Preparation method of polyketone compound and application of polyketone compound in anti-inflammatory aspect

Abstract

The invention discloses a polyketone compound, a preparation method and application of the polyketone compound in the anti-inflammatory aspect. According to the invention, six compounds with remarkable anti-inflammatory activity are separated from a soil fungus Talaromyces sp.KYS-41, and the six compounds have a good application prospect in the aspect of research and development of anti-inflammatory drugs.

Description

Technical Field

[0001] The invention belongs to the technical field of natural medicines, and relates to a preparation method of a class of polyketone compounds and their application in anti-inflammatory aspects. Background Art

[0002] Inflammation is the primary defense response of vascularized living tissues to a variety of harmful stimuli. When inflammation is properly regulated, it plays a vital role in maintaining body homeostasis, assisting in the fight against pathogens, repairing damaged tissues, and other important processes. However, excessive or persistent low-grade inflammatory responses promote and / or maintain the development and progression of a variety of diseases, including rheumatoid arthritis, asthma, chronic inflammatory bowel disease, chronic kidney disease, neurodegenerative diseases, and cancer. Although there are a variety of anti-inflammatory drugs in clinical practice, such as nonsteroidal anti-inflammatory drugs (NSAIDs), glucocorticoids, and immunosuppressants, the long-term use of these drugs will inevitably produce side effects, so the discovery of new low-toxic anti-inflammatory drugs is still very necessary. Summary of the invention

[0003] The first object of the present invention is to provide a polyketone compound, which is any one of the six compounds in formula (I). Formula (I).

[0004] The second object of the present invention is to provide a method for preparing a polyketone compound represented by formula (I), which comprises: (1) The soil samples were isolated and purified on PDA medium using the gradient dilution method, and the obtained strains were stored in a -80°C refrigerator in the form of glycerol strains; (2) Take out Talaromyces sp. KYS-41 from the seed tube, inoculate it onto a PDA plate, and culture it in a constant temperature incubator at 28°C for 5-7 days. Then, inoculate the activated fungus into fungal medium No. 2 and culture it for 3-5 days; then, inoculate the seed liquid into rice solid culture medium and ferment it at room temperature for 30 days; (3) The culture medium obtained in step (2) after fermentation for 30 days was subjected to ultrasonic immersion extraction for three times with 95% ethanol, the ethanol was combined, and the extract was concentrated under reduced pressure to obtain a crude extract, the crude extract was suspended in water, and then extracted with ethyl acetate for three times, and concentrated under reduced pressure to obtain an ethyl acetate extract; (4) The ethyl acetate extract of step (3) is subjected to repeated separation by positive and reverse phase silica gel column chromatography using petroleum ether-ethyl acetate and methanol-water as the elution system, and finally separated and purified by high performance liquid chromatography using methanol-water and isopropanol-n-hexane as the mobile phase, to finally obtain compound 1-6 represented by formula (I) of claim 1.

[0005] Preferably, the composition of the PDA medium is: 200g of potato, diced and boiled for 30min, 20g of glucose, 1000mL of water, 20g of agar are added to the filtrate, and sterilized at 121°C for 30min.

[0006] Preferably, the ingredients of the fungus medium No. 2 are: 20 g maltose, 20 g mannitol, 10 g glucose, 10 g monosodium glutamate, 3 g yeast extract, 1 g corn steep liquor, 0.5 g potassium dihydrogen phosphate, 0.3 g magnesium sulfate heptahydrate, 1 L deionized water, and sterilized at 121°C for 30 min. The ingredients of the rice solid medium are: 80 g rice and 120 mL distilled water are placed in a 500 mL conical flask and sterilized at 121°C for 30 min.

[0007] Preferably, the ratio of petroleum ether to ethyl acetate for the silica gel column chromatography eluent is 20:1-1:2; the ratio of methanol to water for the reverse phase column chromatography eluent is 20%-100%; the ratios of methanol to water for the HPLC eluent are 45%, 75%, 65%, 45%, 45%, 65%, respectively, the retention times are 26.9 min, 11.8 min, 15.0 min, 17.7 min, 16.6 min, 12.5 min, respectively, and the flow rate is 3 mL / min; the ratio of isopropanol to n-hexane for the HPLC eluent is 30%, the retention times are 8.7 min and 10.2 min, respectively, and the flow rate is 0.8 mL / min.

[0008] The third object of the present invention is to provide the use of the polyketone compound represented by formula (I): (1) The polyketide compound represented by formula (I) has significant anti-inflammatory activity.

[0009] (2) A method for treating or preventing inflammation or diseases, disorders or symptoms mediated by inflammation, comprising administering an effective dose of any one of the compounds or any combination of compounds described in formula (I).

