Artemisia argyi karyotype probe and use method

Abstract

The invention relates to a wormwood karyotype probe and a use method, 11 wormwood karyotype probes are analyzed and designed through bioinformatics software by taking a wormwood genome published on NCBI as a reference, and the probes can generate clear chromosome signals on wormwood chromosomes. The method comprises the following steps: setting 11 karyotype probes into two probe sleeves Multiplex # 1 and Multiplex # 2, preparing a probe staining solution, staining chromosome flakes at the early stage of root tip cell mitosis of Chinese mugwort and Artemisia vulgaris, and finding that rich chromosome banding patterns are generated on Chinese mugwort chromosomes. According to the invention, chromosome high-definition karyotypes of Chinese mugwort and Artemisia vulgaris are constructed for the first time, and it is proved that Maillari variotii has 17 pairs of special heterologous chromosomes. The karyotype probe disclosed by the invention can be used for analyzing karyotype construction of chromosomes of different wormwood varieties and pairing behaviors of chromosomes in a meiosis I-stage final change period, and a new method and a theoretical basis are provided for research on wormwood chromosomes.

Description

Technical Field

[0001] The invention relates to a mugwort nucleotype probe, and in particular to a mugwort nucleotype probe and a use method thereof. Background Art

[0002] Mugwort is a perennial herbaceous plant of the genus Artemisia in the Asteraceae family. It is a traditional Chinese medicinal material. It is warm in nature, bitter and pungent in taste. It enters the liver, spleen and kidney meridians and has the effects of warming the meridians and stopping bleeding, dispelling cold and relieving pain, relieving cough and asthma, stopping leakage and stabilizing pregnancy, and drying dampness and relieving itching. Studies have found that the chemical components of wormwood mainly include volatile oils, flavonoids, eucalyptone and triterpenoid compounds, etc. These components not only have insecticidal, repellent, antifeedant and population growth inhibition effects, but also have the effects of inhibiting mycelium growth and spore germination. Therefore, it can replace chemical pesticides for pest control. Mugwort wool is a natural processed product of wormwood. It is the raw material for making moxa sticks and the main material used in moxibustion. In addition, wormwood extracts can also be used as chemical dyes, food processing, animal feed, etc.

[0003] Artemisia argyi belongs to the Artemisia argyi group, with a total of 90 species and 12 variants. Cytological studies have shown that the Artemisia argyi group mainly includes two chromosome base number species, namely diploid to hexaploid species with a chromosome base number of x=8 and diploid to dodecaploid species with a chromosome base number of x=9. There has been controversy over the chromosome base number and ploidy of Artemisia argyi, and it is generally believed to be a diploid or tetraploid with a chromosome base number of 9. However, studies have found that Artemisia argyi is an allotetraploid with 34 chromosomes and a chromosome base number of 17. It contains two extra-long chromosomes No. 10. Gene colinearity analysis speculates that this extra-long chromosome is the result of the end-to-end fusion of chromosomes 8 and 9 of the ancestor of the Artemisia genus. In order to reveal the chromosome composition and evolution of Artemisia argyi and accurately classify the genome, researchers introduced banding technology and fluorescence in situ hybridization (FISH) technology into Artemisia argyi, which to a certain extent revealed the chromosome characteristics of Artemisia argyi. Despite this, there is still a lack of effective chromosome markers to accurately identify the chromosomes and genome of Artemisia argyi, making its classification unclear. For example, in the study of northern mugwort, it was found that it contains mugwort varieties with different numbers of chromosomes. Wan mugwort contains many different varieties, some of which are very different from each other, and even different plants of the same variety have very different phenotypes. Some contain five-leaf and seven-leaf types at the same time, so that plants such as ragweed that have no medicinal value are mixed in.

