negative breast cancer cells and low metastatic triple-negative breast cancer cells, and is upregulated in highly metastatic triple-negative breast cancer cells, and the exo-circular DNA regulates the expression of the GALNT3 gene. Knocking down the exo-circular DNA can reduce the expression level of the GALNT3 gene, and overexpressing the exo-circular DNA can increase the expression level of the GALNT3 gene. Therefore, the use of the exo-circular DNA in the preparation of a product for regulating the expression level of the GALNT3 gene also belongs to the protection scope of the present invention. The accession number of the GALNT3 gene in the present invention in NCBI is NM_004482.4.

[0044] The present invention also provides the use of a substance for detecting the expression level of the exocyclic DNA or GALNT3 gene described in the above technical solution in the preparation of a product for monitoring the progression and / or prognosis of highly metastatic triple-negative breast cancer. As an embodiment, the expression level of the exocyclic DNA or GALNT3 gene shows an upward trend as the stage of highly metastatic triple-negative breast cancer progresses. As an embodiment, the prognosis includes one or more of the clinical outcome of the prognosis subject, the treatment effect of the prognosis subject, and the survival of the prognosis subject; as another embodiment, the prognosis includes the clinical outcome of the prognosis subject, the treatment effect of the prognosis subject, and the survival of the prognosis subject.

[0045] The present invention also provides the use of a substance for detecting the expression level of the exocyclic DNA or GALNT3 gene described in the above technical solution in the preparation of a product for diagnosing highly metastatic triple-negative breast cancer. As an embodiment, the exocyclic DNA or GALNT3 gene is significantly upregulated in patients with highly metastatic triple-negative breast cancer.

[0046] The present invention also provides the use of a substance for detecting the expression level of the exocyclic DNA or GALNT3 gene described in the above technical solution in the preparation of a product for distinguishing highly metastatic triple-negative breast cancer from low metastatic triple-negative breast cancer.

[0047] The present invention also provides the use of the substance for inhibiting the expression of the exocyclic DNA or GALNT3 gene described in the above technical solution in the preparation of a product for treating highly metastatic triple-negative breast cancer.

[0048] As an embodiment, the product includes a diagnostic agent, a test kit, a chip, a test paper or a well plate.

[0049] In the present invention, as an embodiment, the substance that inhibits the expression of exocyclic DNA or GALNT3 gene includes shRNA; the shRNA includes shLig3-1 and / or shLig3-2, the target sequence of the shLig3-1 is shown in SEQ ID NO:2, and the target sequence of the shLig3-2 is shown in SEQ ID NO:3.

[0050] The present invention also provides shRNA for inhibiting the expression of the outer circular DNA or GALNT3 gene described in the above technical solution, wherein the shRNA includes shLig3-1 and / or shLig3-2; the target sequence of the shLig3-1 is shown in SEQ ID NO: 2; the target sequence of the shLig3-2 is shown in SEQ ID NO: 3.

[0051] The present invention utilizes the shRNA to knock down the expression of the outer circular DNA, thereby reducing the expression level of the GALNT3 gene, and treating highly metastatic triple-negative breast cancer. Therefore, the use of the shRNA in the preparation of a product for treating highly metastatic triple-negative breast cancer also falls within the protection scope of the present invention.

[0052] In order to further illustrate the present invention, the following is a schematic diagram of an outer ring GALNT3 provided by the present invention in combination with the accompanying drawings and embodiments. circle The invention and its application in triple-negative breast cancer are described in detail, but they should not be understood as limiting the scope of protection of the invention.

[0053] Example 1

[0054] 1. Referring to the prior art (Wu R, Li K, Yuan M, et al. Nerve growth factor receptor increases the tumor growth and metastatic potential of triple-negative breast cancer cells[J]. Oncogene, 2021, 40(12): 2165-2181.), highly metastatic triple-negative breast cancer cells were prepared and recorded as 231-H.

