KASP molecular marker closely linked with growth of larch and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker closely linked with growth of larch and application of the KASP molecular marker, the KASP molecular marker is designed according to an SNP site of a larch genome, the SNP site has A / C base mutation, genotypes of A: C and C: C are genotypes with fast-growing property, and the genotype of A: A is genotype without fast-growing property. The invention also discloses a primer for detecting the KASP molecular marker and a method for identifying whether larch has fast-growing property or not by using the primer, and also discloses application of a reagent, the primer or the method for detecting the molecular marker in identifying whether larch has fast-growing property or not in a seedling stage and in larch molecular marker-assisted breeding. The primer disclosed by the invention can be used for rapidly identifying whether the larch has fast-growing property or not, has the advantages of accuracy, rapidness, low cost, short identification period, simplicity and convenience in operation and the like, can be used for assisting the breeding of excellent strains of the larch, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of forest tree molecular marker assisted breeding, and specifically relates to a KASP molecular marker closely linked to larch growth (diameter at breast height) and application thereof. Background Art

[0002] Larix spp., Pinaceae, is an important economic tree species, valued for its rapid growth, high-quality wood and wide adaptability. However, traditional breeding methods have problems such as low efficiency and long cycle in improving the growth rate and excellent traits of larch. Therefore, developing molecular markers closely linked to low growth and auxiliary selection of larch fiber growth through molecular markers will effectively save breeding time and land, accelerate the breeding process, and have important practical significance for the selection and promotion of larch varieties. KASP (Kompetitive Allele-Specific PCR), that is, competitive allele-specific PCR, has the advantages of high throughput, low cost, high efficiency, and no need for electrophoresis detection compared with traditional PCR methods. Summary of the invention

[0003] The first object of the present invention is to provide a KASP molecular marker that is closely linked to the growth (DBH) of larch and a primer for detecting the KASP molecular marker.

[0004] The present invention also aims to provide a method for identifying the fast-growing property of larch.

[0005] The last object of the present invention is to provide a reagent, primer or method for detecting the above KASP molecular marker and its application in identifying larch growth phenotype and in larch molecular marker-assisted breeding.

[0006] The above-mentioned first object of the present invention can be achieved by the following technical scheme: a KASP molecular marker (nucleotide sequence is shown in SEQ ID NO.4) closely linked to the growth of larch, the KASP molecular marker is designed based on a SNP site on the larch genome, the SNP site has an A / C base mutation, and the corresponding genotypes include A:A, A:C and C:C, wherein the C:C and A:C genotypes show fast-growing genotypes, and the A:A genotype shows a genotype that does not have fast-growing properties. The KASP molecular marker can be obtained by amplification of primers shown in SEQ ID NO.1 to SEQ ID NO.3, respectively.

[0007] The nucleotide sequence of the KASP molecular marker is as follows:

[0008] AAGACTTGGAACACATAATACATCTTTGAAATTACCATCATCTAGTTGAATTGTT CCATATCCTACAACATTCAGATATCTATCATCACCAACAAATATTTGTTGGGTGTTACA TTCATTTAGAGTAGAAAAGTGGCTTTATCCTTATCC(A / C)AATGATAATATTCTCCAAC ATCAATGAGTCACTCATTAGAAGAAGAAGAAGATGCATTAAAGGAAAAACTAGAAGCGGAAAATGTATGTCCATGACATGTAGAGTTAGAAGAAAAATCAAGTTTGATGGTTTGCTTCTTTATTCATGATT

[0009] In the present invention, a SNP site is mutated in the case of fast-growing cells, and is not mutated in the case of not fast-growing cells.

[0010] The present invention also provides a set of primers for detecting KASP molecular markers closely linked to larch growth, the set of primers comprising two specific upstream primers sca235:1015388-F3 and sca235:1015388-F4 and a universal downstream primer sca235:1015388-R2, wherein the nucleotide sequence of the upstream primer sca235:1015388-F3 is as shown in SEQ ID NO.1, the nucleotide sequence of the upstream primer sca235:1015388-F4 is as shown in SEQ ID NO.2, the nucleotide sequence of the downstream primer sca235:1015388-R2 is as shown in SEQ ID NO.3, a FAM fluorescent label sequence is added to the 5' end of the upstream primer sca235:1015388-F3, and a VIC fluorescent label sequence is added to the 5' end of the upstream primer sca235:1015388-F4.