[0004] Oligonucleotide fluorescence in situ hybridization technology is a cytological technology that has emerged in recent years and can greatly improve the recognition ability of plant chromosomes. At present, this technology has been widely used in chromosome research such as cucumber, wheat, corn and peanut. In 2022, based on PacBio-Hifi sequencing and Hi-C technology, my country took the lead in completing the high-quality assembly of the Qi Ai chromosome-level genome. The results showed that the wormwood genome is a large genome of 8.03Gb, with highly repetitive sequences accounting for 73.59%, which provides a sequence basis for the development of wormwood repetitive sequence nuclear type probes. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides an Artemisia argyi karyotype probe and a method of use. Qi Ai, Wan Ai and Bei Ai are taken as research objects. By performing bioinformatics analysis on the Qi Ai reference genome, 11 Qi Ai karyotype probes are designed and screened, and two probe sets for constructing the Qi Ai karyotype are prepared. The first Qi Ai high-definition chromosome karyotype is established, and it is applied to the karyotype analysis of Bei Ai and the pairing analysis of the Wan Ai meiosis I terminal metamorphosis, providing a new method for the study of Artemisia argyi chromosomes.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] 1. A mugwort nuclear probe, there are eleven nuclear probes, and their sequences are:

[0008] Probe C8-21: TTATGACCCGAATAAAAATATAACCGATTTAATGAAACC;

[0009] Probe C4-13: ATTTTATATTACTTACAAGCTCGAGAACTCAACAATAACT;

[0010] Probe C10-9: GACACAATTGACAACAAAAAATGCCAAACTAATAGGTAAAA; Probe Co-516: ATGACAGTTTTTATTTGCGCTTGATAACATTTAGTATATT;

[0011] Probe C10-7: CGTGTGATCCCACGTCATCTCGACTCGTTCGTTTAACATCT;

[0012] Probe C5-2: GTCACGGAACCATGGTCGTAGGTCATCCA;

[0013] Probe Tel-1: TTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTT TAGGGTTTAGGG;

[0014] Probe C1-1: TTGTTATGGATAAGCATAACATGTTAAACGGATGAGTCGAG;

[0015] Probe C1-12: TTGATAACGGCTATTTCTATGACAGTTTTATTTGCGCTTC;

[0016] Probe C10-10: GGCCACTTTATGCTTAATTGTATGTGACTAAATACCCAAA;

[0017] Probe C5-14: CATCGACCATTTTTAATTTCAACTTGTCCTCAAACCAATA.

[0018] 2. The design method of the mugwort nuclear probe as described in 1 is based on the mugwort ASM3068699v1 version reference genome sequence Genbank: GCA_030686995.1 published on NCBI, and the TRF tool is used to mine the tandem repeat sequences in the genome. Then, CD-HIT and NCBI-BLAST+ (V2.8.1) software are used to remove redundancy of the tandem repeat sequences, and non-redundant sequences are filtered to obtain non-redundant sequences of different repeat unit lengths for clustering; non-redundant sequences with a repeat unit length of more than 10bp and a copy number greater than 50bp are screened respectively. Finally, non-redundant sequences of different lengths are clustered, and the top 20 sequences are selected from high to low according to the frequency of the repeat sequence. Oligonucleotide sequences are designed according to the sequence information using Oligo7, 5′-TAMRA or FAM fluorescently labeled oligonucleotide probes are synthesized, and probe screening is performed using fluorescence in situ hybridization to finally obtain the mugwort nuclear probe.

[0019] 3. The mugwort nuclear type probe set as described in 1, wherein the probe set includes probe set Multiplex #1 and probe set Multiplex #2, wherein probe set Multiplex #1 includes TAMRA-labeled probes C8-21, C4-13, C10-9, Co-516, C10-7, C5-2 and Tel-1; and probe set Multiplex #2 includes FAM-labeled probes C1-1, C1-12, C10-10 and C5-14.

[0020] 4. The method for using the mugwort nucleotype probe as described in 1 comprises the following steps:

[0021] (1) The 11 nuclear probes were divided into probe set Multiplex #1 and probe set Multiplex #2. The probe set Multiplex #1 included TAMRA-labeled C8-21, C4-13, C10-9, Co-516, C10-7, C5-2 and Tel-1, and the concentration of each probe was 1000 ng / μl; the probe set Multiplex #2 included FAM-labeled C1-1, C1-12, C10-10 and C5-14, and the concentration of each probe was 1000 ng / μl;

[0022] (2) Take 5 μL of each probe in probe set Multiplex #1 and probe set Multiplex #2 and 5 μL of 100 μg / mL DAPI stock solution and add them to 40 mL of 2× PBS buffer to prepare probe staining solution;

[0023] (3) The chromosome preparation of the prophase of mitosis of the root tip cells of Artemisia argyi was placed in the probe staining solution, and immersed for staining at 37° C. for 10-12 hours; rinsed with distilled water for 10-15 times, blown dry, and then dripped with a sealing agent and covered with a coverslip, observed and photographed under a fluorescence microscope, and the karyotype and pairing of Artemisia argyi were analyzed according to the chromosome banding pattern.

