Taq DNA polymerase with enhanced base mismatch recognition capability and application thereof

Abstract

The invention belongs to the technical field of molecular biology, and particularly discloses Taq DNA polymerase with enhanced base mismatch recognition capacity and application of the Taq DNA polymerase in gene mutation detection. The Taq DNA polymerase provided by the invention has enhanced base mismatch recognition capability, also retains the activity of the polymerase, and is especially suitable for gene mutation detection of which the 3'end of a primer contains a mismatch base. Experimental results show that Ct values of mutants M9, M10, M11, M12, M13 and M14 amplified by the 3'end base mismatched primer are obviously greater than Ct values of mutants amplified by a normal primer, and the mutants can all adapt to a rapid amplification procedure of 5s at 60 DEG C. Especially, the Ct value of the mutant M14 amplified by using a 3'end 1-bit base mismatched primer or a 2, 3-bit base mismatched primer is obviously greater than that of a normal primer, which indicates that the error distinguishing capability of the mutant M14 is the strongest, and the mutant M12 is suitable for preparing a gene mutation detection reagent.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a Taq DNA polymerase with enhanced base mismatch recognition ability and an application thereof in gene mutation detection. Background Art

[0002] ARMS-PCR is a technology developed based on PCR for detecting known mutations. It can detect various point mutations in DNA and is currently one of the most important and widely used technologies for personalized molecular detection of tumors in the world.

[0003] ARMS-PCR (Amplification Refractory Mutation System PCR, Amplification Retractory Mutation System PCR) is also called Allele-Specific PCR (AS-PCR). It mainly controls the specific extension of alleles by designing the 3' terminal base of the primer. Its basic principle is: if the 3' terminal base of the primer is not complementary to the template base, the extension of DNA polymerase will be blocked and PCR products cannot be obtained. Therefore, two upstream primers can be designed according to the known point mutation, and their 3' terminal bases are complementary to the bases of the wild-type and mutant templates respectively. During amplification, the upstream primer that is not completely complementary to the template forms a mismatch at the 3' terminal base position, and the extension is blocked, while the upstream primer that is completely complementary to the template can amplify the corresponding PCR product, thereby distinguishing the template with point mutation from the normal template. It has been proven in practice that the detection of point mutations in ARMS-PCR depends on the optimization of reaction conditions, including primers, Taq DNA polymerase, template DNA, reaction temperature, etc. Among them, the first generation ARMS-PCR uses traditional primers and Taq DNA polymerase. In order to improve the specificity and sensitivity of detection, mismatched bases can also be introduced at the 3' end of the primer; the second generation ARMS-PCR is to improve the structure of traditional primers. For example, Aide Biotechnology's Super-ARMS can increase the detection sensitivity to 1 copy / μL by designing primers with synthetic neck-loop structures; the third generation ARMS-PCR mainly improves traditional Taq DNA polymerase, while enhancing the recognition of base mismatches and retaining the polymerase activity as much as possible. For example, the E507K / R536K / R660V TM-Taq DNA polymerase developed by GENECAST (Youngshin Lim et al., 2022) can achieve ultra-sensitive ARMS-PCR.

[0004] In addition, Chinese patent CN103025868B (Roche) discloses a Taq DNA polymerase with an E491K mutation, which can enhance the enzyme's 3'-mismatch recognition ability and is suitable for rare allele detection. Chinese patent application CN116004566A (Yisheng Biology) discloses that Taq DNA polymerase with T506K mutation, especially T506K and G510R double mutation, has good discrimination ability for single-base mismatches, and the single-base mismatch probe using the mutant enzyme has a lower peak and higher typing accuracy. Another US patent US20150191707A1 (IDT) discloses that V783 and / or H784 mutations can enhance the 3'-mismatch recognition ability of Taq DNA polymerase. However, the above-mentioned Taq DNA polymerase modified by mutation cannot effectively retain the polymerase activity while enhancing the base mismatch recognition ability. Therefore, it is necessary to develop a new TaqDNA polymerase suitable for gene mutation detection. Summary of the invention

[0005] The main technical problem solved by the present invention is to provide a Taq DNA polymerase with enhanced base mismatch recognition ability and a coding gene thereof.

[0006] Secondly, the present invention provides a biological material comprising the Taq DNA polymerase or a gene encoding the same.

[0007] Again, the present invention provides a gene mutation detection reagent.