[0055] 2. According to the conventional transwell experimental steps (Wu R, Li K, Yuan M, et al. Nerve growth factor receptor increases the tumor growth and metastatic potential of triple-negative breast cancer cells [J]. Oncogene, 2021, 40 (12): 2165-2181), transwell migration experiments were performed on low metastatic triple-negative breast cancer cells (MDA-MB-231, 231) and highly metastatic triple-negative breast cancer cells (231-H) obtained in step 1, respectively. Pictures were taken under a fluorescence microscope, and cell counting was performed using Image J. The results showed that 231-H had stronger migration ability than 231 ( Figure 1 ).

[0056] 3. According to the conventional experimental steps (Wu R, Li K, Yuan M, et al. Nerve growth factor receptor increases the tumor growth and metastatic potential of triple-negative breast cancer cells [J]. Oncogene, 2021, 40 (12): 2165-2181.), tail vein lung metastasis experiments were performed on low metastatic triple-negative breast cancer cells (MDA-MB-231, 231) and highly metastatic triple-negative breast cancer cells obtained in step 1 (231-H). After 28 days, photos were taken under a fluorescence microscope to observe the metastasis formed in the lungs and calculate the fluorescence area. The results showed that 231-H has a stronger metastatic ability than 231 ( Figure 2 ).

[0057] 4. Referring to (Cen Y, Fang Y, et, al. Global characterization of extrachromosomalcircular DNAs in advanced high grade serous ovarian cancer [J]. Cell death and disease, 2022, 13: 342), the low metastatic triple-negative breast cancer cells (MDA-MB-231, 231) and the highly metastatic triple-negative breast cancer cells (231-H) obtained in step 1 were analyzed for eccDNAs and transcriptomes, and the intersection of eccDNA and transcriptome sequencing was taken. The results are as follows Figures 3 to 5 shown.

[0058] according to Figures 3 to 5 It can be seen that compared with 231 cells, 231-H cells have upregulated eccDNA.

[0059] 5. Referring to the prior art (Cen Y, Fang Y, et, al. Global characterization of extrachromosomal circular DNAs in advanced high grade serous ovarian cancer [J]. Cell death and disease, 2022, 13: 342), the eccDNA of the highly metastatic triple-negative breast cancer cells (231-H) in step 4 was amplified inwardly and outwardly, and the amplified products were subjected to agarose gel electrophoresis. The results are as follows Figure 6 As shown; among them, bands 1, 2, 3, and 4 are respectively the enriched eccDNA, genomic DNA, control without template, and eccDNA after rolling circle amplification. The target band in the agarose was cut off for gel recovery, and the DNA was eluted and purified for sanger sequencing. The results showed that the gene chr2:165775969-165777061 had a splicing site of AGCC after sanger sequencing and the sequence was roughly in line with expectations, so it was the target circular. The exact position coordinates were verified to be chr2:165775969-165777062. The sequence of the PCR product (i.e., the head-to-tail connection of the target circular DNA fragment and the trans-splicing site) is as follows: GGTACCCGTCTTTCTAGACCCCACTAAATGCTACTAAAGAAATTTAAAA GAGGAATAAATTCATGAGGGAGAGGATAGTGGGAGAAGAGATATCCGAGA AG A CCATATGATAAAATTATTTATATACACATTTAAAAATACAAAGGTAAGCTAAAAGCTGGAAGATGACATTGGTCATGCATACACAGTTGTCCCTTGGTATGTGGGAGGGATTGGTTCCAGGACCCTCCATTGGATATCAAAACCATGGATGCAAAAAA (SEQ ID NO: 1); wherein the underlined bases represent the connection site ( Figure 6 ).