[0010] (3) Any compound comprising the compound of formula (I) and its pharmaceutically acceptable salt, hydrate or solvate.

[0011] (4) Any combination of compounds, including any combination of a compound containing at least one compound of formula (I) and any other compound.

[0012] The present invention has the following beneficial effects: The present invention provides a kind of fungus from soil Talaromyces sp. Six polyketide compounds were isolated from KYS-41, and all six polyketide compounds have significant anti-inflammatory activity and have good application prospects in the research and development of anti-inflammatory drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is the key HMBC-related signal of compound 1; Figure 2 is the ECD spectrum of compound 1a and 1b measured in methanol; Figure 3 IC of the anti-inflammatory activity of compounds 1-6 50 curve. DETAILED DESCRIPTION

[0014] The technical solution of the present invention is further explained and illustrated by means of specific embodiments below.

[0015] Example 1: Preparation and structural identification of the polyketone compound represented by formula (I) (1) Extraction and separation of polyketone compounds represented by formula (I) Removing fungi from seed tubes Talaromyces sp. KYS-41 was inoculated on a PDA plate and cultured in a constant temperature incubator at 28°C for 5-7 days. Talaromyces sp.The ITS sequence of KYS-41 is CGAGTGCGGGCCCTCGCGGCCCAACCTCCCACCCTTGTCTCTATACACC TGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGTCTGTCTCCGGGCCCGCGCCCGCCGAAGCGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAA CGCACATTGCGCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGCGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACTCGCTCGGGACGGACCTGCGGGGGTTGGTCACCACCATATTTTACCACGGTTGACCTCGGATCAGGTAGGAGT. Then the bacteria were inoculated in fungal medium No. 2, 180 rpm, 25°C, and cultured for 3-5 days. The seed liquid was inoculated into rice solid culture medium and fermented at room temperature for 30 days. The solid culture medium was collected, ultrasonically soaked and extracted with 95% ethanol for 3 times, 25L each time, and the ethanol extract was combined and concentrated under reduced pressure to obtain 1.0 kg of crude extract. The crude extract was suspended in 1 L of water and extracted with ethyl acetate three times, 1 L each time. The ethyl acetate layers were combined and concentrated under reduced pressure to obtain 45.0 g of ethyl acetate extract. The extract was chromatographed on a 100-200 mesh normal phase silica gel column and eluted with petroleum ether-ethyl acetate in a volume ratio of 20:1-1:2 to obtain 7 components, namely component AG.

[0016] Component E was subjected to reverse phase silica gel column chromatography, and gradient elution was performed using a methanol-water system with a volume ratio of 20%-100% to obtain 7 components E-1-E-7. Component E4-2 was separated and purified by semi-preparative high performance liquid phase to obtain compound 1 (1.5 mg, t R= 26.9 min), where the chromatographic conditions were: chromatographic column ZORBAX SB-C18, 9.4×250 mm, 5μm, detection wavelengths 210 nm and 254 nm, flow rate 3 mL / min, mobile phase 45% methanol-water. Then, semi-preparative HPLC was used to separate compound 1 to obtain compound 1a (0.3 mg, t R = 8.7 min) and 1b (0.3 mg, t R = 10.2 min), where the chromatographic conditions are: the chromatographic column is CHIRALPAK ® IG-3, 4.6×250mm, 3μm, detection wavelengths at 210 nm and 254 nm, flow rate 0.8 mL / min, mobile phase 30% isopropanol-n-hexane. Component E4-3 was separated and purified by semi-preparative HPLC to obtain compound 2 (1.0 mg, t R = 11.8 min), wherein the chromatographic conditions are: chromatographic column is ZORBAX SB-C18, 9.4×250 mm, 5μm, detection wavelength is 210 nm and 254 nm, flow rate is 3 mL / min, and mobile phase is 75% methanol-water. Component E4-4 was separated and purified by semi-preparative HPLC to obtain compound 6 (3.0 mg, t R = 12.5 min) and compound 3 (2.0 mg, t R = 15.0 min), wherein the chromatographic conditions are: chromatographic column is ZORBAX SB-C18, 9.4×250 mm, 5μm, detection wavelength is 210 nm and 254 nm, flow rate is 3 mL / min, and mobile phase is 65% methanol-water. Component E4-4 was separated by semi-preparative HPLC to obtain compound 5 (5.9 mg, t R = 16.6 min) and compound 4 (0.5 mg, t R = 17.7 min), where the chromatographic conditions were as follows: the chromatographic column was ZORBAX SB-C18, 9.4×250 mm, 5 μm, the detection wavelengths were 210 nm and 254 nm, the flow rate was 3 mL / min, and the mobile phase was 45% methanol-water.

