Cysteine protease inhibitor gene OsCYT2 for regulating and controlling rice sheath blight resistance and application of cysteine protease inhibitor gene OsCYT2

Abstract

The invention discloses a cysteine protease inhibitor gene OsCYT2 for regulating and controlling rice sheath blight resistance and application thereof.According to the cysteine protease inhibitor gene OsCYT2 for regulating and controlling rice sheath blight resistance, the OsCYT2 gene is transferred into an infected rice variety through agrobacterium-mediated genetic transformation, it is found that the resistance of a transgenic plant over-expressing the OsCYT2 gene to sheath blight is enhanced, and after the transgenic plant is infected with the sheath blight, the gene OsCYT2 gene can be transferred into the infected rice variety. The scab length of sheath blight is reduced, and the disease resistance of rice is enhanced. The gene provided by the invention has reference significance for researching gene molecular functions and breeding.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a cysteine ​​protease inhibitor gene OsCYT2 for regulating rice resistance to sheath blight and an application thereof. Background Art

[0002] Rice is one of the most important food crops, and more than half of the world's population relies on it as their staple food. At the same time, rice production is directly related to my country's food security, farmers' income growth and rural stability. Rice sheath blight is a soil-borne fungal disease caused by Rhizoctonia solani (PARK et al., 2008). According to research reports, sheath blight can cause up to 45% loss of grain production. In a humid environment with continuous rainfall, the grain loss caused by sheath blight can even reach 100% (Dai et al., 2017). According to research statistics from the National Agricultural Technology Extension Service Center, the area affected by sheath blight in my country in 2020 was approximately 20 million hm2. 2 The condition is level 4, which is severe, ranking first among the three major rice diseases (National Agricultural Technology Extension and Service Center, 2020).

[0003] Plant cysteine ​​protease inhibitors (also known as cystatins) are competitive and reversible inhibitors of cysteine ​​proteases that have been found in different plant species. Most cysteine ​​proteases have been shown to inhibit the activity of L-like cysteine ​​proteases in the peptidase C1A family (Alvarez-Fernandez et al., 1999; Martínez et al., 2007). It competitively interacts with the active site of the target protease and blocks the access of its protein substrate. Plant cysteine ​​proteases can be subdivided into three major groups, the first group consists of proteins with a molecular weight of 12-16 kDa; the second group has carboxyl-terminal extensions with a molecular weight of 23 kDa; and the third group consists of multi-cysteine ​​proteases with multiple cysteine ​​protease domains, weighing 80 kDa (Wang et al., 2008). Several studies have demonstrated that plant cysteine ​​proteases can effectively inhibit nematode (Chan et al., 2010) and fungal infections (ValdesRodriguez et al., 2010); environmental stresses that trigger plant gene expression and physiological responses also lead to differential expression of plant cystatins to overcome stress and improve plant tolerance (Benchabane et al., 2010). These studies indicate that plant cystatins play a vital role in several fundamental processes of plant development.

[0004] Therefore, the prevention and control of rice sheath blight is of great significance to ensuring food security and increasing rice yields. Due to the scarcity of rice sheath blight-resistant resources, the research on rice sheath blight-resistant molecular breeding is at a standstill, which makes the prevention and control of the disease more difficult. Summary of the invention

[0005] The present invention provides a cysteine ​​protease inhibitor gene OsCYT2 for regulating rice resistance to sheath blight and its application. Through Agrobacterium-mediated genetic transformation, the gene OsCYT2 overexpression vector is transferred into susceptible rice. The transgenic plants overexpressing OsCYT2 show stronger resistance to sheath blight than the control plants. The present invention completes the functional study of the gene OsCYT2 in rice resistance to sheath blight and proposes the application of OsCYT2 in resistance to sheath blight. The technical scheme is as follows:

[0006] In a first aspect of the present invention, a cysteine ​​protease inhibitor gene OsCYT2 for regulating rice resistance to sheath blight is provided, wherein the amino acid sequence of the protein encoded by the gene OsCYT2 is as shown in SEQ ID NO.2, or the protein encoded by the gene OsCYT2 is a derivative protein having equivalent function by replacing, deleting or adding one / several amino acids to the amino acid sequence shown in SEQ ID NO.2.