[0024] 5. Use of the mugwort nuclear type probe as described in 1 in analyzing the chromosome composition of mugwort.

[0025] 6. Use of the mugwort karyotype probe as described in 1 in analyzing mugwort karyotype construction and chromosome pairing.

[0026] Beneficial effects of the present invention

[0027] (1) The present invention uses bioinformatics to analyze the reference genome sequence of Qi Ai and successfully develops 11 mugwort nuclear probes. These 11 nuclear probes can all produce clear chromosome signals on mugwort chromosomes, providing a new and effective method for the development of mugwort chromosome cytological markers.

[0028] (2) The present invention uses 11 mugwort nuclear type probe sets with two probe sets, and uses the probe sets to construct high-definition karyotypes of the chromosomes of the prophase of mitosis of mugworts such as Qi mugwort and Bei mugwort, thus achieving effective identification of mugwort chromosomes. The probe sets were used to perform staining analysis on the chromosomes of the diakinesis phase I of meiosis of Wan mugwort, and it was found that chromosomes with similar banding patterns were paired, confirming that its chromosomes consisted of 17 pairs of special heterologous chromosomes, clarifying the chromosome characteristics of mugwort.

[0029] (3) The karyotype probe of the present invention can be used to analyze the chromosome karyotype construction and chromosome pairing behavior of different mugwort varieties during meiosis I diastasis, providing a new method for mugwort chromosome research. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The fluorescence in situ hybridization (FISH) signal results of the six mugwort nuclear type probes of the present invention on the chromosomes in the prophase of mitosis of the root tip of Artemisia argyi.

[0031] Figure 2 The fluorescence in situ hybridization (FISH) signal results of the five mugwort nuclear type probes of the present invention on the chromosomes in the prophase of mitosis of the root tip of Artemisia argyi.

[0032] Figure 3 The staining signal results and karyotype of the chromosomes in the prophase of mitosis of the root tip of Artemisia argyi using probe sets Multiplex #1 (red) and Multiplex #2 (green).

[0033] Figure 4 The staining signal results (a) and karyotype (b) of the prophase chromosomes of the root tip of Artemisia annua using probe sets Multiplex #1 (red) and Multiplex #2 (green).

[0034] Figure 5 The results of staining chromosome pairing at the diakinesis stage of meiosis I in pollen mother cells of Artemisia wanfangensis using probe sets Multiplex #1 (red) and Multiplex #2 (green). DETAILED DESCRIPTION

[0035] The technical solution of the present invention is further described in detail below in conjunction with specific embodiments.

[0036] Example 1. A design method for a nuclear probe of Qi Ai

[0037] The reference genome sequence Genbank of Artemisia argyi ASM3068699v1 version published on NCBI: GCA_030686995.1, the TRF tool was used to mine the tandem repeat sequences in the genome, and then CD-HIT and NCBI-BLAST+ (V2.8.1) software were used to remove redundancy of the tandem repeat sequences, filter the non-redundant sequences, and obtain non-redundant sequences of different repeat unit lengths for clustering. Non-redundant sequences with a repeat unit length of more than 10bp and a copy number of more than 50bp were screened. Finally, non-redundant sequences of different lengths were clustered, and the top 20 sequences were selected from high to low according to the frequency of the repeat sequence. Oligo 7 was used to design oligonucleotide sequences based on the sequence information, and 5′-TAMRA (red) or FAM (green) fluorescently labeled oligonucleotide probes were synthesized by Anhui Chuzhou General Biological Co., Ltd.