[0017] (2) Structural identification of the polyketide compound represented by formula (I) By testing and analyzing the nuclear magnetic resonance (NMR), mass spectrometry (MS), optical rotation, circular dichroism (ECD) and other data of compounds 1-6, their chemical structures as shown in formula (I) were determined.

[0018] The structural analysis of compound 1 is as follows: The high-resolution mass spectrum (HR-ESIMS) of compound 1 showed a deprotonated ion peak. m / z The value is [MH] - 291.0882, same as theoretical calculated value [MH] - calcd 291.0869 is highly consistent, and combined with the data shown in Table 1 13 C NMR data, it can be deduced that the molecular formula of compound 1 is C 15 H 16 O6, and calculated that the compound has 8 degrees of unsaturation. Further analysis of Table 1 1 H NMR spectrum. In the low-field region of the spectrum, two proton signals can be observed. d H 6.67 and 7.28, which have the same coupling constant ( J = 1.8 Hz), and a single peak signal d H 6.51, these signals indicate the presence of a 1,2,4,6-tetrasubstituted phenyl group and a trisubstituted double bond in the structure. 1 H NMR data also deduced other functional groups, including a tertiary methyl group ( d H 2.04), a methoxy group ( d H 3.85) and an ethoxy group ( d H 4.15, 1.10). At the same time, in-depth analysis 13 C NMR data also suggested that compound 1 contained a keto carbonyl group ( d C 184.4) and an ester carbonyl group ( d C 172.5). Combining the above functional groups, they occupy a total of 7 unsaturations, indicating that on this basis, the structure also contains a ring structure to meet the requirements of its total unsaturation.

[0019] Table 1: Proton spectrum (600 MHz, CDCl3) and carbon spectrum data (150 MHz, CDCl3) of compound 1 By analyzing the 2D NMR data, the above functional groups were assembled to construct the planar structure of compound 1. Specifically, the benzene ring was confirmed by the separation of H-6 and C-5 ( d C 132.6)、C-7( d C 161.4), C-8 ( d C 108.3) and C-10 ( d C 118.2) of HMBC, and H-8 and C-7, C-9 ( d C 156.1) and HMBC correlation of C-10, as shown in the attached Figure 1 The determination of the second ring structure also relies on a series of related signals, which are H-6 and C-4 ( d C 184.4) and C-5; H3-12 and C-2 ( d C 140.0)、C-3( d C 137.4) and C-4; and H-2 to C-1 ( d C 73.1), C-10 and C-11 ( d C 172.5). In addition, the methoxy group ( d H 3.85) to C-7, strongly proving that the methoxy group is attached to the C-7 position; O CH2 CH3( d H The HMBC correlation of 4.15) to C-11 confirmed that the ethoxy group was attached at C-11.

[0020] Finally, if Figure 2 As shown in Figure 2, the measured ECD curves of compounds 1a and 1b match their calculated values, thus confirming that the absolute configuration of compound 1a is 1 R , the absolute configuration of compound 1b is 1 S Compound 1 is reported for the first time. It is a white, amorphous powder that is easily soluble in methanol and dichloromethane. The specific rotation value of compound 1a is +379.0 ( c 0.03, MeOH). The specific rotation value of compound 1b is -378.7 ( c 0.03, MeOH).

[0021] The structural analysis of compound 2 is as follows: The molecular formula of the compound is C 15 H 20 O2, red amorphous gel. 1 H-NMR (600MHz, CD3OD), 6.13(2H, d, J =2.2 Hz), 6.08 (1H, t, J =2.2 Hz), 5.99 (2H, m), 5.55 (2H, m), 2.51(2H, t, J =7.3 Hz), 2.30 (2H, q, J =7.3 Hz), 2.03 (2H, q, J =7.3 Hz), 1.40 (2H, q, J =7.3 Hz), 0.90 (3H, t, J =7.3 Hz); 13 C-NMR (150 MHz, CD3OD), 159.4 (C-1, C-5), 145.5 (C-3), 133.2 (C-6'), 132.2 (C-3'), 132.2 (C-4'), 132.0 (C-5'), 107.9 (C-2, C-4), 101.1 (C-6), 37.1 (C-1'), 35.8 (C-2'), 35.5 (C-7'), 23.7 (C-8'), 14.0 (C-9'). Based on the above data, which are consistent with the literature reports, compound 2 was identified as 5-[( 3E , 5E )-3,5-nonadienyl]-1,3-benzenediol.