[0011] After the PCR products of the present invention are subjected to fluorescence detection, typing detection is performed on the PCR amplification products and the results are presented in the form of a chart; the chart is divided into X and Y axes, each data point represents an independent DNA sample, and samples of the same genotype are clustered together, wherein the genotype is T:T type, the fluorescent signal is blue, and the material is gathered near the Y axis, which is determined to be a homozygous material without rapid growth; the genotype is G:T type, the fluorescent signal is green, and the material is gathered near the middle position, which is determined to be a heterozygous material with rapid growth; the genotype is G:G, the fluorescent signal is red, and the material is gathered near the X axis, which is determined to be a homozygous material with rapid growth.

[0012] The last object of the present invention can be achieved by the following technical solution: use of a reagent for detecting the KASP molecular marker in identifying the growth phenotype of larch.

[0013] The present invention has the following advantages:

[0014] The KASP molecular marker primers in the present invention can quickly identify the growth phenotype of larch, and have the advantages of accuracy, rapidity, low cost, short identification cycle, simple operation, etc., can assist in the breeding of new larch strains, and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the genotyping diagram of the larch population using the KASP molecular marker primer sca235:1015388 in Example 2. The genotype is T:T type, the fluorescent signal is blue, and the material is concentrated near the Y axis, which is determined to be a homozygous material without fast growth; the genotype is G:T type, the fluorescent signal is green, and it is concentrated near the middle position, which is determined to be a heterozygous material with fast growth; the genotype is G:G The fluorescent signal is red, and it is concentrated near the X axis, which is determined to be a homozygous material with fast growth. DETAILED DESCRIPTION

[0016] In order to make the objectives, technical solutions and advantages of the embodiments of the present invention more clearly understood, the spirit of the contents disclosed by the present invention will be described in detail below. After understanding the embodiments of the contents of the present invention, any technician in the relevant technical field can change and modify them according to the techniques taught by the contents of the present invention without departing from the spirit and scope of the contents of the present invention.

[0017] The exemplary embodiments of the present invention and the description thereof are used to explain the present invention but are not intended to limit the present invention.

[0018] Example 1

[0019] In this example, 310 hybrid larch plants from 39 populations were used as materials to construct a gene pool, and RAD-seq was performed to obtain SNP sites and perform genome-wide association analysis on growth (DBH) traits, and the SNP site sca235:1015388 closely linked to the growth traits of larch was determined (as shown in Table 1).

[0020] According to the SNP site information, PrimerPicker Lite for KASPar Version 0.26 (https: / / www.biosearchtech.com / ) was used to develop KASP markers. One marker contains three primers, of which the two upstream primers sca235:1015388-F3 and sca235:1015388-F4 are specific primers designed according to the SNP site sca235:1015388, and the downstream primer sca235:1015388-R2 is a universal primer; the 3' end of the upstream primer is a variant base, and the 5' end is connected to the carboxyfluorescein FAM (GAAGGTGACCAAGTTCATGCT) and phosphoramidite fluorescein VIC (GAAGGTCGGAGTCAACGGATT) fluorescent signal tag sequences, respectively. The three primer sequences are as follows:

[0021] 1)sca235:1015388-F3:

[0022] 5'- GAAGGTGACCAAGTT CATGCTTTGATGTTGGAGAATATTATCATTG-3' (SEQ ID NO. 1), the underlined portion is the sequence of fluorescein FAM.

[0023] 2)sca235:1015388-F4:

[0024] 5'- GAAGGTCGGAGTCAACGGATT ATTGATGTTGGAGAATATTATCATTT-3' (SEQ ID NO. 2), the underlined portion is the sequence of fluorescein VIC.

[0025] 3)sca235:1015388-R2:

[0026] 5'-TTGTTGGGGTTACATTCATTTAGA-3' (SEQ ID NO. 3).

[0027] The primers can also be developed into a kit for use.

[0028] Example 2

[0029] The PCR amplification of larch single plants using the above-mentioned labeled primers and the detection of PCR products include the following steps:

[0030] (1) Larch DNA extraction

[0031] The experimental material is fresh leaves of a single larch plant, and the steps for extracting genomic DNA are as follows:

[0032] ① Take a small amount of fresh leaves and put them into a 2mL centrifuge tube, add steel balls, grind them on a grinder, shake 30 times per second for 2 minutes, add 800μL of 2% CTAB extract, mix well, and place in a 65℃ water bath for 1h (shake well every 10 minutes);

[0033] ② After standing to room temperature, add 800 μL of chloroform: isoamyl alcohol (volume ratio 24:1), mix gently for 10 minutes, and then centrifuge at 12000 rpm for 15 minutes. Transfer the supernatant (about 600 μL) to a new 1.5 mL centrifuge tube;

[0034] ③ Add 2 / 3 volume of isopropanol to the supernatant, mix gently and place at -20℃ for 30min~1h;

[0035] ④12000rmp, centrifuge for 10min, discard the supernatant;

[0036] ⑤ Add anhydrous ethanol to the centrifuge tube to wash the DNA precipitate once, then wash it once with 75% (volume percentage) ethanol, and blow dry it on the clean bench;

[0037] ⑥ Add 50 μL TE (or ddH2O) to dissolve and use as larch genomic DNA.

