SNP (Single Nucleotide Polymorphism) marker related to upland cotton plant type and application

Abstract

The invention provides an SNP marker related to an upland cotton plant type and application, and relates to the technical field of molecular marker assisted breeding, the SNP marker is located at the 14762561th basic group of an 18th chromosome D05 of an upland cotton genome, in an upland cotton plant with a compact plant type and a tower type (shorter fruit node), the nucleotide type of the SNP marker is T, and the nucleotide type of the SNP marker is T; in upland cotton plants with loose and cylindrical plant types (long fruit nodes), the nucleotide type of the SNP marker is G. By detecting the genotype of the SNP marker, the plant type (fruit knot length) of the to-be-detected upland cotton germplasm can be quickly and accurately judged, so that the variety with short fruit knot and compact plant type can be quickly and reliably identified on the gene level without being influenced by the environment and the growth and development period, and the breeding accuracy and efficiency of the variety with short fruit knot and compact plant type are improved; the SNP variation site provided by the invention can be used as a target of genetic engineering breeding, and a rapid and effective way is provided for genetic improvement of upland cotton fruit node length traits.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and in particular to a SNP marker associated with upland cotton plant type and an application thereof. Background Art

[0002] The plant type of upland cotton is an important factor affecting mechanization and yield. Therefore, in the process of upland cotton breeding, compact plant type is one of the important breeding goals. The length of upland cotton fruit nodes refers to the distance between bolls on the fruit branches of the plant and between the bolls and the main stem of the plant. Shorter fruit nodes can make the plant more compact, which helps to increase the planting density and improve the photosynthesis efficiency, thereby increasing the biomass and yield of the crop. Compact plant type and shorter fruit nodes also help to adapt to mechanized operations, because the space between plants is smaller, which is more suitable for mechanical operation. Therefore, the development of short fruit node genes and related molecular markers has important research value and production significance.

[0003] Using traditional breeding methods such as hybrid breeding, it is necessary to go through multiple generations of self-pollination and screening to obtain upland cotton varieties with stable short fruit node traits, which consumes a lot of manpower and material resources. In addition, traditional breeding relies on the genetic variation of existing varieties, and the selectable parent resources are relatively limited. The selection of varieties relies on the experience of breeders and the observation of phenotypes to select excellent traits. The lack of precise operation and control at the genetic level also makes the breeding process relatively blind and unpredictable.

[0004] Marker-assisted breeding (MAS) is a method that uses molecular markers that are closely linked to target traits to assist traditional breeding. Its core principle is to identify and select plant varieties with desired genetic characteristics through molecular marker technology. SNP markers are a type of molecular marker, which refers to DNA sequence polymorphism caused by the variation of a single base on the genomic DNA sequence. SNPs are widely distributed in the genome and are huge in number. SNPs can reflect the differences in nucleotide sequences at the DNA level and are not affected by developmental stages, environmental factors, or whether genes are expressed. They can be stably reflected and inherited in the genome of organisms. Using SNPs that are closely linked to genes that affect target traits as molecular markers can track target genes, more efficiently perform assisted selection and multi-gene aggregation, and screen individuals carrying target genes, thereby significantly improving breeding efficiency and accuracy. Summary of the invention

[0005] In view of the problems existing in the traditional breeding process, the present invention provides a SNP marker D05:14762561, which is highly linked to the length trait of upland cotton fruit nodes and is a diallel SNP with a polymorphic genotype of G / T. Upland cotton germplasm with the TT genotype has shorter fruit nodes than germplasm with the GG genotype. The shorter the fruit node length, the more compact the plant type of the upland cotton is, which is specifically manifested as a tower shape. The longer the fruit node length of the fruit branch, the looser the plant type of the upland cotton is, which is specifically manifested as a barrel shape. Therefore, by using the SNP marker to assist in the selection of varieties with short fruit nodes, individuals carrying the target gene can be screened out at the early gene level, and undesirable plants can be eliminated in advance without waiting for phenotypic identification in the adult stage, thereby reducing breeding costs and improving breeding accuracy and efficiency.

