A SNP molecular marker related to the body weight of sparus aurata and application thereof

By screening for the SNP molecular marker SNP23_4593166, which is related to the body weight of the angelfish, and its specific primers, early and precise selection of angelfish breeding was achieved, solving the problem of unstable growth performance and improving breeding efficiency.

CN122629210APending Publication Date: 2026-08-25SANYA TROPICAL FISHERIES RES INST +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610706162.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-21
Publication Date
2026-08-25

AI Technical Summary

Technical Problem

The existing breeding of angelfish fry relies on wild parent fish or has not been systematically selected, resulting in unstable growth performance and large individual differences. Traditional phenotypic selection breeding has a long cycle and low efficiency, making it difficult to achieve early and precise selection.

Method used

The SNP molecular marker SNP23_4593166, which is associated with the weight trait of the angelfish, was screened out. Specific primers SNP23_4593166RC, SNP23_4593166RT, and SNP23_4593166F were designed. The genotype was determined by PCR amplification and fluorescence signal analysis. Kits were provided for breeding superior weight strains.

Benefits of technology

It enables early and precise breeding, shortens the breeding cycle, improves selection accuracy, overcomes the limitations of traditional breeding that rely on phenotype, and is simple to operate and yields reliable results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_6
    Figure SMS_6
Patent Text Reader

Abstract

The application discloses a SNP molecular marker related to the body weight of Harpadon microchir, which is characterized by being located at the 4593166th base of the 23rd chromosome of the Harpadon microchir, and the sequence of the SNP molecular marker is shown as SEQ ID NO. 1, and the 301st base from the 5' end is A or G; wherein the body weight of an AA genotype individual is significantly higher than that of an AG or GG genotype individual. The application further discloses primers and a kit for detecting the SNP molecular marker, and application of the primers and the kit in breeding of a fine strain of the Harpadon microchir. The application can be used for early screening of breeding materials of the Harpadon microchir, shortening of a breeding cycle, improvement of selection accuracy and overcoming of the limitation of phenotype dependence in traditional breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology for aquatic animals, specifically relating to an SNP molecular marker related to the body weight of the angelfish and its application. Background Technology

[0002] Sharp-finned angelfish ( Platax teira The long-winged angelfish (Siniperca spp.), also known as the long-winged angelfish, is a tropical and temperate marine fish belonging to the order Perciformes, suborder Spondylodon, family Sinipercaidae, and genus Siniperca. It is mainly distributed in the Arabian Sea, Indonesia, and the Sea of ​​Japan in the Indo-Pacific region, and is also found in the South my country Sea and Taiwan. Its flesh is tender, delicious, and nutritious, making it a valuable marine fish species with significant potential for aquaculture. Currently, artificial breeding techniques for the long-winged angelfish are relatively mature; moreover, its growth rate is fast, with fry reaching approximately 500g in weight after five months of rearing. It can be fed formulated feed throughout the entire rearing process. Given its rapid growth, delicious flesh, and ability to consume formulated feed, the long-winged angelfish is a promising species suitable for deep-water, wave-resistant cage culture.

[0003] The current breeding of angelfish fry relies heavily on wild parent stock or unselected farmed populations. The lack of scientific guidance in parent stock mating leads to unstable growth performance and large individual differences. Traditional phenotypic selection breeding has a long cycle and low efficiency, making it difficult to achieve early and precise selection.

[0004] Among various molecular markers, single nucleotide polymorphisms (SNPs) have become an ideal source of genetic markers due to their wide distribution in the genome, high information content, and convenient and efficient detection. By analyzing the association between SNP sites and key economic traits, molecular markers closely linked to target traits can be screened out and applied to marker-assisted selection, which is one of the core methods of modern molecular breeding of aquatic animals. However, to date, there are no research reports on SNP markers and their applications for the weight trait of the angelfish. Therefore, screening out SNP molecular markers associated with the weight trait of the angelfish and establishing early breeding techniques are of great significance for promoting marker-assisted breeding of the angelfish, shortening the breeding cycle, and improving genetic gain. Summary of the Invention

[0005] The first objective of this invention is to provide a SNP molecular marker associated with the body weight of the angelfish.

[0006] The present invention also aims to provide primers or kits for detecting the above-mentioned SNP molecular markers, and a method for selecting superior strains of angelfish with excellent body weight.

[0007] The final objective of this invention is to provide the application of the above-mentioned SNP molecular marker primers, kits, and methods in the selection of superior body weight strains of the angelfish.