[0038] (2) Using larch genomic DNA as a template, PCR amplification was performed using the KASP molecular marker primers in Example 1.

[0039] PCR amplification was performed in a CFX fluorescence quantifier from BIO-RAD. The 5 μL reaction system included: 1.25 μL of genomic DNA at a concentration of 100 ng / μL, 2.5 μL of HiGeno2×ProbeMixA, 0.25 μL of each upstream primer at a concentration of 10 mM, and 0.75 μL of a downstream primer at a concentration of 10 mM.

[0040] The PCR amplification program was as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 20 s, annealing at 61-55°C for 1 min, with the annealing temperature decreasing by 0.6°C per cycle for a total of 10 cycles, followed by denaturation at 95°C for 20 s and extension at 55°C for 1 min. After 27 cycles, the fluorescence signal was read at 25°C for 1 min.

[0041] (3) Amplification results:

[0042] The primers of Example 1 are used for PCR amplification, and the amplified products are subjected to fluorescence detection. The fluorescence signal is combined with the label information to complete the genotyping and present it in the form of a chart; Figure 1 As shown, the figure is divided into X and Y axes, each data point represents an independent DNA sample, and samples with the same genotype are clustered together.

[0043] like Figure 1 After the PCR products were read by fluorescence, there was one genotype that did not grow rapidly, and the fluorescence signal of the genotype "T:T" was blue and concentrated near the Y-axis. There were two genotypes that grew rapidly, and the fluorescence signal of the genotype "G:G" was red and concentrated near the X-axis. The fluorescence signal of the genotype "G:T" was green and concentrated near the middle.

[0044] The results show that when the growth-assisted selection of larch is carried out, the phenotype of the fast-growing individual plants in the population is consistent with the band pattern amplified by the primers of the molecular markers. This example uses KASP molecular markers to screen whether larch has fast-growing ability, thereby realizing assisted breeding of larch.

[0045] Table 1 Gene location results of SNP site sca3332:283854

[0046] CHROM POS REF ALT sca235 1015388 A C

Claims

1. A KASP molecular marker closely linked to larch growth and its application, characterized in that The molecular marker is used to assist larch breeding; the KASP molecular marker has an A / C base mutation at position 1015388 of chromosome sca235:1015388; the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.

4.

2. The use according to claim 1, characterized in that The auxiliary larch breeding is achieved by screening larch based on larch growth (diameter at breast height).

3. The use according to claim 1, characterized in that The A / C base mutation corresponds to genotypes including A:A, A:C and C:C, wherein the A:A genotype is a genotype that does not grow rapidly, and the A:C and C:C genotypes are genotypes that grow rapidly.

4. The use according to claim 1 or 2, characterized in that The auxiliary larch breeding is to select high-quality larch based on larch growth (DBH), and the specific method is as follows: 1) Obtaining DNA of larch to be tested; 2) Using primers to perform fluorescence quantitative PCR amplification; 3) Genotyping of PCR products after fluorescence detection: blue fluorescence signals are recorded as T:T genotype; green fluorescence signals are recorded as G:T genotype; red fluorescence signals are recorded as G:G genotype; 4) The G:G and G:T genotypes are fast-growing genotypes, while the T:T genotype is not fast-growing genotype.

5. The use according to claim 4, characterized in that The primers used for fluorescence quantitative PCR amplification are as follows: sca235:1015388-F3: 5’- GAAGGTGACCAAGTT CATGCTTTGATGTTGGAGAATATTATCATTG-3’; sca235:1015388-F4: 5'- GAAGGTCGGAGTCAACGGATT ATTGATGTTGGAGAATATTATCATTT-3'; sca235:1015388-R2: 5'-TTGTTGGGGTTACATTCATTTAGA-3'.

6. A primer for detecting KASP molecular markers related to larch growth, characterized in that The primer sequences are sca235:1015388-F3, sca235:1015388-F4 and sca235:1015388-R2; the nucleotide sequence of sca235:1015388-F3 is shown in SEQ ID NO.1, the nucleotide sequence of sca235:1015388-F4 is shown in SEQ ID NO.2, and the nucleotide sequence of sca235:1015388-R2 is shown in SEQ ID NO.

3.

7. A kit comprising the primers according to claim 6.

Images