[0006] To achieve the above object, the present invention specifically adopts the following technical solutions: The first aspect of the present invention provides a SNP marker associated with the plant type of upland cotton, wherein the SNP marker is located at the 14762561th base of chromosome 18 D05 of the upland cotton genome, wherein in upland cotton plants with compact plant type, the nucleotide type of the SNP marker is T, and in upland cotton plants with loose plant type, the nucleotide type of the SNP marker is G.

[0007] As a further illustration of the present invention, the compact upland cotton plant is specifically tower-shaped, and the loose upland cotton plant is specifically cylinder-shaped.

[0008] As a further illustration of the present invention, in upland cotton plants with short fruiting branches and fruiting nodes, the nucleotide type of the SNP marker is T, and in upland cotton plants with long fruiting branches and fruiting nodes, the nucleotide type of the SNP marker is G.

[0009] As a further illustration of the present invention, the SNP marker is located in the promoter region 2000 bp upstream of the gene Ghi_D05G08181.

[0010] As a further illustration of the present invention, the nucleotide sequence of the 2000 bp promoter upstream of the gene Ghi_D05G08181 is shown in SEQ ID NO.1.

[0011] As a further illustration of the present invention, the nucleotide sequence of the gene Ghi_D05G08181 is shown in SEQ ID NO.2.

[0012] The second aspect of the present invention provides a detection primer for detecting the SNP marker described in any of the above items, wherein the detection primer comprises two upstream primers and one downstream primer, wherein the nucleotide sequences of the two upstream primers are respectively shown in SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.5.

[0013] A third aspect of the present invention provides a kit for detecting plant type of upland cotton, the kit comprising the above-mentioned detection primers and PCR amplification reagents.

[0014] The fourth aspect of the present invention provides the use of the above-mentioned SNP marker or the above-mentioned detection primer or the above-mentioned kit in the detection of upland cotton plant type.

[0015] A fifth aspect of the present invention provides a method for detecting plant type of upland cotton, comprising the following steps: Step 1: Extract DNA from the upland cotton sample to be tested; Step 2: using the above detection primers to perform PCR amplification based on KASP technology on the DNA of the upland cotton sample to be tested, to obtain a PCR amplification product; Step 3: Perform fluorescence detection and analysis on the PCR amplification product. When FAM fluorescence is generated, it indicates that the genotype of the upland cotton sample at the above-mentioned SNP marker is GG. When HEX fluorescence is generated, it indicates that the genotype of the upland cotton sample at the above-mentioned SNP marker is TT. Among them, the GG genotype is an upland cotton variety with a loose plant type, and the TT genotype is an upland cotton variety with a compact plant type.

[0016] Compared with the prior art, the present invention has the following beneficial technical effects: The present invention provides a SNP marker related to plant type of upland cotton (closely associated with fruit node length): D05:14762561. The SNP is closely related to the fruit node length trait of upland cotton. The fruit node length of the fruit branch of the variety with genotype TT is significantly shorter than that of the variety with genotype GG. And it shows extremely significant differences in three environments, indicating that the SNP is relatively reliable and stable, and can be used as a molecular marker highly linked to the plant type (fruit node length) of upland cotton for molecular assisted breeding, and breeding materials with compact plant type (shorter fruit node length). By detecting the genotype of the SNP marker, the plant type (fruit node length) of the upland cotton germplasm to be tested can be quickly and accurately determined. Specifically, when the genotype of the upland cotton germplasm to be tested at the SNP is GG, it is determined to be a variety with a loose plant type (longer fruit node), and when the genotype of the upland cotton germplasm to be tested at the SNP is TT, it is determined to be a variety with a compact plant type (shorter fruit node). The present invention can quickly and reliably distinguish or identify varieties with short fruit nodes from the gene level, and is not affected by the environment and the growth and development period, which greatly accelerates the breeding process and improves the accuracy and efficiency of short fruit node variety selection. In addition, the SNP variation site provided by the present invention can be used as a target for genetic engineering breeding, and the GG genotype can be mutated into the TT genotype by mutation, editing, etc., which can provide a new, fast and effective way for the genetic improvement of upland cotton fruit node traits.