[0007] It should be noted that the regulation refers to the increase in the activity and / or expression of the gene OsCYT2, which enhances the resistance of rice to sheath blight. The enhanced resistance of rice to sheath blight is mainly manifested in that after sheath blight infects rice leaf sheaths and leaves, the length of the pathogen infection in Nipponbare plants is greater than that in overexpression plants; at the same time, after sheath blight infects the leaf sheaths and leaves of overexpression plants, the length of the lesions is shortened, and the ability of sheath blight to infect rice is weakened.

[0008] “The protein encoded by the gene OsCYT2 is a derivative protein having the same function as the amino acid sequence shown in SEQ ID NO.2 by substitution, deletion or addition of one / several amino acids” means that the derivative protein sequence has a homology of not less than 90% with the protein sequence of SEQ ID NO.2, and the function of the derivative protein can regulate resistance to sheath blight.

[0009] Furthermore, the nucleotide sequence of the CDS of the gene OsCYT2 is shown in SEQ ID NO.1.

[0010] The second aspect of the present invention provides an application of a gene OsCYT2 in regulating resistance to sheath blight in rice.

[0011] The third aspect of the present invention provides a product, which is any one of the following:

[0012] (1) A recombinant expression vector, comprising the gene OsCYT2;

[0013] (2) A microbial transformant, wherein the microbial transformant is obtained by transforming the recombinant expression vector into Agrobacterium;

[0014] (3) a transgenic cell line, comprising the gene OsCYT2;

[0015] (4) A kit comprising the recombinant expression vector, the microbial transformant, or the transgenic cell line.

[0016] Furthermore, the purpose of the recombinant expression vector is to overexpress the gene OsCYT2.

[0017] The third aspect of the present invention provides an application of the above product in regulating rice resistance to sheath blight.

[0018] A fourth aspect of the present invention provides a method for preparing transgenic rice resistant to sheath blight, which is prepared by transforming the gene OsCYT2 into rice through transgenic technology.

[0019] Furthermore, the purpose of the above transgenic technology is to introduce the recombinant expression vector carrying the gene OsCYT2 into plant cells by using conventional biotechnology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc.

[0020] Preferably, the transgenic technology is Agrobacterium-mediated method.

[0021] Furthermore, the recombinant expression vector containing the gene OsCYT2 was introduced into rice using the genetic transformation method mediated by Agrobacterium EHA105, and transgenic plants were screened to finally obtain transgenic rice plants with positive OsCYT2 overexpression, that is, transgenic rice resistant to sheath blight.

[0022] A fifth aspect of the present invention provides an application of the offspring plants obtained by the above preparation method in rice breeding.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] (1) The present invention found that plants overexpressing the OsCYT2 gene have enhanced resistance to sheath blight. After sheath blight infected transgenic plants overexpressing the OsCYT2 gene, the length of sheath blight lesions decreased, and the disease resistance of rice was enhanced. The present invention revealed for the first time that the OsCYT2 gene enhanced the resistance of rice to sheath blight, which can be used to study plant disease resistance and has reference significance for studying gene molecular functions and breeding.