[0008] Finally, the present invention provides an application of the Taq DNA polymerase in gene mutation detection.

[0009] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0010] A Taq DNA polymerase with enhanced base mismatch recognition, comprising mutation 1 or mutation 3 compared to the amino acid sequence of a wild-type Taq DNA polymerase;

[0011] If mutation 1 is included, one or two of mutation 2 and mutation 4 are also included;

[0012] If mutation 3 is included, one or two of mutation 2 and mutation 4 may be included optionally;

[0013] Mutation 1: T506K, i.e., threonine at position 506 mutates to lysine;

[0014] Mutation 2: E507K, i.e., glutamic acid at position 507 mutated to lysine;

[0015] Mutation 3: T509K, i.e., threonine at position 509 mutated to lysine;

[0016] Mutation 4: R660V / T, i.e., the arginine at position 660 mutates to valine or threonine;

[0017] The amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO:1.

[0018] As a preferred embodiment of the present invention, the Taq DNA polymerase with enhanced base mismatch recognition ability has a sequence homology of more than 90% with the amino acid sequence of the wild-type Taq DNA polymerase.

[0019] More preferably, the sequence homology is 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0020] As a preferred embodiment of the present invention, the Taq DNA polymerase with enhanced base mismatch recognition comprises mutation 1 and mutation 2 compared with the amino acid sequence of the wild-type Taq DNA polymerase;

[0021] Mutation 1: T506K;

[0022] Mutation 2: E507K.

[0023] More preferably, only mutation 1 and mutation 2 are included.

[0024] As a preferred embodiment of the present invention, the Taq DNA polymerase with enhanced base mismatch recognition comprises mutation 1, mutation 2 and mutation 4 compared with the amino acid sequence of the wild-type Taq DNA polymerase:

[0025] Mutation 1: T506K;

[0026] Mutation 2: E507K;

[0027] Mutation 4: R660V / T.

[0028] More preferably, only mutation 1, mutation 2 and mutation 4 are included.

[0029] As a preferred embodiment of the present invention, the Taq DNA polymerase with enhanced base mismatch recognition comprises mutation 2 and mutation 3 compared with the amino acid sequence of the wild-type Taq DNA polymerase;

[0030] Mutation 2: E507K;

[0031] Mutation 3: T509K.

[0032] More preferably, only mutation 2 and mutation 3 are included.

[0033] As a preferred embodiment of the present invention, the Taq DNA polymerase with enhanced base mismatch recognition comprises mutation 2, mutation 3 and mutation 4 compared with the amino acid sequence of the wild-type Taq DNA polymerase;

[0034] Mutation 2: E507K;

[0035] Mutation 3: T509K;

[0036] Mutation 4: R660V / T.

[0037] More preferably, only mutation 2, mutation 3 and mutation 4 are included.

[0038] As a preferred embodiment of the present invention, the Taq DNA polymerase with enhanced base mismatch recognition ability also includes a reversibly inactivated hot start modification, such as chemical modification, nucleic acid aptamer modification, affinity antibody modification, etc. The modified Taq DNA polymerase completely loses (or mostly loses) polymerase activity at low temperatures, and the hot start modification is destroyed after the temperature is raised, and the polymerase activity is reactivated.

[0039] Specifically, the chemical modification is disclosed in patent CN1282741C (Roche), and the preparation method is as follows: a Taq DNA polymerase having enhanced base mismatch recognition ability is mixed and reacted with a dicarboxylic anhydride having a structure of formula (I) or formula (II) at an alkaline pH value and below 25° C.

[0040] The structural formula of the dicarboxylic anhydride having the structure of formula (I) or formula (II) is as follows:

[0041]

[0042] In formula (I), R1 and R2 are each independently selected from hydrogen or an organic group, and they may be connected;

[0043] In formula (II), R1 and R2 are each independently selected from an organic group, they may be linked, and hydrogen is cis;

[0044] The organic group may be directly connected to the ring via a carbon-carbon bond, a carbon-heteroatom bond (such as a carbon-oxygen bond, a carbon-nitrogen bond, a carbon-sulfur bond);

[0045] The organic groups may also be linked to each other to form a ring structure, for example, 3,4,5,6-tetrahydrophthalic anhydride.

[0046] Specifically, the modification of the nucleic acid aptamer refers to patents CN101768616B (Roche) and US9109226B2 (NEB). The nucleic acid aptamer can be obtained by screening using the SELEX technology. Its inhibitory properties on Taq DNA polymerase do not depend on the specific nucleotide sequence, but are determined by the conformation or shape of the secondary structure formed by the sequence and the melting temperature of the structure.