[0017] Other features and advantages of the technical solution will be described in the subsequent description, and partly become apparent from the description, or understood by implementing the technical solution. The purpose and other advantages of the technical solution can be achieved and obtained through the structures specifically pointed out in the written description and the drawings.

[0018] The technical solution of the present technical solution is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings are used to provide a further understanding of the technical solution and constitute a part of the specification. Together with the embodiments of the technical solution, they are used to explain the technical solution and do not constitute a limitation of the technical solution. In the accompanying drawings: Figure 1 This is a box plot of the correlation between 343 materials and upland cotton plant type. In the figure, 23_XJ, 24_AY, and 24_XJ represent Bortala Prefecture, Xinjiang in 2023, Anyang, Henan in 2024, and Bortala Prefecture, Xinjiang in 2024, respectively; BLUE represents the best linear unbiased prediction (BLUE) value of the three environments; LJJ1 represents the distance between the first boll on the third fruit branch and the main stem.

[0020] Figure 2 It is the structure diagram of gene Ghi_D05G08181 and SNP: D05:14762561.

[0021] Figure 3 This is the KASP typing diagram of 343 materials. Red is the GG homozygous genotype (237 copies), blue is the TT homozygous genotype (106 copies), and black is water (control).

[0022] Figure 4 The results of comparing the fruit branch lengths of GG and TT genotype upland cotton germplasms are shown in the figure. Only 20 samples are shown.

[0023] Figure 5 The results are a comparison of the plant types of GG and TT genotype upland cotton germplasm. DETAILED DESCRIPTION

[0024] The preferred embodiments of the present technical solution are described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present technical solution, and are not used to limit the present technical solution.

[0025] 1. Obtaining SNP marker loci related to upland cotton plant type.

[0026] 1. Sources of materials and investigation methods The present invention uses 343 core germplasms of upland cotton for phenotypic investigation and genotyping. The materials are provided by the National Upland Cotton Germplasm Resources Medium-term Bank of the Upland Cotton Research Institute of the Chinese Academy of Agricultural Sciences. These materials mainly come from foreign countries and the Yangtze River, Yellow River, Liaohe River basins, etc. in China. They have a wide range of sources and a long time span, which is conducive to analyzing the genetic diversity of upland cotton germplasm resources from the whole genome level.

[0027] Because the length of the fruit nodes of the fruit branches in the middle of cotton (3-5) is closer to the average level of the whole plant, the correlation with the average level of the whole plant is higher, and the coefficient of variation of the fruit node length is smaller, it is more stable. The third fruit branch fruit node length survey experiment of 343 materials was investigated in Bortala Prefecture, Xinjiang and Anyang, Henan for two years, with a total of 3 environments: Bortala Prefecture, Xinjiang in 2023, Anyang, Henan in 2024, and Bortala Prefecture, Xinjiang in 2024, respectively referred to as: 23_XJ, 24_AY, 24_XJ. Two replicates were set for each environment, and 5 consecutive plants with normal growth and development were selected in each replicate except the first one in the side row for measurement. The measurement method is: the distance between the first boll of the third fruit branch and the main stem, and the distance between the second boll and the first boll of the third fruit branch. The average value of the 5 plants was taken as the phenotypic value of the variety under the replicate, and the average value of the 3 replicates was taken as the phenotypic value of the variety under the environment. And the best linear unbiased prediction (BLUE) value was calculated. The analysis was based on the lme4 (Bates et al., 2015) and emmeans packages (Lenth, 2020) in the R language environment.