[0060] 6. Referring to the prior art (Wu R, Li K, Yuan M, et al. Nerve growth factor recept or increases the tumor growth and metastatic potential of triple-negative breast cancer cells [J]. Oncogene, 2021, 40 (12): 2165-2181.), low metastatic triple-negative breast cancer cells (MDA-MB-468, 468), low metastatic triple-negative breast cancer cells (MDA-MB-231, 231) and highly metastatic triple-negative breast cancer cells (231-H) obtained in step 1 were cultured respectively. After 24 hours of culture, the expression levels of GALNT3 gene mRNA in the three types of triple-negative breast cancer cells were detected respectively, and Western Blot analysis was performed. The results showed that there was no significant difference in the expression level of GALNT3 gene mRNA in 468 and 231. Compared with 468 and 231, the expression levels of GALNT3 gene mRNA and protein in 231-H and 468 were significantly increased ( Figure 7 )

[0061] 7. According to the instructions of the FISH in situ hybridization kit, the low metastatic triple-negative breast cancer cells (MDA-MB-231, 231) and the highly metastatic triple-negative breast cancer cells (231-H) obtained in step 1 were cultured respectively. After 24 hours of culture, fluorescence in situ hybridization (FISH) detection was performed. The results showed that the outer ring GAL NT3 circle Upregulated in highly metastatic triple-negative breast cancer cell line 231-H ( Figure 8 ).

[0062] Example 2

[0063] Interference or overexpression of viral envelope

[0064] 1. Interference with virus coating

[0065] (1) Referring to the target sequences of shLig3-1 and shLig3-2 in the prior art (Jin W, Xu Z, Song Y and Chen F. Extrachromosomalcircular DNA promotes prostate cancer progression through the FAM848 / CDK N1B / MYC / WWP1 axis. Cellular & Molecular Biology Letters. 2024. 29: 103.), Wuhan Chuling Bioengineering Co., Ltd. was commissioned to design interference plasmids based on the target sequences; wherein the nucleotide sequence of shLig3-1 targeting the GALNT3 gene is 5'-CCGGATCATGTTCTCAGAAAT-3' (SEQ ID NO: 2); the nucleotide sequence of sh Lig3-2 targeting the GALNT3 gene is 5'-GCCCACTTTAAGGACTACATT-3' (SEQ ID NO: 3); the nucleotide sequence of the blank control shCtrl is 5'-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG-3' (SEQ ID NO: 4). ID NO:4).

[0066] (2) The lentiviral packaging plasmids pMD2.G, pMDLg, pRSV and the interfering plasmid obtained in step (1) were mixed in serum-free DMEM at a mass ratio of 1.5:2.5:1:4 to obtain a plasmid for transfection.

[0067] (3) 293T cells were cultured in a 10 cm culture dish until the confluency reached 70-80%, and the plasmid used for transfection in step (2) was transfected into the 293T cells using the transfection reagent Lipofectamine 3000 according to the instruction manual. The culture was continued at 37° C. and 5% CO2 for 48-72 hours, and the culture supernatant was collected to obtain the interfering virus solution.

[0068] 2. Overexpression virus coating

[0069] (1) Wuhan Chuling Bioengineering Co., Ltd. was commissioned to obtain an overexpression plasmid from the gene sequence encoding GALNT3; among them, the transcript ID encoding human GALNT3 in NCBI is shown as NM_004482.4.

[0070] (2) The lentiviral packaging plasmids pMD2.G, pMDLg, pRSV and the overexpression plasmid obtained in step (1) were mixed in serum-free DMEM at a mass ratio of 1.5:2.5:1:4 to obtain a plasmid for transfection.

[0071] (3) 293T cells were cultured in a 10 cm culture dish until the confluence reached 70-80%, and the plasmid transfected in step (2) was transfected into the 293T cells using the transfection reagent Lipofectamine 3000 according to the instructions. The culture was continued at 37° C. and 5% CO2 for 48-72 hours, and the culture supernatant was collected to obtain the overexpression lentivirus solution.

[0072] Example 3

[0073] 1. Cell Culture Preparation

[0074] 18 to 24 h before transfection, the 231-H cells obtained in Example 1 were cultured at 2×10 5 Cells were seeded in 6-well plates at a density of 2 mL per well and cultured overnight in a 5% CO2 incubator to reach 50% confluency.