[0008] The first objective of the present invention can be achieved by the following technical solution: a SNP molecular marker related to the weight of the angelfish, located at base 4593166 on chromosome 23 of the angelfish, with a mutation type of A / G, named SNP23_4593166.

[0009] Furthermore, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the 301st base starting from the 5' end of the sequence shown in SEQ ID NO.1 is A or G.

[0010] The nucleotide sequence shown in SEQ ID NO.1 is as follows:

[0011] TTCACCTTGGTCGCAACTTCAAGACAATAAGGAAGCAAGTTTTACTGCTTATCAAAGGTTTAATGGTGTCAGTGGTCCTTATTTTTCCATCCTCTCTTTCTCTCCTCTTTAAATGAGTTGTTTGCAACAAAAACGTCCATCACTCTCTCCC TCTCTCCCTCGTGTCTTTCTTCTTGTCACAGGAACTGTAGCAAACCGAAGTCAGAAATGTTGGGAATGTTGCAGAACAGAGCAGGAGGATTCACTCTGCATTGTTAAAGGGCTGTTCCGCTCCGTCTCCTGTAAACAGTCGTCAAACC N(A / G) AGGAGAAACCCGATAGCTTCACTTAGCTGTGATCTGCTCTAACTACTGAGATCATAGACTGAGGGATGGAGGGCAAGCGGAGAGGGGTAAAGGGTTAGACTGAAAAGTACAAGTAGATGCTTTTCTTTTACCTTGAAGAGATGTTGAACA TTTTATGTTAAGATAAAATGAATGGCAGGTACATACCAGATTTGCTGCAAGGCAAGTAGCTGCCCTCTAAGTACTTCTGCACTTATCCACATCCACATTTTTCAGTACATTTCAAATTAAAAGAGTCAACTTATCCTTCATCTTTTTAAA.

[0012] Furthermore, the SNP molecular marker genotype AA is the preferred genotype, and individuals with this genotype have significantly higher body weights than individuals with genotypes AG or GG.

[0013] The second objective of the present invention can be achieved by the following technical solution: a primer for detecting the above-mentioned SNP molecular marker, the nucleotide sequence of which is shown in SEQ ID NO.2~4.

[0014] Based on the nucleotide sequence shown in SEQ ID NO.1, this invention designs specific primers SNP23_4593166RC, SNP23_4593166RT, and SNP23_4593166F for SNP molecular markers, performs specific PCR amplification, reads the fluorescence signal of the amplification product using an enzyme-linked immunosorbent assay (ELISA) reader, and then analyzes and converts the fluorescence signal to obtain the genotype of the above-mentioned SNP molecular marker sites in the target angelfish.

[0015] The primers described in this invention, as shown in SEQ ID NO.2~4, are used for specific amplification of the nucleotide sequence containing the SNP molecular marker described in this invention. The amplification product is analyzed by an enzyme-linked immunosorbent assay (ELISA) reader to obtain the genotype of the SNP molecular marker site in the target angelfish.

[0016] Specifically, the nucleotide sequence of the primer is as follows:

[0017] SNP23_4593166RC (SEQ ID NO.2):

[0018] GAAGGTGACCAAGTTCATGCTTGAAGCTATCGGGTTTCTCCTC;

[0019] SNP23_4593166RT (SEQ ID NO.3):

[0020] GAAGGTCGGAGTCAACGGATTTGAAGCTATCGGGTTTCTCCTT;

[0021] SNP23_4593166F (SEQ ID NO.4):

[0022] CCGCTCCGTCTCTCCTGTAA.

[0023] The present invention also provides a kit for detecting the above-mentioned SNP molecular markers, the kit comprising the above-mentioned primers.

[0024] Furthermore, the present invention also provides a method for breeding superior strains of angelfish in terms of body weight, comprising the following steps:

[0025] (1) Extract DNA from the fin rays of the individual angelfish to be tested;

[0026] (2) The extracted DNA was amplified by PCR using the primers shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 to obtain the PCR amplification products;

[0027] (3) Analyze the fluorescence signal of the PCR amplification product to determine the genotype of the above SNP molecular marker. The body weight of individuals with the SNP molecular marker genotype AA is significantly better than that of individuals with the genotype AG or GG.

[0028] The last objective of the present invention can be achieved by the following technical solution: the application of the above-mentioned SNP molecular marker primers or kits and the above-mentioned methods in the selection of superior body weight strains of the winged angelfish.