[0028] 2. Sequencing and genotyping This study is based on the detection data of 380 upland cotton germplasms using the CottonSNP80K chip. According to the following standards: call rate>0.99, MAF>0.2, heterozygosity<0.05, and distribution density 400kb / SNP, 4857 candidate extension sites were screened, and 3948 sites were screened from the CottonSNP63K chip according to the following standards: polymorphism (DDfre)>0.05, call rate>0.95, signal value DD R meDn value≥0.4, BB meDn value≥0.4, LD screening r2≥0.8 (500kb). In addition, 257 publicly published GWAS sites related to yield, quality, plant type, and growth period were summarized, and finally a set of 8347 sites with a wide range of sources and more complete information was obtained. The 8347 SNP sites covered a total of 1,934,654,758 bp of the genome, with an average marker density of 1 variant detected every 231,778 base pairs.

[0029] 3. GWAS Analysis GWAS analysis was performed using the third fruit node length phenotypic values ​​of 343 upland cotton materials in three environments and the best linear unbiased prediction (BLUE) of the three environments combined with 7779 SNP loci covering the entire genome of upland cotton. Three analysis software were used: GAPIT, rMVP, gemma. The model used was MLM (Mixed Linear Model), and the threshold line was set to 1 / number of markers. To ensure the stability of the model and SNP loci, the GWAS results were screened and stable SNPs that could be detected in at least two software and at least two environments were selected. The results showed that SNP: D05:14762561 was closely related to the phenotypic values ​​and best linear unbiased prediction (BLUE) values ​​of the first section of the third fruit branch length of 343 materials in three environments, with the same trend, and the differences between different genotypes of SNP were significant. In plants with shorter first fruit nodes, the nucleotide of the SNP variant is T (represented as 1), and in plants with longer first fruit nodes, the nucleotide of the SNP variant is G (represented as 0) (e.g. Figure 1 as shown).

[0030] This SNP is located at base 14762561 of chromosome 18 (D05) of upland cotton, at position 1505 in the 2000 bp upstream promoter of gene Ghi_D05G08181 (e.g. Figure 2As shown, the position of the SNP is marked in red). The 14762561st base is replaced by G to T, which is represented by G / T (reference genome: Gossypium hirsutum (AD1) 'TM-1' genome WHU_v1). It is a two-positioned polymorphic SNP site. Among them, the nucleotide sequence of the 2000bp promoter upstream of the Ghi_D05G08181 gene is shown in SEQ ID NO.1, and the full-length nucleotide sequence of the Ghi_D05G08181 gene is shown in SEQ ID NO.2.

[0031] 2. Genotyping based on competitive allele-specific polymerase chain reaction KASP (Kompetitive AlleleSpecific PCR) technology.

[0032] 1. KSAP Primer Design Extract the SNP: D05:14762561, that is, the sequence of 100bp upstream and downstream of the 14762561th base of chromosome D05 (excluding the SNP), and organize it into the following format: > D05:14762561 TTATCATTATACCAAACAAAATTTCATTGACACCAAAAACAAAATGTTATGCGAAATCATCATGGGATTTTCACCACATCTTCCAAATGATAAAATGTTA[G / T]ATCATACAAACAAAAAGATGAGCAACAAGGCTTTATTAACTTGAACCTATCTTTCTCTCTAAGTATAGACTGTTGACCTCTGAACAAAAGGAACTCAAAT, where [G / T] is the polymorphic genotype of the SNP. SNPWay Submit and design primers in, including two forward primers (upstream primers), with a linker sequence at the 5' end, as shown in SEQ ID NO. 3 and SEQ ID NO. 4, and the 3' end is the polymorphic genotype G or T of SNP: D05:14762561, as shown in SEQ ID NO. 3 and SEQ ID NO. 4. One reverse universal primer (downstream primer) is shown in SEQ ID NO. 5.

[0033] 2. The KASP genotyping of 343 materials was performed using the primer combination, including the following steps: (1) DNA was extracted from 343 upland cotton materials used for KSAP typing.