[0047] Specifically, the affinity antibody modification is described in patents EP726324B1 (Johnson & Johnson) and CN107119029A (Hailite), and the affinity antibody can be obtained by immune screening.

[0048] As a preferred embodiment of the present invention, the Taq DNA polymerase with enhanced base mismatch recognition is fused with Sso7d, PCNA or other protein tags (such as His, GST).

[0049] The gene encoding the Taq DNA polymerase with enhanced base mismatch recognition.

[0050] As a preferred embodiment of the present invention, without changing the amino acid sequence of the encoded Taq DNA polymerase, the codon preference of the host cell is optimized.

[0051] A biological material comprises the above-mentioned Taq DNA polymerase with enhanced base mismatch recognition ability or a gene encoding the same.

[0052] As a preferred embodiment of the present invention, the biological material includes but is not limited to a recombinant expression vector, a gene expression cassette, a recombinant bacterium, and the like.

[0053] As a preferred embodiment of the present invention, the method for preparing the recombinant expression vector is: introducing a gene encoding Taq DNA polymerase with enhanced base mismatch recognition into the expression vector to obtain the recombinant expression vector.

[0054] As a preferred embodiment of the present invention, the method for preparing the recombinant bacteria is: transferring the above-mentioned recombinant expression vector into a host bacterium (such as Escherichia coli) to obtain the recombinant bacteria.

[0055] A gene mutation detection reagent comprises the above-mentioned Taq DNA polymerase with enhanced base mismatch recognition ability.

[0056] As a preferred embodiment of the present invention, the gene mutation detection reagent further comprises primers, probes, reaction buffer (containing Mg 2+ , dNTPs, buffer substances, cosolvents, additives, etc.), reverse transcriptase, and one or more of UDG enzyme.

[0057] Specifically, the buffer material includes but is not limited to Tris-HCl, Tris-H 2 SO 4 .

[0058] Specifically, the cosolvent includes, but is not limited to, formamide, dimethyl sulfoxide (DMSO), ethylene glycol, 1,2-propylene glycol, and polyethylene glycol (PEG).

[0059] Specifically, the additives include but are not limited to NaCl, KCl, EDTA, betaine, tetramethylammonium chloride (TMAC), ammonium chloride, ammonium sulfate, ammonium acetate, glycerol, bovine serum albumin (BSA), gelatin, dithiothreitol (DTT), cationic or non-ionic detergents (such as Tween-20, Triton X-100, NP-40, etc.).

[0060] Application of Taq DNA polymerase with enhanced base mismatch recognition in gene mutation detection.

[0061] As a preferred embodiment of the present invention, the application is: preparing a reaction system containing the above-mentioned Taq DNA polymerase, performing an ARMS-PCR reaction, analyzing the amplification result, and determining whether there is a gene mutation.

[0062] Beneficial effects of the present invention:

[0063] The Taq DNA polymerase provided by the present invention has enhanced base mismatch recognition, and also retains polymerase activity, and is particularly suitable for detection of gene mutations containing mismatched bases at the 3' end of the primer. Experimental results show that the Ct values ​​of mutants M9, M10, M11, M12, M13, and M14 amplified with 3' end base mismatch primers are significantly greater than the Ct values ​​amplified with normal primers, and the above mutants can adapt to the rapid amplification program of 60°C 5s. Especially mutant M14, whether the Ct values ​​amplified with 3' end 1 base mismatch primer or 2, 3 base mismatch primers are extremely significantly greater than normal primers, indicating that mutant M14 has the strongest ability to distinguish errors, followed by mutant M12, followed by mutants M9, M10, M11, and M13, and the above mutants can be used to prepare gene mutation detection reagents.

[0064] The gene mutation detection reagent provided by the present invention has a simple composition and low cost, and can also improve the specificity and sensitivity of detection, thus having high economic value and good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 This is the error detection performance test result of the Taq DNA polymerase mutant in the experimental example.

[0066] Figure 2 This is a graph showing the amplification results of the Taq DNA polymerase mutant M14 in the experimental example.