[0075] 2. Preparation of Stable Transfectants

[0076] Add 2 mL of the interfering virus solution obtained in Example 2 to the cells in step 1, remove the virus solution and replace with fresh culture medium after 24 to 48 hours of culture, add 2 μg / mL of puromycin after 24 hours, and select cells with antibiotic resistance as positive cells.

[0077] 3. Perform fluorescence in situ hybridization (FISH) detection on the obtained positive cells in the manner of Example 1 to analyze GALNT3 circle The mRNA expression levels of Lig3 and GALNT3 were analyzed by Western Blot. The results showed that after knocking down Lig3, the mRNA levels of Lig3 and GALNT3 circle The level dropped significantly ( Fig. 9 ), and the expression levels of GALNT3 gene mRNA and protein were significantly downregulated, indicating that GALNT3 circle Regulates the transcription level of GALNT3 gene ( Fig.10 ).

[0078] Example 4

[0079] 1. Cell Culture Preparation

[0080] 18 to 24 h before transfection, the 231-H cells obtained in Example 1 were cultured at 2×10 5 Cells were seeded in 6-well plates at a density of 2 mL per well and cultured overnight in a 5% CO2 incubator to reach 50% confluency.

[0081] 2. Preparation of Stable Transfectants

[0082] (1) 2 mL of the interfering virus solution obtained by using shLig3-1 or shCtrl in Example 2 was added to the cells in step 1, respectively. After culturing for 24 to 48 hours, the virus solution was removed and replaced with fresh culture medium. After 24 hours, 2 μg / mL of puromycin was added to screen cells with antibiotic resistance, which were positive cells and recorded as shLig3-1 and shCtrl, respectively.

[0083] (2) Positive cells shLig3-1 were cultured at 2×10 5 The cells were inoculated in a 6-well plate at a density of 10 cells / 2 mL. The cells were cultured overnight in a 5% CO2 incubator to reach a confluency of 50%, and the overexpressed virus solution or the empty virus solution obtained in Example 2 was added respectively. After culturing for 24 to 48 hours, the virus solution was removed and replaced with fresh culture medium. After 24 hours, 2 μg / mL of puromycin was added, and cells with antibiotic resistance were screened as positive cells, which were recorded as shLig3-1+oeCtrl and shLig3-1+oeGALNT3, respectively.

[0084] 3. Referring to the method of Example 1, positive cells shLig3-1, shCtrl, shLig3-1+oeCtrl and shLig3-1+oeGALNT3 were cultured respectively, the mRNA expression levels of the GALNT3 gene in different cells were detected, and Western Blot analysis was performed. The results showed that compared with shCtrl, the mRNA expression level of the GALNT3 gene in shLig3-1 was significantly downregulated; there was no significant difference in the mRNA expression level of the GALNT3 gene between shLig3-1 and shLig3-1+oeCtrl, compared with shLig3-1, the mRNA expression level of the GALNT3 gene in shLig3-1+oeGALNT3, and there was no significant difference in the mRNA expression level of the GALNT3 gene between shLig3-1+oeGALNT3 and shCtrl ( Fig.11 ).

[0085] 4. Referring to the method of Example 1, transwell migration experiments were performed on positive cells shCtrl, shLig3-1, shLig3-1+oeCtrl and shLig3-1+oeGALNT3, and photos were taken under a fluorescence microscope and cell counting was performed using Image J. The results showed that disruption of GALNT3 circle After that, the migration ability was significantly decreased. On this basis, after overexpression of GALNT3, the migration ability was significantly increased ( Fig.12 ).

[0086] 5. Referring to the method of Example 1, tail vein lung metastasis experiments were performed on positive cells shLig3-1, shCtrl, shLig3-1+oeCtrl and shLig3-1+oeGALNT3, and photos were taken under a fluorescence microscope 28 days later to observe the metastasis formed in the lungs and calculate the ratio of the fluorescent area to the entire lung area. The results showed that the disruption of GALNT3 circle After the overexpression of GALNT3, the metastatic ability was significantly increased ( Fig.13 ).