[0034] (1-1) Take a single shelled upland cotton seed and place it in a 2 ml centrifuge tube. Add two 4 mm steel balls and grind it into powder.

[0035] (1-2) Add 800 μl of preheated SDS extraction solution (1% SDS, 0.01% EDTA, 0.705 mol / L NaCl, 0.05 mol / L Tris-HCl, 0.5% sorbitol, 1% PVP, 1% β-mercaptoethanol) to the centrifuge tube, vortex to mix, and incubate at 65°C in a water bath for 30 min, inverting to mix every 10 min.

[0036] (1-3) Add 800 μl of a mixture of phenol, chloroform and isoamyl alcohol (volume ratio 25:24:1) to a centrifuge tube, mix by inverting until no separation occurs, and centrifuge at 12,000 rpm for 10 min.

[0037] (1-4) Pipette 650 μl of supernatant into a new centrifuge tube, add an equal volume of a mixture of chloroform and isoamyl alcohol (volume ratio 24:1), mix by inverting until no separation occurs, and centrifuge at 12,000 rpm for 10 min.

[0038] (1-5) Pipette 500 μl of supernatant into a new centrifuge tube, add 0.7 times the volume of isopropanol, mix slowly until the DNA clumps and precipitates, and let stand at room temperature for 30 min.

[0039] (1-6) Wash the DNA precipitate twice with 70% ethanol and once with anhydrous ethanol.

[0040] (1-7) Dry the ethanol in the centrifuge tube and add 100 μl ddH2O to fully dissolve the DNA for later use.

[0041] (2) Use specific KASP primers to perform PCR amplification of DNA based on KASP technology.

[0042] 2X Master Mix for ASPCR V1 and specific KASP primers (the forward primer and universal reverse primer mentioned above) were added to the DNA template of the 343 material extracted in step (1) for PCR amplification.

[0043] Table 1 PCR reaction system

[0044] The above 2X Master Mix for ASPCR V1 contains the following components: FAM fluorescent probe, HEX fluorescent probe, ROX internal reference dye, Taq DNA polymerase, dNTP and MgC12.

[0045] The above PCR reaction system is shown in Table 1:

[0046] The water bath PCR reaction conditions were as follows: 95°C for 10 min; 95°C for 20 sec, 61-55°C for 40 sec (0.6°C reduction per cycle), 10 cycles; 95°C for 20 sec, 55°C for 40 sec, 30 cycles.

[0047] (3) Perform fluorescence detection and analysis on the PCR amplification products.

[0048] The designed KSAP primers were used to identify the genotypes of 343 upland cotton materials at the base position of SNP: D05:14762561. The 5' ends of the two upstream primers carried different linker sequences, the 5' end of upstream primer one carried a FAM tag sequence, and the 5' end of upstream primer two carried a HEX tag sequence. The last base at the 3' end of the two upstream primers carries SNP: G or T of the D05:14762561 variation. The two forward primers denature and melt the DNA template at 95° based on the competitive allele-specific polymerase chain reaction (KASP) technology. At a specific annealing temperature, the upland cotton germplasm carrying the GG genotype combines with the upstream primers and extends. The FAM group in the PCR system separates from the quenching group and combines with the FAM tag sequence of the DNA amplification fragment to generate FAM fluorescence (red) and is detected, indicating that the genotype of the material at the 14762561th base of D05 is GG. Similarly, the upland cotton germplasm with the TT genotype combines with the upstream primer 2 and extends. The HEX group in the PCR system separates from the quenching group and combines with the HEX tag sequence of the DNA amplification fragment to produce HEX fluorescence (blue), which is detected, indicating that the genotype of the material at the 14762561st base of D05 is TT. If green light is detected as a mixture of red and blue, it means that the genotype of the material at this site is a GT heterozygous genotype. The KSAP typing results of the above 343 materials are as follows: Figure 3 As shown in the figure, after using KASP to detect the genotype of 343 materials at the SNP, the results showed that the genotype of 237 materials was GG, and the genotype of 106 materials was TT. By comparing with the typing results of SNP: D05: 14762561 in the sequencing data of 343 materials, the KSAP typing results were consistent with the sequencing typing results, proving the reliability of the KASP typing results of 343 materials. Therefore, the genotype of the tested upland cotton germplasm at the SNP: D05: 14762561 mutation can be accurately and intuitively determined by detecting the fluorescence value of the PCR product, providing technical support for molecular marker-assisted upland cotton breeding.