[0067] In order to more clearly illustrate the technical solution to be protected by the present invention, the above drawings obtained in the experimental examples are briefly introduced. It should be understood that the above drawings only show the technical solutions and technical effects of certain experimental examples of the present invention, and should not be regarded as any limitation on the protection scope of the present invention. For ordinary technicians in this field, other related drawings can also be obtained based on these drawings without paying creative work. DETAILED DESCRIPTION

[0068] The technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments and experimental examples. Those skilled in the art should understand that the following embodiments and experimental examples are only used to illustrate the technical solution of the present invention and should not be regarded as any limitation on the scope of protection of the claims. Based on the following embodiments and experimental examples, other technical solutions obtained by ordinary technicians in the field without paying creative work, such as technical solutions obtained after modification, denaturation or simple replacement, should all belong to the scope of protection of the present invention. In the absence of conflict, the technical features in different embodiments can be combined and replaced with each other.

[0069] The methods used in the embodiments and experimental examples (including molecular biology and nucleic acid chemistry methods) are all prior arts and are introduced in books and documents, see "Molecular Cloning Laboratory Guide", Cold Spring Harbor Laboratory Press; "Oligonucleotide Synthesis", MJ Gait et al., 1984; "Nudeic Acid Hybridization", BD Hames and SJ Higgins, 1984; "Basic Methods in Molecular Biology", Elsevier; "Current Protocols in Molecular Biology", John Wiley and Sons; "Methods in Enzymology", American Academic Press.

[0070] Unless otherwise specified, the raw materials (including biological materials), reagents, culture media, instruments, etc. used in the embodiments and experimental examples can be obtained through commercial channels.

[0071] The terms and abbreviations used in the embodiments and experimental examples have the conventional meanings in the art, such as PBS is phosphate buffered saline.

[0072] Example 1

[0073] This embodiment provides a Taq DNA polymerase with enhanced base mismatch recognition ability, which only comprises mutation 1 and mutation 2 compared with the amino acid sequence of the wild-type Taq DNA polymerase (as shown in SEQ ID NO: 1):

[0074] Mutation 1: T506K;

[0075] Mutation 2: E507K.

[0076] This embodiment provides a method for preparing a Taq DNA polymerase with enhanced base mismatch recognition ability, the steps are as follows:

[0077] 1. Construction of mutant strains

[0078] (1) Circle expansion PCR

[0079] The coding gene of wild-type Taq DNA polymerase (as shown in SEQ ID NO: 2) was synthesized outsourced and constructed on pET-30a plasmid. The plasmid was used as a template and the primer pairs shown in Table 1 were used for expansion PCR. The reaction system was shown in Table 2 and the reaction procedure was shown in Table 3 to obtain a plasmid with a mutation site.

[0080] Table 1 Construction primers corresponding to each mutation site

[0081]

[0082]

[0083] Table 2 Reaction system of expansion PCR

[0084]

[0085]

[0086] Table 3 Reaction procedure of expansion PCR

[0087]

[0088] Take 5 μL of PCR product for agarose gel electrophoresis to confirm that the target band is of correct size and single, and the remaining product is used for subsequent experiments.

[0089] (2) Dpn1 digestion

[0090] 1 μL DpnI (NEB, R0176S) was added to 20 μL PCR product and incubated at 37°C in a PCR instrument for 40 min.

[0091] (3) Conversion

[0092] Add 5 μL of DpnI digestion product to BL21 (DE3), place on ice for 30 min, heat shock at 42°C for 90 s, place on ice for 2 min, add 800 μL of LB medium, shake on a shaker for 1 h, spread 100 μL of the mixture on a plate, culture at 37°C overnight, screen positive clones by colony PCR, and sequence to obtain recombinant strains containing the corresponding mutation sites.

[0093] The PCR screening system is shown in Table 4. 1 μL of bacterial solution was added for detection. The reaction procedure was: 95°C pre-reaction for 5 min, followed by 95°C for 30 s, 65°C for 30 s, and 72°C for 3 min, for 28 cycles. After the reaction, agarose gel electrophoresis was performed to screen positive clones.