[0087] 6. The tissue chip purchased from Shanghai Xinchao Biotechnology Co., Ltd. (HBreD180Bc01-2, including adjacent and stage I-III triple-negative breast cancer tissues) was subjected to fluorescence in situ hybridization (FISH) detection according to the method of Example 1. The results showed that the outer ring GALNT3 circle It is specifically highly expressed in triple-negative breast cancer and its high expression is positively correlated with the malignancy of the tumor. Knockdown of the outer ring GALNT3 circle Or overexpression of extra-circular GALNT3 circle Can effectively inhibit or promote tumor metastasis ( Fig.14 ).

[0088] Example 5

[0089] Sensitive and specific detection

[0090] To evaluate the external ring GALNT3 circle For the prediction of highly metastatic triple-negative breast cancer, refer to the instructions of the FISH in situ hybridization kit, perform FISH experiments, and establish the outer ring GALNT3 through GraphPadPrism 8.0 circle The ROC curve showed that the area under the curve was 0.918, the cutoff point was 1.5, the 95% confidence interval was 0.870-0.965, the sensitivity was 92.66%, the specificity was 97.56%, and the P value was <0.0001 ( Fig.15 ).

[0091] Example 6

[0092] 1. Referring to the prior art (Wu R, Li K, Yuan M, et al. Nerve growth factor receptor increases the tumor growth and metastatic potential of triple-negative breast cancer cells [J]. Oncogene, 2021, 40 (12): 2165-2181.), mouse triple-negative breast cancer cells EMT6 (low metastatic cells) and mouse triple-negative breast cancer cells 4T1 (high metastatic cells) were cultured respectively, the expression level of GALNT3 gene mRNA in the two mouse breast cancer cells was detected, and Western Blot analysis was performed. The results showed that there was a significant difference in the expression level of GALNT3 gene mRNA in the two mouse breast cancer cells, and the expression level of GALNT3 gene mRNA in mouse breast cancer cells 4T1 was significantly higher than that in mouse breast cancer cells EMT6 ( Fig.16 ).

[0093] 2. Referring to the prior art (Wu R, Li K, Yuan M, et al. Nerve growth factor receptor increases the tumor growth and metastatic potential of triple-negative breast cancer cells [J]. Oncogene, 2021, 40 (12): 2165-2181.), tail vein lung metastasis experiments were performed on mouse triple-negative breast cancer cells EMT6 (low metastatic cells) and mouse triple-negative breast cancer cells 4T1 (high metastatic cells), and photos were taken under a fluorescence microscope to calculate the photon flux (p / s / cm 2 / sr). The results showed that the metastatic ability of mouse triple-negative breast cancer cell 4T1 was significantly higher than that of mouse triple-negative breast cancer cell EMT6 ( Fig.17 ).

[0094] Example 7

[0095] 1. Cell Culture Preparation

[0096] 18-24 h before transfection, mouse triple-negative breast cancer cells 4T1 were cultured at 2×10 5 Cells were seeded in 6-well plates at a density of 2 mL per well and cultured overnight in a 5% CO2 incubator to reach 50% confluency.

[0097] 2. Preparation of Stable Transfectants

[0098] (1) Wuhan Chuling Bioengineering Co., Ltd. was commissioned to design interference plasmids and blank plasmids based on the target sequence of the mouse GALNT3 gene; the nucleotide sequence of shLig3 targeting the mouse GALNT3 gene is 5'-CCACCGAACAGAAGCTCAATA-3' (SEQ ID NO: 5);

[0099] (2) Referring to the method of Example 2, an interfering virus solution and a control virus solution for mice were prepared;

[0100] (3) Add 2 mL of the interfering virus solution and the control virus solution obtained in step (2) to the cells in step 1, respectively. After 24 to 48 hours, remove the virus solution and replace it with fresh culture medium. After 24 hours, add 2 μg / mL of puromycin to screen cells with antibiotic resistance, which are positive cells and are recorded as shLig3 and shCtrl, respectively.

