SNP (Single Nucleotide Polymorphism) molecular marker for identifying early blossoming variety of chrysanthemum and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker for identifying early blossoming varieties of chrysanthemums and application of the SNP molecular marker, and belongs to the technical field of SNP molecular markers. The SNP molecular marker for identifying the early blossoming variety of the chrysanthemum is obtained by applying a whole genome association analysis method, the SNP molecular marker is located at the 296119494th site of a No.1 chromosome, and the name of the site is LG01: 296119494; the molecular marker is located at the 214th site of the CiSMXL gene; the nucleotide sequence of the CiSMXL gene is as shown in SEQ ID No. 1; the two nucleotide bases of the site are T or A. The bases of the SNP molecular marker have T / A polymorphism, which leads to the change of the flowering time of chrysanthemum. By detecting the LG01: 296119494 site of chrysanthemum indicum, the flowering phase can be identified in the early stage in the seedling stage of chrysanthemum indicum, and whether an individual belongs to an early flower type / late flower type or not is effectively determined; different varieties are identified in the chrysanthemum seedling stage according to market requirements, and different florescence varieties are sorted, so that the screening efficiency and breeding efficiency of the chrysanthemum florescence are improved, and the production cost is reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of SNP molecular markers, and particularly relates to a SNP molecular marker for identifying early-flowering chrysanthemum varieties and an application thereof. Background Art

[0002] Chrysanthemum (Chrysanthemum morifolium Ramat.) belongs to the Asteraceae family and has high ornamental and economic value. It is popular for its extremely beautiful and colorful flowers and has become one of the commercially developed flower crops.

[0003] Flowering period is an important trait that affects the production and quality of chrysanthemums, and the early or late flowering period directly determines the growth cycle, market supply and economic benefits of chrysanthemums. In order to achieve precise control and identification of the early or late flowering period, traditional phenotypic observation methods have gradually failed to meet the needs of modern agriculture for rapid, accurate and non-destructive observation. Traditional methods mainly rely on observing the flowering time, which usually requires a long growth cycle and is easily affected by factors such as the environment and cultivation management. In addition, phenotypic observation requires a lot of manual input and is costly.

[0004] With the progress of genomics, SNP molecular marker technology has gradually been introduced into plant breeding and flowering period identification. Through genome-wide association analysis (GWAS) of large-scale genetic resources, gene loci associated with important traits can be identified, which makes it possible to detect SNP molecular markers for early and late flowering. However, most of the existing SNP molecular markers are concentrated in some single traits or a few gene regions, and related studies are mostly limited to a single variety or a small number of populations, lacking adaptability research under a wide range of populations and environmental conditions. More importantly, most existing methods lack markers that can accurately identify flowering periods in the seedling stage or early stages, which is of great significance for shortening the breeding cycle and improving efficiency. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a SNP molecular marker for identifying early-flowering chrysanthemum varieties and an application thereof.

[0006] The present invention conducts GWAS analysis on a wide range of populations and flowering period traits, and finds that a candidate gene (CM01G712150) has a non-synonymous substitution (T→A) at the 214th base site (1st exon), causing the 72nd amino acid to mutate from serine to threonine, and sequencing confirms that the site is significantly related to the early and late flowering period of chrysanthemum. Through protein sequence alignment, it is homologous to AT4G29920 (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN-RELATED) in Arabidopsis, so it is named CiSMXL. Specifically, the T allele at this site is closely related to the early flowering phenotype, and the A allele is significantly associated with the late flowering phenotype. Therefore, locating the CiSMXL mutation site related to the flowering period and developing the corresponding SNP molecular marker tool will help to quickly identify the flowering period characteristics.

[0007] Furthermore, the present invention proposes a method based on Hitom second-generation sequencing technology, using the 214th site of CiSMXL as a SNP molecular marker, which can achieve rapid identification of flowering period in the seedling stage. This method has the advantages of high efficiency, rapidity, low cost, and low environmental interference, which can effectively make up for the shortcomings of the existing technology and is particularly suitable for large-scale breeding and cultivation management.