[0094] Table 4 PCR screening system

[0095] Components Dosage (μL) 2×Taq Mix (Yisheng) 25 Bacterial liquid 1 10 μM Primer T7 1 10 μM primer T7 ter 1 water 22

[0096] 2. Expression and purification of recombinant proteins

[0097] The recombinant strain with correct sequencing was fermented to prepare recombinant protein, inoculated into LB medium at an inoculum of 2%, cultured at 37°C with shaking until OD600 was 0.6-0.8, added IPTG with a final concentration of 0.5mM to induce expression, cultured overnight at 16°C for about 16h, and collected the bacteria. The bacteria were resuspended in a buffer (composed of: 50mM Tris-HCl, pH 7.5, 0.3M NaCl, 1mM EDTA, 1mM DTT) at a ratio of 1:10, the cells were broken by ultrasonic treatment, and the supernatant was collected by centrifugation. PEI with a final concentration of 0.2% was added to the supernatant, and the supernatant was collected by centrifugation. 40% ammonium sulfate was added to the supernatant to precipitate the protein. The collected protein was purified by SP chromatography column to obtain a crude sample from which most of the impurities had been removed. The crude sample was stored in storage buffer (composition: 20mM Tris-HCl, 100mM NaCl, 0.1mM EDTA, 1mM DTT, 0.01% NP-40Alternative, 50% glycerol, pH 7.5 at 25°C) and diluted to 0.71mg / mL for subsequent mutant screening and performance evaluation.

[0098] Example 2

[0099] This embodiment provides a Taq DNA polymerase with enhanced base mismatch recognition (amino acid sequence as shown in SEQ ID NO: 4), which only comprises mutation 1, mutation 2 and mutation 4 compared with the amino acid sequence of wild-type Taq DNA polymerase (as shown in SEQ ID NO: 1):

[0100] Mutation 1: T506K;

[0101] Mutation 2: E507K;

[0102] Mutation 4: R660V.

[0103] The method for preparing the Taq DNA polymerase with enhanced base mismatch recognition provided in this example is basically the same as that in Example 1, except that the primers used for construction are not completely the same, as shown in Table 1.

[0104] In other embodiments of the present invention, Taq DNA polymerase mutants as shown in Table 5 were constructed according to methods substantially the same as in Example 1, and the construction primers corresponding to each mutation site were shown in Table 1 (SEQ ID NO: 5-34).

[0105] Table 5 Constructed Taq DNA polymerase containing mutations

[0106] Mutants Mutation site M1 K508Y, G510R M2 E507K, R536K, R660V M3 S543A, R630W, F692Y, Y719F M4 S577A, W645R, I707V M5 R536K, R587K, R660V M6 E507K, R536K, R587K, R660V M7 E507K, R660T M8 E507K、R660V M9 T509K, E507K, R660V M10 T509K M11 T506K M12 T509K, E507K M13 T506K, E507K M14 T506K, E507K, R660V

[0107] Experimental example

[0108] The constructed Taq DNA polymerase mutant was tested for error detection performance. The experimental method includes: designing normal amplification primers for λDNA, 3' end base mismatch primers and TaqMan probes, as shown in Table 6, using qPCR to evaluate the error detection performance of the Taq DNA polymerase mutant, and the qPCR reaction system and rapid amplification reaction procedures are shown in Table 7 (SEQ ID NO: 35-42). The results are judged based on the Ct value and the net amplification result. Figure 1 , 2 shown. Figure 1 "Net amplification" stands for the net amplification height, which refers to the difference between the fluorescence value after the amplification is completed and the initial fluorescence value (Rn). Under the same reaction conditions, the higher the net amplification height, the higher the polymerase activity and the stronger the amplification ability. "Ct" stands for the Ct value. The greater the difference from the Ct value of the normal primer, the stronger the 3' end base mismatch recognition of the DNA polymerase and the better the error detection performance. "Signal-to-noise ratio" is the ratio of Rn to the initial fluorescence value.

[0109] Table 6 Primers and TaqMan probes

[0110] Primer or probe Sequence (5'-3') 1F agtgctcgcaacattcgcttat 1R atcgtcacagcgcgatatgc 1T 6-FAM-ttgccgtagtgccgcgacgcc-TAMRA 1F1A agtgctcgcaacattcgcttaA 1F2C agtgctcgcaacattcgcttCt 1F3A agtgctcgcaacattcgctAat 1F1G agtgctcgcaacattcgcttaG 1F1C agtgctcgcaacattcgcttaC

[0111] Table 7 qPCR reaction system and reaction procedure

[0112]

[0113] from Figure 1It can be seen that the Taq DNA polymerase mutant M3 has no net amplification (Rn) whether it is amplified with normal primers or mismatched primers, indicating that it is similar to the wild-type Taq DNA polymerase and is not suitable for the rapid amplification program of 60℃5s. Mutants M1, M2, M4, M5, M6, M7, M8, M9, M10, M11, M12, M13, and M14 all have net amplification, indicating that the above mutants can adapt to the rapid amplification program of 60℃5s, and the Ct value amplified with the 3' end base mismatched primer is greater than the Ct value amplified with the normal primer.