[0049] 3. Detection of fruit node length and plant shape.

[0050] The length of the third fruit node of each material was tested. The testing method was as follows: the length of the first fruit node of the third fruit branch on the main stem of each material was selected as the investigation object, and the length from the first boll to the main stem was measured with a ruler. Five replicates were investigated for each variety, and the average value was taken as the fruit node length value for each material. The following results were obtained, as shown in Table 2.

[0051] Table 2 Test results of upland cotton genotype and fruit node length (only 20 samples are shown)

[0052] The results showed that the fruit node length of varieties carrying the GG genotype was significantly longer than that of varieties carrying the TT genotype, as shown in Table 2 and Figure 4 As shown. The plant type of varieties carrying the GG genotype is relatively loose, in the shape of a cylinder (equal width at the top and bottom), while the variety carrying the TT genotype is in the shape of a tower (wide at the bottom and narrow at the top), as shown Figure 5 As shown. Genotype analysis shows that this SNP is a molecular marker associated with the length of fruit nodes of upland cotton. In practical applications, the length of the fruit nodes of the plants to be tested can be determined by detecting the genotype of the plants to be tested: GG genotype upland cotton is long-fruit node upland cotton, and TT genotype upland cotton is short-fruit node upland cotton. The shorter the fruit node length, the more compact the plant type of the upland cotton, which is specifically manifested as a tower shape. The longer the fruit node length, the looser the plant type of the upland cotton, which is specifically manifested as a barrel shape. Further, the fruit node conditions of the two upland cottons to be tested can be compared: the fruit node length of the GG genotype upland cotton is longer than that of the TT genotype upland cotton, and there is no significant difference in the fruit node length between the same genotype upland cottons.

[0053] In summary, the present invention also provides the following method for detecting plant type of upland cotton, which specifically comprises the following steps: Step 1: Extract DNA from the upland cotton sample to be tested. The specific extraction process can refer to the above-mentioned process of extracting DNA from 343 upland cotton materials used for KSAP typing.

[0054] Step 2: Use the detection primers (two forward primers and one reverse universal primer) in the above genotyping experiment to perform PCR amplification based on KASP technology on the DNA of the upland cotton sample to obtain a PCR amplification product. The specific PCR reaction system refers to the PCR reaction system in the above KASP typing experiment process; Step 3: Perform fluorescence detection and analysis on the PCR amplification products (the specific fluorescence detection and analysis process can refer to the fluorescence detection in the above-mentioned KASP typing experiment process). When FAM fluorescence is generated, it indicates that the genotype of the upland cotton sample at the above-mentioned SNP marker is GG, and when HEX fluorescence is generated, it indicates that the genotype of the upland cotton sample at the above-mentioned SNP marker is TT; wherein, the GG genotype upland cotton is long-fruit-node upland cotton, and the TT genotype upland cotton is short-fruit-node upland cotton, and the shorter the fruit node length, the more compact the plant type of the upland cotton, which is specifically manifested as a tower shape, and the longer the fruit node length, the looser the plant type of the upland cotton, which is specifically manifested as a barrel shape.