[0008] Specifically, the SNP molecular marker for identifying early-flowering chrysanthemum varieties provided by the present invention is located at position 296119494 of chromosome 1, with the site name LG01:296119494; it is located at position 214 of the CiSMXL gene; the nucleotide sequence of the CiSMXL gene is shown in SEQ ID No.1; the two nucleotide bases at the site are T or A, and the bases of this SNP molecular marker have T / A polymorphism, which leads to changes in the flowering time of chrysanthemum, and the traits of different genotypes at the site are as follows: TT: early flowering trait; TA: late flowering trait; AA: late flowering trait.

[0009] The CiSMXL genomic fragment is shown in SEQ ID No.1:

[0010] TGAGGCTGCTTCAGTCTTGAAGCACTCTCTAAGTTTAGCAAGAAGGAGAGGCCATGCTCAGGTCACTCCTCTTCATGTGGCTGCAACTCTTTTGATGAGTTCAAGAGCCACTATTCTAAGAAGAGCTTGCATTAAGTCACAAACAAATGTTTCAAATCATTCCAGTGTTACATCTCAGTTTGGACCTAATAGTACTAATGTCTCACCACCTTTTCATTGTAGGGCACTTGAGCTTTGTTTC;

[0011] The chrysanthemum reference genome used in the present invention is the diploid wild chrysanthemum WT genome of China Agricultural University.

[0012] The present invention also provides a kit for identifying early-flowering chrysanthemum varieties, characterized in that it contains primers for amplifying the SNP molecular markers of claim 1. Specifically, the primer sequences are shown in SEQ ID No.2 and SEQ ID No.3.

[0013]

[0014] The present invention also provides application of the above-provided SNP molecular marker and amplification primer in early-flowering chrysanthemum breeding.

[0015] The method for detecting the flowering time of chrysanthemum using the SNP molecular marker comprises the following steps:

[0016] (1) Extracting genomic DNA of the sample to be tested from chrysanthemum leaves;

[0017] (2) using genomic DNA as a template, PCR amplification of the target sequence in the genomic DNA of the sample to be tested;

[0018] (3) The amplified samples are tested using a fluorescence detection platform, and the flowering time of chrysanthemums is determined based on the polymorphism of the SNP molecular markers reflected by the obtained fluorescence signals;

[0019] (4) When the SNP molecular marker genotype is TT, it is an early flowering trait; when the SNP molecular marker genotype is TA or AA, it is a late flowering trait.

[0020] The composition and PCR reaction procedure of the PCR reaction system for PCR amplification of the above-mentioned SNP molecular markers are as follows:

[0021] The concentration ratio of the upstream primer and the downstream primer of each pair of primers in the system is 1:1; the final concentration of the upstream primer and the downstream primer in the system is preferably 0.1-1.5 μmol / L;

[0022] The system also includes:

[0023] dNTPs: The final concentration in the system is 0.1-0.25 mmol / L each, preferably 0.2 mmol / L;

[0024] Magnesium chloride: the final concentration in the system is 1.0-4.0 mmol / L, preferably 2 mmol / L;

[0025] DNA polymerase: The final concentration in the system is 0.04U / μL,

[0026] PCR buffer: It is prepared by potassium chloride with a final concentration of 10-50 mmol / L in the system and Tris-HCL (pH 7.5-9.0) with a final concentration of 1-10 mmol / L in the system.

[0027] The present invention uses the reference genome of wild chrysanthemum WT and a large amount of resequencing data to identify a SNP site significantly associated with the flowering period of wild chrysanthemum: LG01:296119494. Whole genome association analysis found that this site is significantly associated with the flowering period of wild chrysanthemum population. The discovery of this innovation requires the collection of different wild chrysanthemum ecotypes from various parts of my country. The collected wild chrysanthemum seeds are planted at the Shangzhuang Experimental Station of China Agricultural University. The flowering time is counted for two consecutive years, and the genomic DNA is extracted for whole genome sequencing and resequencing.