[0114] Among the above mutants, the Ct values ​​of M9, M10, M11, M12, and M13 amplified with primers with 1 base mismatch at the 3' end were significantly greater than those of other mismatch primers and normal primers, while the mutant M14 (see Figure 2 ), the Ct values ​​of the amplifications using the primers with mismatched base 1 at the 3' end or the primers with mismatched bases 2 and 3 are significantly greater than those of the normal primers, indicating that the mutant M14 has the strongest error discrimination ability (basically consistent with the mutant M2), followed by the mutant M12 (amino acid sequence as shown in SEQ ID NO: 3), followed by the mutants M9, M10, M11, and M13. The mutants M9, M10, M12, and M14 with "the difference of Ct value amplified by mismatched primers minus Ct value amplified by normal primers>4" were screened out for the preparation of gene mutation detection reagents.

[0115] Although the technical solution of the present invention has been described in detail above with general descriptions, specific embodiments and experimental examples, for ordinary technicians in this field, modifications, substitutions or improvements made without departing from the spirit of the present invention should all fall within the scope of protection of the present invention.

Claims

1. A Taq DNA polymerase with enhanced base mismatch recognition, characterized in that: Compared with the amino acid sequence of wild-type Taq DNA polymerase, it contains mutation 1 or mutation 3; If mutation 1 is included, one or two of mutation 2 and mutation 4 are also included; If mutation 3 is included, one or two of mutation 2 and mutation 4 may be included optionally; Mutation 1: T506K, i.e., threonine at position 506 mutates to lysine; Mutation 2: E507K, i.e., glutamic acid at position 507 mutated to lysine; Mutation 3: T509K, i.e., threonine at position 509 mutated to lysine; Mutation 4: R660V / T, i.e., the arginine at position 660 mutates to valine or threonine; The amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO:

1.

2. The Taq DNA polymerase according to claim 1, characterized in that: The Taq DNA polymerase with enhanced base mismatch recognition ability comprises mutation 1 and mutation 2 compared with the amino acid sequence of the wild-type Taq DNA polymerase; Mutation 1: T506K; Mutation 2: E507K.

3. The Taq DNA polymerase according to claim 1, characterized in that: Compared with the amino acid sequence of wild-type Taq DNA polymerase, the Taq DNA polymerase with enhanced base mismatch recognition comprises mutation 1, mutation 2 and mutation 4: Mutation 1: T506K; Mutation 2: E507K; Mutation 4: R660V / T.

4. The Taq DNA polymerase according to claim 1, characterized in that: The Taq DNA polymerase with enhanced base mismatch recognition ability comprises mutation 2 and mutation 3 compared with the amino acid sequence of wild-type Taq DNA polymerase; Mutation 2: E507K; Mutation 3: T509K.

5. The Taq DNA polymerase according to claim 1, characterized in that: The Taq DNA polymerase with enhanced base mismatch recognition ability comprises mutation 2, mutation 3 and mutation 4 compared with the amino acid sequence of wild-type Taq DNA polymerase; Mutation 2: E507K; Mutation 3: T509K; Mutation 4: R660V / T.

6. The Taq DNA polymerase according to claim 1, characterized in that: The Taq DNA polymerase with enhanced base mismatch recognition also includes reversible inactivation hot start modification, including but not limited to chemical modification, nucleic acid aptamer modification, and affinity antibody modification; And / or, the Taq DNA polymerase with enhanced base mismatch recognition ability is fused with Sso7d, PCNA or other protein tags.

7. The gene encoding the Taq DNA polymerase with enhanced base mismatch recognition according to any one of claims 1 to 6.

8. A biomaterial, characterized in that: Comprising the Taq DNA polymerase with enhanced base mismatch recognition according to any one of claims 1 to 6, or its encoding gene according to claim 7.

9. A gene mutation detection reagent, characterized in that: The method comprises the Taq DNA polymerase with enhanced base mismatch recognition according to any one of claims 1 to 6.

10. Use of the Taq DNA polymerase with enhanced base mismatch recognition according to any one of claims 1 to 6 in gene mutation detection.

Images