[0055] In summary, the present invention provides a SNP marker associated with the plant type of upland cotton (closely associated with the length of the fruit node): D05: 14762561. The SNP is closely related to the length of the fruit node of upland cotton. The fruit node length of the variety with the genotype of TT is significantly shorter than that of the variety with the genotype of GG. And it shows extremely significant differences in the three environments, indicating that the SNP is relatively reliable and stable, and can be used as a molecular marker highly linked to the plant type (fruit node length) of upland cotton for molecular assisted breeding, and breeding materials with compact plant type (shorter fruit node length). By detecting the genotype of the SNP marker, the plant type (fruit node length) of the upland cotton germplasm to be tested can be quickly and accurately determined. Specifically, when the genotype of the upland cotton germplasm to be tested at the SNP is GG, it is determined to be a variety with a loose plant type (longer fruit node), and when the genotype of the upland cotton germplasm to be tested at the SNP is TT, it is determined to be a variety with a compact plant type (shorter fruit node). The present invention can quickly and reliably distinguish or identify varieties with short fruit nodes from the gene level, and is not affected by the environment and the growth and development period, which greatly accelerates the breeding process and improves the accuracy and efficiency of short fruit node variety selection. In addition, the SNP variation site provided by the present invention can be used as a target for genetic engineering breeding, and the GG genotype can be mutated into the TT genotype by mutation, editing, etc., which can provide a new, fast and effective way for the genetic improvement of upland cotton fruit node traits.

[0056] Obviously, those skilled in the art can make various changes and modifications to the technical solution without departing from the spirit and scope of the technical solution. Thus, if these modifications and variations of the technical solution fall within the scope of the claims of the technical solution and their equivalents, the technical solution is also intended to include these modifications and variations.

Claims

1. A SNP marker associated with upland cotton plant type, characterized in that: The SNP marker is located at the 14762561th base of chromosome 18 D05 of the upland cotton genome, wherein in upland cotton plants with compact plant types, the nucleotide type of the SNP marker is T, and in upland cotton plants with loose plant types, the nucleotide type of the SNP marker is G.

2. The SNP marker associated with upland cotton plant type according to claim 1, wherein The compact upland cotton plant is specifically tower-shaped, and the loose upland cotton plant is specifically cylinder-shaped.

3. The SNP marker associated with upland cotton plant type according to claim 1, characterized in that In upland cotton plants with short fruit nodes, the nucleotide type of the SNP marker is T, and in upland cotton plants with long fruit nodes, the nucleotide type of the SNP marker is G.

4. The SNP marker associated with upland cotton plant type according to claim 1, wherein The SNP marker is located in the promoter region of 2000 bp upstream of gene Ghi_D05G08181.

5. The SNP marker associated with upland cotton plant type according to claim 4, characterized in that The nucleotide sequence of the 2000 bp promoter upstream of the gene Ghi_D05G08181 is shown in SEQ ID NO.

1.

6. The SNP marker associated with upland cotton plant type according to claim 4, characterized in that: The nucleotide sequence of the gene Ghi_D05G08181 is shown in SEQ ID NO.

2.

7. A detection primer for detecting the SNP marker according to any one of claims 1 to 6, characterized in that: The detection primers include two upstream primers and one downstream primer, wherein the nucleotide sequences of the two upstream primers are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively; and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

5.

8. A kit for detecting plant type of upland cotton, characterized in that: The kit comprises the detection primers and PCR amplification reagents according to claim 7.

9. Use of the SNP marker according to any one of claims 1 to 6, the detection primer according to claim 7, or the kit according to claim 8 in detecting plant type of upland cotton.

10. A method for detecting plant type of upland cotton, characterized in that: The following steps are involved: Step 1: Extract DNA from the upland cotton sample to be tested; Step 2: using the detection primers described in claim 7 to perform PCR amplification based on KASP technology on the DNA of the upland cotton sample to be tested, to obtain a PCR amplification product; Step 3: Perform fluorescence detection and analysis on the PCR amplification product. When FAM fluorescence is generated, it indicates that the genotype of the upland cotton sample at the SNP marker described in claim 1 is GG. When HEX fluorescence is generated, it indicates that the genotype of the upland cotton sample at the SNP marker described in claim 1 is TT; wherein the GG genotype is an upland cotton variety with a loose plant type, and the TT genotype is an upland cotton variety with a compact plant type.

Images