[0025] (2) There are many OsCYT2 gene members in plant cells, which are involved in a variety of biological functions. Therefore, the research on OsCYT2 gene has a good reference value for the subsequent research on other cysteine ​​protease inhibitor members. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The quantitative PCR results of OsCYT2 overexpressing transgenic materials, the relative expression levels of OsCYT2 in the OsCYT2 gene overexpressing transgenic materials CYT2OE-1 and CYT2OE-2; Figure 1 Medium, **, P < 0.01; ***, P < 0.001, ****, P < 0.0001;

[0027] Figure 2 Figure 2 Disease resistance phenotypes of OsCYT2 overexpressing transgenic rice lines CYT2OE-1 and CYT2OE-2. A. Length of sheath blight lesions. The length of lesions formed by pathogen infection in Nipponbare plants is longer than that in overexpressing plants. B. Ratio of the length of rice pathogen infection to the total length of the stem. The smaller the value, the stronger the resistance. DETAILED DESCRIPTION

[0028] The present invention studies the transcriptome analysis of resistant and susceptible rice before and after inoculation with sheath blight, and finds that the expression of OsCYT2 gene in disease-resistant rice is significantly upregulated after inoculation with sheath blight, while there is no obvious change in susceptible rice, suggesting that OsCYT2 gene may play a certain role in the rice disease resistance mechanism pathway. In order to study the specific role of this gene in rice resistance to sheath blight, through Agrobacterium-mediated genetic transformation, its overexpression vector is transferred into susceptible rice varieties, and the overexpressed transgenic plants show stronger resistance to sheath blight than the control plants, which is mainly manifested in that after inoculation with sheath blight, compared with the resistant sheath blight phenotype, the pathogen infection length of the control plants is greater than that of the overexpressed plants. The present invention has a good reference significance for studying gene molecular functions and breeding work.

[0029] Unless otherwise specified, the reagents, kits and technical solutions used in the following examples are all commercially available reagents, kits, and conventional molecular biology techniques in the industry.

[0030] In some implementation cases of the present invention, the japonica rice variety Nipponbare can be selected as a representative rice variety for testing.

[0031] Example 1: Obtaining the Rice OsCYT2 Gene

[0032] Through the transcriptome sequencing ID, the full-length sequence of the OsCYT2 gene in the Nipponbare database was found. Its CDS is 456 bp long and encodes 151 amino acids. Primers were designed according to the CDS, and PCR amplification was performed using the Nipponbare rice cDNA as a template. The PCR amplification reaction system is shown in Table 1. The reaction program is 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 58 °C annealing and extension for 30 s / kb, and 30 cycles.

[0033] The PCR amplified product was recovered and connected to the pMD18-T vector, and the positive clones were screened and sequenced. The sequencing results showed that the sequence of the PCR product was consistent with SEQ ID NO.1, and the correct pMD18-T-OsCYT2 recombinant plasmid was obtained.

[0034] Table 1 PCR reaction system

[0035]

[0036] Example 2: Construction of OsCYT2 gene overexpression vector

[0037] Primers were designed to construct an OsCYT2 gene overexpression vector. The nucleotide sequence of the forward primer pCXUN-OsCYT2-F is shown in SEQ NO.3, specifically cccgggggatccccaatactatgcgggcatcatctctctt (5'-3');

[0038] The nucleotide sequence of the reverse primer pXCUN-OsCYT2-R is shown in SEQ NO.4, specifically:

[0039] aacccgctgttatccccaatactggcggtggcgtcgtcgaggggc (5'-3').

[0040] PCR amplification was performed using the pMD18-T-OsCYT2 recombinant plasmid as a template. The reaction system for PCR amplification is shown in Table 1. The reaction program was 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 58 °C annealing and extension for 30 s / kb, and 30 cycles to obtain the OsCYT2 fragment.

[0041] The pCXUN vector was digested with XcmI, and the exogenous fragment (OsCYT2 fragment) was directly connected after adding A. After sequencing verification, the resulting vector was the OsCYT2 gene overexpression vector pCXUN-OsCYT2.

[0042] Example 3: Agrobacterium-mediated genetic transformation

[0043] The OsCYT2 gene overexpression vector was electroporated into Agrobacterium EHA105, a single clone was picked for expansion and culture, and after PCR verification, an equal volume of 50% glycerol was added and mixed, and stored at -80°C for later use.