[0029] The present invention has the following technical effects:

[0030] (1) This invention screened the SNP molecular marker SNP23_4593166 through genome-wide association analysis, and further verified that the SNP molecular marker is associated with body weight. Based on the genotypic differences of this SNP molecular marker, it can be used as a molecular marker for breeding superior body weight strains of angelfish.

[0031] (2) The present invention can rapidly amplify target sites and determine genotypes using specific primers. The operation is simple and convenient and the results are accurate and reliable.

[0032] (3) The SNP molecular markers, primers and kits provided by the present invention have application prospects in molecular marker-assisted breeding of angelfish. They are not affected by individual age, sex and other factors, and can be used for early screening of angelfish breeding materials. They can shorten the breeding cycle, improve selection accuracy and overcome the limitations of traditional breeding that depend on phenotype. Attached Figure Description

[0033] The present invention will now be further described with reference to the accompanying drawings and embodiments.

[0034] Figure 1 This is a Manhattan plot of the genome-wide association analysis of body weight in Example 1 of the present invention. The point pointed to by the arrow is the SNP molecular marker SNP23_4593166 screened in the present invention.

[0035] Figure 2 The QQ plot of the genome-wide association analysis of body weight in Example 1 of this invention verifies the reliability of the association analysis results. Detailed Implementation

[0036] The technical solution of the present invention will be described in detail below with reference to specific embodiments, so that those skilled in the art can better understand and implement the technical solution of the present invention. The following embodiments and drawings are for illustrative purposes only and should not be construed as limiting the present invention. Unless otherwise specified, the reagents or materials used in the embodiments are all from commercial sources. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0037] Example 1: Screening of SNP molecular markers related to body weight in the angelfish

[0038] (1) The body weight of 350 nine-month-old angelfish under the same breeding environment was randomly measured, and the caudal fins of 50 fish with the largest and 50 fish with the smallest body weight were cut off. The genomic DNA of the angelfish was extracted from the caudal fins using a magnetic bead DNA extraction kit.

[0039] (2) The genomic DNA was randomly fragmented into 350bp fragments. After end repair, phosphorylation and A-tailing, adapters were ligated to both ends of the fragments to prepare a DNA library. Then, PE150 sequencing was performed using the BGI T7 sequencing platform.

[0040] (3) After quality control and processing, the raw sequencing data were aligned to the reference genome using BWA v0.7.15 software. SNP molecular markers were detected using the standard procedure of SAMtools v1.3.1 software. The obtained genotype data were filtered for quality control using PLINK v1.9 software. The filtering conditions were: detection rate >95%, minor allele frequency (MAF) <0.05, and Hardy-Weinberg equilibrium test P value <10. -6 Finally, a genome-wide association analysis of body weight traits in the angelfish was conducted using 100 individuals and 638,085 SNP molecular markers.

[0041] (4) Genome-wide association analysis of body weight in the angelfish was performed using a linear mixture model in GEMMA v0.98.5 software. The model was Y= In the formula, Y is the weight of the angelfish, and W is the variance-covariance matrix. X is the population mean, and X is an indicator variable. This is the effect of SNP labeling, where Z is based on the SNP kinship matrix. It is an additive genetic effect. These are random residuals. Principal component analysis was performed on the factors influencing the phenotype, and the first three principal components were added to the model as covariates.

[0042] (5) A genome-wide association analysis revealed a SNP molecular marker associated with the body weight of the angelfish. This SNP molecular marker is located at base 4593166 on chromosome 23 of the angelfish and is named SNP23_4593166. Figure 1 The point indicated by the arrow is the marker. That is, SNP23_4593166 is the 301 bases of the nucleotide sequence shown in SEQ ID NO.1.

[0043] The nucleotide sequence shown in SEQ ID NO.1 is as follows:

[0044] TTCACCTTGGTCGCAACTTCAAGACAATAAGGAAGCAAGTTTTACTGCTTATCAAAGGTTTAATGGTGTCAGTGGTCCTTATTTTTCCATCCTCTCTTTCTCTCCTCTTTAAATGAGTTGTTTGCAACAAAAACGTCCATCACTCTCTCCC TCTCTCCCTCGTGTCTTTCTTCTTGTCACAGGAACTGTAGCAAACCGAAGTCAGAAATGTTGGGAATGTTGCAGAACAGAGCAGGAGGATTCACTCTGCATTGTTAAAGGGCTGTTCCGCTCCGTCTCCTGTAAACAGTCGTCAAACC N(A / G) AGGAGAAACCCGATAGCTTCACTTAGCTGTGATCTGCTCTAACTACTGAGATCATAGACTGAGGGATGGAGGGCAAGCGGAGAGGGGTAAAGGGTTAGACTGAAAAGTACAAGTAGATGCTTTTCTTTTACCTTGAAGAGATGTTGAACA TTTTATGTTAAGATAAAATGAATGGCAGGTACATACCAGATTTGCTGCAAGGCAAGTAGCTGCCCTCTAAGTACTTCTGCACTTATCCACATCCACATTTTTCAGTACATTTCAAATTAAAAGAGTCAACTTATCCTTCATCTTTTTAAA.