[0038] The probes are as follows:

[0039] Probe C8-21: TTATGACCCGAATAAAAATATAACCGATTTAATGAAACC (SEQ ID NO: 1)

[0040] Probe C4-13: ATTTTATATTACTTACAAGCTCGAGAACTCAACAATAACT (SEQ ID NO: 2)

[0041] Probe C10-9: GACACAATTGACAACAAAAATGCCAAACTAATAGGTAAAA (SE Q ID NO: 3)

[0042] Probe Co-516: ATGACAGTTTTTATTTGCGCTTGATAACATTTAGTATATT (SEQ ID NO: 4)

[0043] Probe C10-7: CGTGTGATCCCACGTCATCTCGACTCGTTCGTTTAACATCT (SEQ ID NO: 5)

[0044] Probe C5-2: GTCACGGAACCATGGTCGTAGGTCATCCA (SEQ ID NO: 6) Probe Tel-1: TTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTT TAGGGTTTAGGG (SEQ ID NO: 7)

[0045] Probe C1-1: TTGTTATGGATAAGCATAACATGTTAAACGGATGAGTCGAG (SEQ ID NO: 8)

[0046] Probe C1-12: TTGATAACGGCTATTTCTATGACAGTTTTATTTGCGCTTC (SEQ ID NO: 9)

[0047] Probe C10-10: GGCCACTTTATGCTTAATTGTATGTGACTAAATACCCAAA (SEQ ID NO: 10)

[0048] Probe C5-14: CATCGACCATTTTTAATTTCAACTTGTCCTCAAACCAATA (SEQ ID NO: 11)

[0049] Probe screening was performed using fluorescence in situ hybridization (FISH), and 11 probes that could produce clear signals on the chromosomes of Qi Ai were finally obtained (see Figure 1, Figure 2 ).

[0050] Figure 1 Af in the middle are the FISH signals of probes C5-2 (red), Tel-1 (red), C1-12 (green), C10-10 (green), C5-14 (green), and C1-1 (green), respectively. Figure 2 Ae in the middle are the FISH signals of probes C10-9 (red), Co-516 (red), C4-13 (red), C8-21 (red) and C10-7 (red), respectively. It can be seen that each probe produces a clear red or green signal on the Qi Ai chromosome.

[0051] Example 2. A method for using a Qi Ai nucleotype probe

[0052] (1) According to the distribution characteristics of the probes on chromosomes in Example 1, in order to maximize the difference in red and green signals between chromosomes, 11 nuclear type probes are set as probe set Multiplex #1 and probe set Multiplex #2.

[0053] Probe set Multiplex #1 included TAMRA-labeled C8-21, C4-13, C10-9, Co-516, C10-7, C5-2, and Tel-1, and the concentration of each probe was 1000 ng / μl;

[0054] Probe set Multiplex #2 includes FAM-labeled C1-1, C1-12, C10-10, and C5-14, and the concentration of each probe is 1000 ng / μl.

[0055] (2) Add 5 μL of each probe in probe sets Multiplex #1 and Multiplex #2 and 5 μL of 100 μg / mL DAPI stock solution to 40 mL of 2× PBS buffer to prepare a probe staining solution.

[0056] (3) Place the chromosome preparation of the mitotic prophase of the root tip cells of Qi Ai in the probe staining solution and soak for staining at 37°C for 10-12 hours; rinse with distilled water for 10-15 times, blow dry, add the sealing agent and cover with a cover glass, observe and photograph under a fluorescence microscope, and chromosomes with similar banding patterns are considered a pair. Finally, the Qi Ai karyotype of 17 pairs of chromosomes was arranged (see Figure 3 ).

[0057] Figure 3 (a) It can be seen that abundant red and green bands are produced on the chromosomes of Qi Ai; (b) The figure shows that the karyotype can be arranged into 17 pairs of chromosomes based on the banding characteristics of Qi Ai.

[0058] Example 3. A method for constructing a chromosome karyotype of Artemisia argyi in the prophase of mitosis

[0059] (1) The 11 nuclear probes of Example 1 were set as probe set Multiplex #1 and probe set Multiplex #2, where probe set Multiplex #1 included TAMRA-labeled C8-21, C4-13, C10-9, Co-516, C10-7, C5-2 and Tel-1, each with a probe concentration of 1000 ng / μl; probe set Multiplex #2 included FAM-labeled C1-1, C1-12, C10-10 and C5-14, each with a probe concentration of 1000 ng / μl.

[0060] (2) Add 5 μL of each probe in probe set Multiplex #1 and probe set Multiplex #2 and 5 μL of 100 μg / mL DAPI stock solution to 40 mL of 2×PBS buffer to prepare a probe staining solution.