[0028] Compared with other related technical solutions in the prior art, the present invention has the following differences:

[0029] First, there has been no large-scale resequencing research published in wild chrysanthemum. Previously, the identification of the flowering period of chrysanthemum could only be done after the chrysanthemum bloomed, and each strain was manually counted, which was costly and labor-intensive. Secondly, the present invention invested a lot of labor to raise and cultivate 161 wild chrysanthemum ecotypes, extract genomic DNA from 161 wild chrysanthemum materials, and resequence them. These data were used as the data basis, and were used in conjunction with the wild chrysanthemum WT reference genome for big data analysis. A large amount of data mining and calculation were performed, which is essentially different from the prior art of citing markers used in other people's literature or selecting markers from certain free databases. Finally, the method of the present invention was verified by PCR amplification and sequencing in early-flowering wild chrysanthemum ecotypes and late-flowering wild chrysanthemum ecotypes, and PCR amplification and sequencing were performed on 6 early-flowering cultivated chrysanthemum varieties and 6 late-flowering cultivated chrysanthemum varieties. The results were consistent with the distribution of SNP genotypes in early and late flowers, so that the identification ability of SNP molecular markers is fully guaranteed.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] Features of the present invention: (1) When the variety is identified by the present invention, DNA directly extracted from seedlings can be used for detection, which is different from the traditional method that requires waiting until the flower buds are transformed or the flowers are blooming before identification, shortening the identification time from several months to several days. (2) Compared with the phenotypic identification method, the identification method based on DNA detection of the present invention is not affected by the external environment and will not change due to changes in environmental conditions. Its results are stable and reliable. (3) Compared with the traditional method of identifying flower bud transformation, the operation of the present invention does not require long-term experience accumulation.

[0032] The present invention can identify the flowering period at an early stage of the chrysanthemum seedling stage by detecting the wild chrysanthemum LG01:296119494 locus, and effectively clarify whether the individual belongs to the early flowering type / late flowering type; identify different varieties according to market demand during the chrysanthemum seedling stage, and sort out varieties with different flowering periods, which is beneficial to improving the screening efficiency and breeding efficiency of the chrysanthemum flowering period and reducing the production cost; it can also be used for variety identification, effectively protecting the rights and interests of producers and breeders, and providing strong technical support for the protection of chrysanthemum germplasm resources and new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 .Results of GWAS analysis of flowering period traits of wild chrysanthemum ecotypes in different regions.

[0034] Figure 2 .Verification diagram of the flowering period site of wild chrysanthemum, notes: A. Number of samples of different genotypes in the population; B. Expression level of CiSMXL gene in leaves / apical buds of early / late flowers; C. PCR electrophoresis diagram of CiSMXL gene fragment in wild chrysanthemum population; D. PCR electrophoresis diagram of CiSMXL gene fragment in cultivated chrysanthemum. DETAILED DESCRIPTION

[0035] Example 1 This example provides a process for obtaining SNP molecular markers of the present invention.

[0036] First, the resequencing results of 161 wild chrysanthemum materials were compared with the diploid wild chrysanthemum WT reference genome sequence of China Agricultural University, and a total of 8,090,751 high-quality SNP sites were obtained after filtering. A genome-wide association study (GWAS) was performed using the wild chrysanthemum budding period-flowering days as the phenotype, and a SNP site significantly associated with flowering period was located, namely LG01:296119494, located on the exon of the CM01G712150 gene on chromosome 1 of the wild chrysanthemum genome ( Figure 1 ), after alignment with the Arabidopsis protein sequence, it was homologous to Arabidopsis heat shock protein-related (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN-RELATED), so it was named CiSMXL. This gene is induced to express when plants respond to environmental stress (such as high temperature, low temperature, drought, and salt stress), and little research has been done on the regulation of flowering time.

[0037] According to the results of haplotype analysis, among the 161 wild chrysanthemum materials, when the LG01:296119494 site was TT, the flowering time was the earliest, and when the site was TA or AA, the flowering time was significantly later than TT, and the site homozygous mutation (AA) had the latest flowering time ( Figure 2 A).

[0038] To verify that CiSMXL regulates flowering time in chrysanthemum, we analyzed the transcriptome of early and late flowering plants and found that CiSMXL was highly expressed in the terminal buds of the late-flowering ecotype, significantly higher than that of the early-flowering ecotype; and significantly higher than that in the leaves (regardless of whether it is early or late flowering) ( Figure 2 B).