[0045] The N at the 301st base of the above sequence is either A or G, and this mutation causes the above sequence to be polymorphic.

[0046] Example 2: Validation of body weight-related SNP molecular markers in the angelfish

[0047] (1) Validation group

[0048] Different groups of angelfish were selected, and 310 experimental fish were randomly selected from them. The weight data of each fish was measured and recorded, and the tail fin samples of each fish were collected and preserved for DNA extraction. The specific process of DNA extraction was the same as in Example 1.

[0049] (2) PCR amplification

[0050] This invention uses the genomic sequences 300 bp upstream and downstream of the above-mentioned SNP molecular marker as a template and designs primers using SNPPrimer software.

[0051] Using the extracted DNA as a template, PCR amplification was performed using SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 as primers. The total volume of the PCR amplification reaction was 10 μL.

[0052] The PCR amplification reaction system is as follows:

[0053]

[0054] The PCR amplification reaction procedure is as follows:

[0055]

[0056] (3) Genotyping

[0057] After PCR amplification, the fluorescence signal of the PCR product is read using an ELISA reader. Then, the fluorescence signal is analyzed and converted using snpdecoder software. Based on the different fluorescence colors, the genotype corresponding to each sample is analyzed and output, thereby obtaining the genotype of the SNP molecular marker described in this invention in different fish.

[0058] (4) Verification results

[0059] One-way ANOVA was performed on the body weight data of different genotypes of the SNP23_4593166 molecular marker using SPSS 26.0, and multiple comparisons between groups were performed using the Tukey method. The results are shown in Table 1.

[0060] Table 1. Effects of SNP23_4593166 polymorphism on body weight of angelfish.

[0061]

[0062] Table 1 shows that P<0.05 indicates a significant difference, and P<0.01 indicates an extremely significant difference.

[0063] Table 1 shows that among the angelfish with the SNP23_4593166 molecular marker, there were extremely significant differences in body weight among individuals with different genotypes (P<0.001). The body weight of individuals with genotype AA was significantly better than that of individuals with genotype AG (P<0.05), and extremely significantly better than that of individuals with genotype GG (P<0.01). There was no significant difference in body weight between individuals with genotypes AG and GG (P>0.05). The results indicate that when the SNP23_4593166 molecular marker genotype is AA, the body weight of the angelfish is significantly better than that of individuals with genotypes AG or GG.

[0064] The above examples demonstrate that the SNP23_4593166 molecular marker of the present invention is significantly correlated with the body weight of the angelfish, and its genotype can be determined by specific amplification primers. The operation is simple and reliable, and this SNP molecular marker has application prospects in molecular marker-assisted breeding of angelfish.

[0065] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure. Any improvements and modifications made based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection is determined by the claims.

Claims

1. A SNP molecular marker associated with the body weight of the angelfish, characterized in that, The nucleotide sequence is shown in SEQ ID NO.1, with the 301st base starting from the 5' end being either A or G.

2. A primer for detecting the SNP molecular marker of claim 1, characterized in that, The nucleotide sequences are shown in SEQ ID NO. 2~4.

3. A kit for detecting the SNP molecular marker of claim 1, characterized in that, Includes the primers described in claim 2.

4. A method for selecting superior body weight strains of the angelfish, characterized in that, Includes the following steps: (1) Extract DNA from the tail fin of the individual angelfish to be tested; (2) The extracted DNA was amplified by PCR using the primers shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 to obtain the PCR amplification products; (3) Analyze the fluorescence signal of the PCR amplification product to determine the genotype of the SNP molecular marker described in claim 1, wherein the body weight of individuals with the SNP molecular marker genotype AA is significantly better than that of individuals with the genotype AG or GG.

5. The application of the primers of claim 2, the kit of claim 3, and the method of claim 4 in the selection of superior body weight strains of the angelfish.