[0022] The structural analysis of compound 3 is as follows: The molecular formula of the compound is C 15 H 12 O6, purple needle-shaped crystals. 1 H-NMR (600MHz, DMSO), 7.24(1H, d, J =2.1 Hz), 6.72 (1H, s), 6.62 (1H, d, J =2.1 Hz), 3.91 (3H, s), 2.66(3H, s); 13C-NMR (150 MHz, DMSO), 166.1 (C-5), 164.6 (C-7), 164.1 (C-3), 147.0(C-4'), 141.5 (C-2'), 138.4 (C-1), 131.2 (C-3'), 126.4 (C-6'), 116.9 (C-5'),109.1 (C-1'), 103.4 (C-6), 99.2 (C-4), 98.3 (C-2), 55.8 (C-OCH3), 24.5 (C-CH3). Based on the above data, which is consistent with the literature report, compound 3 was identified as 3-Hydroxyalternariol 5-O-methyl ether.

[0023] The structural analysis of compound 4 is as follows: The molecular formula of the compound is C 14 H 10 O6, brown gummy solid. 1 H-NMR (600MHz, DMSO), 7.52 (1H, s), 7.02 (1H, d, J =2.2 Hz), 6.78 (1H, s), 6.54 (1H, d, J =2.2 Hz), 3.92 (3H, s); 13 C-NMR (150 MHz, DMSO), 166.7 (C-7), 164.9 (C-5), 163.6 (C-3), 149.3 (C-2'), 144.2 (C-4'), 143.7 (C-5'), 137.5 (C-1), 108.9 (C-6'), 108.9 (C-1'),103.3 (C-3'), 99.9 (C-4), 98.5 (C-2), 97.9 (C-6), 56.0 (C-OCH3). Based on the above data, which is consistent with the literature report, compound 4 was identified as altenuisol.

[0024] The structural analysis of compound 5 is as follows: The molecular formula of the compound is C 15 H 12 O6, white solid. 1 H-NMR (600MHz, CD3OD), 7.03 (1H, s), 6.88 (1H, s), 6.57 (1H, d, J = 2.5 Hz), 6.53 (1H, d,J = 2.5 Hz), 5.03 (1H, m), 4.80 (1H, m), 3.87 (3H, s); 13 C-NMR (150 MHz, CD3OD), 173.9 (C-7), 165.3 (C-5),163.9 (C-3), 148.0 (C-4'), 147.4 (C-2'), 142.8 (C-6'), 132.2 (C-1'), 127.9(C-1), 116.8 (C-3'), 116.0 (C-5'), 108.4 (C-6), 108.3 (C-2), 101.5 (C-4),70.4 (C-7'), 56.1 (C-OCH3). Based on the above data, which is consistent with the literature report, compound 5 was identified as alternariol 1′-hydroxy-9-methyl ether.

[0025] The structural analysis of compound 6 is as follows: The molecular formula of the compound is C 15 H 12 O6, yellow needle-shaped crystals. 1 H-NMR (600MHz, CDCl3), 11.30(1H, s), 6.73 (1H, d, J = 2.3 Hz), 6.69 (1H, s), 6.63 (1H, d, J = 2.3), 6.28 (1H, s), 3.91 (3H, s), 1.73 (3H, s); 13 C-NMR (150 MHz, CDCl3), 180.9 (C-5'), 167.5(C-7), 166.5 (C-5), 164.9 (C-3), 153.3 (C-1'), 146.3 (C-4'), 135.2 (C-1),120.9 (C-6'), 116.3 (C-3'), 104.5 (C-6), 103.8 (C-4), 100.0 (C-2), 79.2 (C-2'), 56.1 (C-OCH3), 29.6 (C-CH3). Based on the above data, which is consistent with the literature report, compound 6 was identified as dehydroaltenusin.

[0026] Example 2: Anti-inflammatory activity experiment (1) Cell viability assay The toxicity of the compounds to RAW264.7 cells was evaluated using the MTT assay according to previously reported literature. Briefly, RAW 264.7 cells were harvested and seeded in 96-well plates and cultured at 37°C for 24 h, with a seeding rate of 3 × 10 4 cells / well. Then, the cells were treated with test compounds 1-6 for 24 hours. Subsequently, 10 μL CCK-8 was added to each well, and the cells were further incubated for 2 hours before detection. Subsequently, the OD values ​​were measured at an experimental wavelength of 450 nm on the SpectraMax iD3 platform.