[0039] To determine the reliability of the SNP loci, the CiSMXL genomic fragment (sequence 1) of the early-flowering wild chrysanthemum: WT, BJ_03J_6_C, SD_01L_2_A, SX_02S_1_B, SX_01J_1_A and the late-flowering wild chrysanthemum: SC_02C_1_B, HB_05E_3_A, GD_02Y_1_A, GX_03G_1_C, CQ_01Y_1_B was amplified by PCR, and the PCR products were sequenced ( Figure 2 C), the sequencing results were consistent with the resequencing results, and could accurately identify wild species of Chrysanthemum indica with different flowering times (Table 1). In order to apply SNP site identification to a wider range of varieties, PCR amplification and sequencing of CiSMXL genome fragments were performed on six early-flowering cultivated varieties and six late-flowering cultivated varieties. The sequencing results showed that among the cultivated varieties, the T genotype accounted for nearly 100% of the early-flowering varieties, while the A genotype accounted for about 30% of the late-flowering varieties (Table 2).

[0040] Table 1. Proportion of CiSMXL fragment genotypes in wild chrysanthemum population (%)

[0041]

[0042] Table 2. Proportion of CiSMXL fragment genotypes in cultivated chrysanthemum (%)

[0043]

[0044] The sequence of the CiSMXL genomic fragment is as follows (SEQ ID No. 1):

[0045] TGAGGCTGCTTCAGTCTTGAAGCACTCTCTAAGTTTAGCAAGAAGGAGAGGCCATGCTCAGGTCACTCCTCTTCATGTGGCTGCAACTCTTTTGATGAGTTCAAGAGCCACTATTCTAAGAAGAGCTTGCATTAAGTCACAAACAAATGTTTCAAATCATTCCAGTGTTACATCTCAGTTTGGACCTAATAGTACTAATGTCTCACCACCTTTTCATTGTAGGGCACTTGAGCTTTGTTTC