[0101] (4) Referring to the steps of Example 4, a GALNT3 overexpression (the transcript ID encoding mouse GALNT3 in NCBI is accession number NM_015736.2) cell line (denoted as shLig3+oeCtrl) and an empty vector overexpression cell line (denoted as shLig3+oeGALNT3) were prepared based on the shLig3 stable cell line;

[0102] 3. After culturing the positive cells shCtrl, shLig3, shLig3+oeCtrl and shLig3+oeGALNT3 for 1 day, the mRNA expression levels of the GALNT3 gene in different cells were detected according to the method of Example 6, and Western Blot analysis was performed. The results showed that compared with shCtrl, the mRNA expression level of the GALNT3 gene was significantly downregulated after the destruction of eccDNA in shLig3 ( Fig.18 ), after knocking out the circular DNA in 4T1, the expression of GALNT3 increased after overexpression of GALNT3.

[0103] 4. Referring to the method of Example 6, shCtrl, shLig3, shLig3+oeCtrl and shLig3+oeGALNT3 were injected into the tail vein for lung metastasis and photographed under a fluorescence microscope to calculate the photon flux (p / s / cm 2 / sr). The results showed that the GALNT3 outer ring of mouse triple-negative breast cancer cell 4T1 circle The metastatic ability of GALNT3 gene was significantly reduced after its expression was inhibited. Fig.19 ).

[0104] According to the above content, it can be seen that the outer circular DNA (GALNT3 circle) can be used as a diagnostic marker for highly metastatic triple-negative breast cancer to distinguish highly metastatic triple-negative breast cancer from low metastatic triple-negative breast cancer. It has strong specificity and high sensitivity, and provides a new target for the treatment of highly metastatic triple-negative breast cancer.

[0105] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An exocyclic DNA, characterized in that The outer circular DNA is named GALNT3 circle , the nucleotide sequence is shown in SEQ ID NO:

1.

2. Use of the exocyclic DNA according to claim 1 in preparing a product for regulating GALNT3 gene expression.

3. Use of a substance for detecting the expression level of the exocyclic DNA or GALNT3 gene according to claim 1 in the preparation of a product for monitoring the progression and / or predicting the prognosis of highly metastatic triple-negative breast cancer.

4. The use according to claim 3, characterized in that: The expression level of the exocircular DNA or GALNT3 gene increases with the progression of the stage of highly metastatic triple-negative breast cancer; The prognostic judgment includes one or more of the clinical outcome of the prognostic subject, the treatment effect of the prognostic subject, and the survival of the prognostic subject.

5. Use of a substance for detecting the expression level of the exocyclic DNA or GALNT3 gene according to claim 1 in the preparation of a product for diagnosing highly metastatic triple-negative breast cancer.

6. The use according to claim 5, characterized in that: The exocircular DNA or GALNT3 gene is significantly upregulated in patients with highly metastatic triple-negative breast cancer.

7. Use of a substance for detecting the expression level of the exocyclic DNA or GALNT3 gene according to claim 1 in preparing a product for distinguishing highly metastatic triple-negative breast cancer from low metastatic triple-negative breast cancer.

8. Use of the substance for inhibiting the expression of the exocyclic DNA or GALNT3 gene according to claim 1 in the preparation of a product for treating highly metastatic triple-negative breast cancer.

9. The shRNA for inhibiting the expression of the outer circular DNA or GALNT3 gene according to claim 1, characterized in that: The shRNA includes shLig3-1 and / or shLig3-2; The target sequence of shLig3-1 is shown in SEQ ID NO: 2; The target sequence of shLig3-2 is shown in SEQ ID NO:

3.

10. Use of the shRNA according to claim 9 in preparing a product for treating highly metastatic triple-negative breast cancer.

Images