[0044] The OsCYT2 gene overexpression vector pCXUN-OsCYT2 was introduced into the japonica rice variety Nipponbare using the Agrobacterium EHA105-mediated genetic transformation method (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282) to obtain OsCYT2 gene overexpression transgenic plants. The positive transgenic plants were detected using the universal primers Hyg-L and Hyg-R for hygromycin.

[0045] Example 4: Identification test of positive transgenic rice

[0046] The T2 positive plants of the OsCYT2 gene overexpressing transgenic plants and Nipponbare rice were respectively extracted from the flag leaves and RNA was converted into cDNA. The relative expression of OsCYT2 was detected by quantitative PCR. The test results are as follows: Figure 1 As shown, the relative expression levels of OsCYT2 gene in two different OsCYT2 gene overexpressing transgenic lines (CYT2OE-1 and CYT2OE-2) were significantly higher than that in the control Nipponbare rice.

[0047] Example 5: Testing the resistance of transgenic rice to sheath blight using the sheath blight pathogen strain AG-1

[0048] (1) Activation: Inoculate the AG-1 strain of Rhizoctonia solani stored at 4°C onto a PDA plate medium and wait for 2-3 days until the plate is fully grown.

[0049] (2) Preparation of wood bark inoculum for sheath blight: Cut 1 mm thick wood bark into 1 cm long and 2 mm wide wood chips and place them in a culture dish. Add 6-7 mL of PDA culture solution to the sterilized culture dish to immerse the wood chips; place an activated fungus block in the center of the culture dish, seal the culture dish with a sealing film, and culture it in the dark at 28 ℃ for 3 days. When the surface of the wood chip is covered with hyphae, it can be used as an inoculum;

[0050] (3) Field inoculation: During the tillering stage of transgenic rice CYT2OE-1, CYT2OE-2 and Nipponbare rice, the inoculation was carried out by embedding the inoculum of sheath blight fungus into the inner side of the leaf sheath below the pulvinus of the second leaf from top to bottom using tweezers.

[0051] Ten days after inoculation, the length and area of ​​diseased OsCYT2 gene overexpressing transgenic rice and Nipponbare rice were statistically analyzed. Three independent biological replicates were performed for each line, and each biological replicate was inoculated at least five times.

[0052] The results are as follows Figure 2 As shown, 10 days after the sheath blight pathogen AG-1 infected rice, the lesion length in Nipponbare was significantly greater than that in rice overexpressing OsCYT2, indicating that rice overexpressing OsCYT2 has better resistance to sheath blight.

[0053] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A cysteine ​​protease inhibitor gene OsCYT2 for regulating rice resistance to sheath blight, characterized in that: The amino acid sequence of the protein encoded by the gene OsCYT2 is shown in SEQ ID NO.2, or the protein encoded by the gene OsCYT2 is a derivative protein with equivalent functions, in which the amino acid sequence shown in SEQ ID NO.2 is replaced, deleted or one / several amino acids are added.

2. The gene OsCYT2 according to claim 1, characterized in that The nucleotide sequence of the CDS of the gene OsCYT2 is shown in SEQ ID NO.

1.

3. Use of the gene OsCYT2 according to claim 1 in regulating rice resistance to sheath blight.

4. A product, characterized in that The product is any of the following: (1) A recombinant expression vector, comprising the gene OsCYT2; (2) A microbial transformant, wherein the microbial transformant is obtained by transforming the recombinant expression vector into Agrobacterium; (3) a transgenic cell line, comprising the gene OsCYT2; (4) A kit comprising the recombinant expression vector, the microbial transformant, or the transgenic cell line.

5. Use of the product according to claim 4 in regulating rice resistance to sheath blight.

6. A method for preparing transgenic rice resistant to sheath blight, characterized in that: The gene OsCYT2 is transformed into rice through genetic modification technology.

7. Use of the offspring plants obtained according to the preparation method of claim 6 in rice breeding.

Images