[0046] The above 161 wild chrysanthemum accessions were all from the germplasm bank of China Agricultural University, and their numbers in the germplasm bank are as follows: NMG_01_1_A, LN_2L_A, LN_02L_B, BJ_06J_3_C, BJ_06J_3_A, BJ_07J_1_B, BJ_06J_3_B, BJ_06J_02_A, BJ_06J_2_C, BJ_06J_2_B, BJ_06J_1_B, BJ_06J_1_C, BJ_06J_1_A, BJ_01J_3_C, BJ_01J_2_A, BJ_01J_3_B, BJ_01J_1_C, BJ_02J_1_A, BJ_02J_2_C, BJ_02J_2_ B, HB_02J_A, HB_02J_C, HB_02J_B, BJ_02J_3_A, BJ_05J_1_C, BJ_05J_1_B, BJ_05J_2_A, BJ_03J_1_B, BJ_04J_1_A, BJ_03J_7_C, BJ_03J_7_B, BJ_03J_ 5_C, BJ_03J_6_C, BJ_03J_5_B, SD_06L_12_A, SD_06L_11_B, SD_06L_12_B, SD_06L_12_C, SD_06L_8_A, SD_06L_9_A, SD_06L_10_A, SD_06L_8_C, SD_06L _9_B, SD_06L_8_B, SD_06L_10_C, SD_06L_5_A, SD_06L_7_B, SD_06L_6_A, SD_06L_6_C, SD_06L_5_C, SD_06L_4_A, SD_06L_7_A, SD_06L_5_B, SD_06L_4 _B, SD_06L_2_A, SD_06L_2_C, SD_06L_2_B, SD_06L_1_A, SX_01J_4_B, SX_0 1J_4_A, SX_01J_4_C, SX_01J_1_A, SX_01J_2_C, SX_01J_2_A, SD_09L_2_A, SD_09L_2_C, SD_01L_2_A, SD_01L_3, SD_01L_1, SD_02L_1_B, SD_02L_1_A, SD_02L_1_C, SD_02L_2_C, SD_05L_2_A, SD_05L_2_B, SD_05L_2_C, SD_03L_ 1_B, SD_03L_1_A, SD_07L_2_A, SD_07L_1_A, SD_07L_2_C, SD_02L_3_B, SD_ 04L_1_B, SD_04L_1_A, SD_04L_2_B, SD_04L_2_C, JS_01S_3_B, SX_02S_1_B,SX_02S_1_A, SX_02S_1_C, HN_02Y_A, SH_02H_1_C, SH_02H_1_A, SH_02H_1_B, SC_08C_2_A, SC_08C_2_B, SC_08C_3_C, S C_08C_3_B, SC_10C_3_A, SC_10C_3_C, SC_10C_1_A, SC_10C_2_A, SC_10C_3_B, SC_02C_1_A, SC_02C_3_C, SC_02C_2_A, S C_02C_2_B, SC_02C_3_A, SC_02C_1_B, SC_02C_3_B, HB_05E_3_A, HB_05E_2_C, HB_05E_2_A, HB_05E_2_B, SC_07C_2_B, S C_04C_2_B, ZJ_01Z_5_C, SC_03C_1_C, SC_03C_1_B, SC_03C_1_A, SC_04C_3_B, SC_04C_2_C, SC_04C_2_A, SC_04C_1_A, S C_04C_1_B, SC_04C_1_C, SC_04C_3_A, SC_01C_1_A, CQ_01Y_1_B, SC_05C_2_B, SC_05C_2_C, SC_05C_4_B, SC_05C_2_A, S C_05C_3_A, SC_05C_4_A, SC_07C_3_A, SC_07C_3_B, SC_07C_2_A, SC_07C_1_B, SC_07C_1_A, SC_07C_1_C, SC_07C_3_C, S C_06C_2_B, SC_06C_3_A, GZ_01Q_1_C, GZ_01Q_1_A, GZ_01Q_1_B, YN_02D_1_B, YN_02D_1_A, GD_02Y_1_B, GD_02Y_1_A, G D_01Y_1_B, GX_01G_1_C, GX_02G_1, GX_02G_5, GX_02G_3, GX_03G_1_C, GX_02G_2, GX_03G_1_A, GX_03G_1_B, GX_02G_4. ,

[0047] Example 2: Validity test of SNP molecular markers of the present invention

[0048] 1. Extraction of genomic DNA

[0049] The genomic DNA of the above-mentioned test varieties were extracted from the seedling leaves using the CTAB method.

[0050] The specific operation method is as follows: when the seedlings of the above-mentioned male parent, female parent, and test variety (offspring) grow 4 to 5 true leaves, take about 1 square centimeter of leaf tissue as a sample, place it in a 2mL centrifuge tube, put in a steel ball with a diameter of 4mm, add 250μL EDTA solvent, and grind at 1200r / min for 30s; then add 500μL EDTA solvent, mix it upside down, and place it in a 65℃ oven for lysis for more than 1h; wait for the solution to cool to room temperature, add an equal volume of chloroform (chloroform is added to anhydrous ethanol in a ratio of 24:1 and mixed evenly), and centrifuge at 12000r / min for 10min; draw 600μL of the supernatant into a new 1.5mL centrifuge tube, add an equal volume of anhydrous ethanol, turn it upside down, and let it stand at -20℃ for more than 1h; take it out from -20℃ and centrifuge it at 12000r / min for 10min, pour out the solution, and add 700μL 75% ethanol, centrifuge at 12000r / min for 10min; pour off the solution (supernatant), add 100μL ultrapure water to fully dissolve the solution after it evaporates, and the extraction is complete.

[0051] The quality and concentration of genomic DNA must meet the PCR requirements. The compliance standards are: the A260 / A280 ratio detected by the UV spectrophotometer Nanodrop2000 (Thermo) is around 1.8, and the A260 / A230 ratio is greater than 1.8; the concentration of the genomic DNA of the test variety × is 30-50ng / μL.

[0052] 2. Using the genomic DNA of the above-mentioned test variety and its male and female parents as templates, a PCR amplification reaction is performed to obtain a PCR amplification product, wherein the upstream primer is the primer shown in sequence 2 in the sequence table, and the downstream primer is the primer shown in sequence 3 in the sequence table.