[0027] (2) Nitric oxide production assay NO release in RAW264.7 cells was measured by Gries regent. RAW264.7 cells were seeded in 96-well plates and treated with different concentrations of compounds 1a, 1b, 2, 3, 4, 5, 6 and 0.05 μg / mL LPS at 37 °C for 24 h. 4 cells / well. Dexamethasone was used as a positive control. 70 μL of supernatant was then collected and reacted with 70 μL of Griess reagent. The absorbance at 546 nm was recorded using the SpectraMax iD3 platform.

[0028] The experimental results show that compounds 1-6 shown in formula (I) have no obvious toxic effects on cells at a concentration of 20 μM, as shown in Table 2; compounds 1-6 shown in formula (I) have an inhibitory effect on the production of nitric oxide in RAW264.7 cells induced by LPS inflammatory response, reflecting certain anti-inflammatory properties. Their IC 50 The values ​​are shown in Table 3 and Figure 3 Therefore, the compounds 1-6 shown in formula (I) of the present invention have anti-inflammatory activity and have potential application value in anti-inflammatory aspects.

[0029] Table 2: Inhibition rate and cell viability of compounds 1-6 at a concentration of 20 μM Table 3: Anti-inflammatory activity (IC 50 , µ M) The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A polyketone compound, characterized in that: The polyketone compound is any one of the six compounds in formula (I), Formula (I).

2. A method for preparing a polyketone compound as claimed in claim 1, characterized in that: The following steps are involved: (1) The soil samples were isolated and purified on PDA medium using the gradient dilution method, and the obtained strains were stored in a -80°C refrigerator in the form of glycerol strains; (2) Take out Talaromyces sp. KYS-41 from the seed tube, inoculate it onto a PDA plate, and culture it in a constant temperature incubator at 28°C for 5-7 days. Then, inoculate the activated fungus into fungal medium No. 2 and culture it for 3-5 days; then, inoculate the seed liquid into rice solid culture medium and ferment it at room temperature for 30 days; (3) The culture medium obtained in step (2) after fermentation for 30 days was subjected to ultrasonic immersion extraction for three times with 95% ethanol, the ethanol was combined, and the extract was concentrated under reduced pressure to obtain a crude extract, the crude extract was suspended in water, and then extracted with ethyl acetate for three times, and concentrated under reduced pressure to obtain an ethyl acetate extract; (4) The ethyl acetate extract of step (3) is subjected to repeated separation by positive and reverse phase silica gel column chromatography using petroleum ether-ethyl acetate and methanol-water as the elution system, and finally separated and purified by high performance liquid chromatography using methanol-water and isopropanol-n-hexane as the mobile phase, to finally obtain compound 1-6 represented by formula (I) of claim 1.

3. The preparation method according to claim 2, characterized in that: The PDA culture medium comprises: 200 g of potato, diced and boiled for 30 min, 20 g of glucose, 1000 mL of water and 20 g of agar are added to the filtrate, and sterilized at 121° C. for 30 min.

4. The preparation method according to claim 2, characterized in that: The ingredients of the fungus medium No. 2 are: 20 g maltose, 20 g mannitol, 10 g glucose, 10 g monosodium glutamate, 3 g yeast extract, 1 g corn steep liquor, 0.5 g potassium dihydrogen phosphate, 0.3 g magnesium sulfate heptahydrate, 1 L deionized water, and sterilized at 121° C. and autoclaved for 30 min; the ingredients of the rice solid medium are: 80 g rice and 120 mL distilled water are placed in a 500 mL conical flask and sterilized at 121° C. and autoclaved for 30 min.

5. The preparation method according to claim 2, characterized in that: The ratio of petroleum ether to ethyl acetate for the silica gel column chromatography eluent is 20:1-1:2; the ratio of methanol to water for the reverse phase column chromatography eluent is 20%-100%; the ratios of methanol to water for the high performance liquid phase eluent are 45%, 75%, 65%, 45%, 45%, 65% respectively, the retention times are 26.9 min, 11.8 min, 15.0 min, 17.7 min, 16.6 min, 12.5 min respectively, and the flow rate is 3 mL / min; the ratio of isopropanol to normal hexane for the high performance liquid phase eluent is 30%, the retention times are 8.7 min and 10.2 min respectively, and the flow rate is 0.8 mL / min. The polyketide compound according to claim 1 has significant anti-inflammatory activity.

7. A use for treating or preventing inflammation or diseases, disorders or symptoms mediated by inflammation, comprising administering an effective dose of any one of the compounds or any combination of compounds as claimed in claim 1.

8. Any compound according to claim 7, comprising the compound according to claim 1 and a pharmaceutically acceptable salt, hydrate or solvate thereof.

9. Any combination of compounds according to claim 7, comprising any combination of at least one compound according to claim 1 and any other compounds.

Images