[0053] PCR reaction system, a total of 25 μL, including:

[0054] Template DNA (50 ng): 1 μL,

[0055] Mixture of upstream primer and downstream primer (the concentration ratio of the two is 1:1, a total of 10 μmol / L): 2.0 μL,

[0056] dNTPs (2.5 mμmol / L each): 2.0 μL,

[0057] Ex Taq (5U / μL): 0.2μL,

[0058] 10×Ex Taq Buffer (Mg 2+ plus) (20 mμmol / L): 2.5 μL,

[0059] ddH2O: 17.3 μL.

[0060] 3. Detection of PCR amplification products

[0061] The PCR amplification product is tested for bands by agarose gel electrophoresis, and the product is subjected to second-generation sequencing. Whether the wild chrysanthemum to be tested is an early / late flowering variety is determined based on the sequencing results.

[0062] (3.1) Preparation of agarose gel

[0063] Take 20mL of 50×TAE buffer, add water to 1000mL, prepare 1×TAE dilution buffer, and set aside. Prepare 1% agarose gel solution, weigh 1g of agarose and pour it into a 200mL conical flask, add 100ml of 1×TAE dilution buffer, and heat it in a microwave oven until the agarose is completely melted. Add 5μL of nucleic acid dye to the agarose gel solution cooled to 60±5℃, shake well, and slowly pour it into the gel tank. After 20 minutes, slowly pull out the comb vertically and place the gel plate into the electrophoresis tank. Add electrophoresis buffer (1×TAE) to the electrophoresis tank so that the liquid level is about 1mm higher than the gel surface.

[0064] (3.2) Agarose gel electrophoresis.

[0065] Use a pipette to draw 5uL of PCR product, add it to the gel well, plug in the wire, turn on the electrophoresis instrument, set the voltage to 130V, the current to 300mA, and the time to 15min. After the electrophoresis is completed, place the gel plate on the gel imaging analyzer to observe the electrophoresis results. The PCR product is sent to the company for sequencing.

[0066] 4. Test results

[0067] According to the sequencing results, if the 69th base of the R-direction sequence of the unknown variety amplified band is T, the flowering period of the variety is early flowering. If the 69th base of the R-direction sequence of the unknown variety is A, the flowering period of the variety is late flowering.

[0068] Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by ordinary technicians in this technical field within the essential scope of the present invention should fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker for identifying early-flowering chrysanthemum varieties, characterized in that: The SNP molecular marker is located at position 296119494 of chromosome 1, with the site name LG01:296119494; located at position 214 of the CiSMXL gene; the nucleotide sequence of the CiSMXL gene is shown in SEQ ID No. 1; the two nucleotide bases at this site are T or A, and the bases of this SNP molecular marker have T / A polymorphism, which leads to changes in the flowering time of chrysanthemum. The traits of different genotypes at this site are as follows: TT: early flowering trait; TA: late flowering trait; AA: late flowering trait.

2. A kit for identifying early-flowering chrysanthemum varieties, characterized in that: Contains primers for amplifying the SNP molecular marker according to claim 1.

3. The kit according to claim 2, characterized in that The primer sequences are shown in SEQ ID No.2 and SEQ ID No.

3.

4. Use of the SNP molecular marker described in claim 1 in early flowering breeding of chrysanthemum.

5. Use of the primers according to claim 3 in molecular assisted breeding of chrysanthemum.

6. The method for detecting the flowering time of chrysanthemum using the SNP molecular marker according to claim 1, characterized in that: The method comprises the following steps: (1) Extracting genomic DNA of the sample to be tested from chrysanthemum leaves; (2) using genomic DNA as a template, PCR amplification of the target sequence in the genomic DNA of the sample to be tested; (3) The amplified samples are tested using a fluorescence detection platform, and the flowering time of chrysanthemums is determined based on the polymorphism of the SNP molecular markers reflected by the obtained fluorescence signals; (4) When the SNP molecular marker genotype is TT, it is an early flowering trait; when the SNP molecular marker genotype is TA or AA, it is a late flowering trait.

Images