[0061] (3) Place the chromosome preparation of the prophase of mitosis of the root tip cells of Artemisia argyi in the probe staining solution and soak for staining at 37°C for 10-12 hours; rinse with distilled water for 10-15 times, blow dry, add the sealing agent and cover with a cover glass, observe and photograph under a fluorescence microscope. Chromosomes with similar banding patterns are a pair, and finally 8 pairs of chromosomes of Artemisia argyi are arranged (see Figure 4 ).

[0062] Figure 4 The staining signal results (a) and karyotype (b) of the prophase chromosomes of the root tip of Artemisia annua using probe sets Multiplex #1 (red) and Multiplex #2 (green) as probes.

[0063] Figure 4 (a) shows that abundant red and green bands are produced on the chromosomes of the Artemisia selengensis; (b) shows that the karyotype can be arranged into 8 pairs of chromosomes based on the banding characteristics of the Artemisia selengensis.

[0064] Example 4. Analysis of chromosome pairing behavior during diakinesis of meiosis I phase of pollen mother cells of Artemisia wanensis

[0065] (1) The 11 nuclear probes of Example 1 were set as probe set Multiplex #1 and probe set Multiplex #2. Probe set Multiplex #1 included TAMRA-labeled C8-21, C4-13, C10-9, Co-516, C10-7, C5-2 and Tel-1, and the concentration of each probe was 1000 ng / μl; probe set Multiplex #2 included FAM-labeled C1-1, C1-12, C10-10 and C5-14, and the concentration of each probe was 1000 ng / μl.

[0066] (2) Add 5 μL of each probe in probe sets Multiplex #1 and Multiplex #2 and 5 μL of 100 μg / mL DAPI stock solution to 40 mL of 2× PBS buffer to prepare a probe staining solution.

[0067] (3) Place the chromosome preparation of Wan Ai pollen mother cells at the diakinesis stage of meiosis I in the probe staining solution and soak for staining at 37°C for 10-12 hours; rinse with distilled water for 10-15 times, blow dry, add the sealing agent, cover with a coverslip, and observe and photograph under a fluorescence microscope (see Figure 5 ).

[0068] from Figure 5 As can be seen from (a) and (b), chromosomes with similar signal bands in Wan Ai paired with each other to form 17 pairs of chromosomes, indicating that Wan Ai has 17 pairs of special heterologous chromosomes.

Claims

1. A mugwort nucleotype probe, characterized in that: There are eleven nuclear probes in total, and their sequences are: Probe C8-21: TTATGACCCGAATAAAAATATAACCGATTTAATGAAACC; Probe C4-13: ATTTTATATTACTTACAAGCTCGAGAACTCAACAATAACT; Probe C10-9: GACACAATTGACAACAAAAATGCCAAACTAATAGGTAAAA; Probe Co-516: ATGACAGTTTTTATTTGCGCTTGATAACATTTAGTATATT; Probe C10-7: CGTGTGATCCCACGTCATCTCGACTCGTTCGTTTAACATCT; Probe C5-2: GTCACGGAACCATGGTCGTAGGTCATCCA; Probe Tel-1: TTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTT TAGGGTTTAGGG; Probe C1-1: TTGTTATGGATAAGCATAACATGTTAAACGGATGAGTCGAG; Probe C1-12: TTGATAACGGCTATTTCTATGACAGTTTTATTTGCGCTTC; Probe C10-10: GGCCACTTTATGCTTAATTGTATGTGACTAAATACCCAAA; Probe C5-14: CATCGACCATTTTTAATTTCAACTTGTCCTCAAACCAATA.

2. A method for designing a mugwort nucleotype probe as claimed in claim 1, characterized in that: The reference genome sequence Genbank: GCA_030686995.1 of Artemisia argyi ASM3068699v1 published on NCBI was used, and the tandem repeat sequences in the genome were mined using the TRF tool. Then, the tandem repeat sequences were de-redundanted using CD-HIT and NCBI-BLAST+ (V2.8.1) software, and non-redundant sequences were filtered to obtain non-redundant sequences with different repeat unit lengths for clustering. Non-redundant sequences with a repeat unit length of more than 10 bp and a copy number of more than 50 bp were screened respectively. Finally, non-redundant sequences of different lengths were clustered, and the top 20 sequences were selected from high to low according to the frequency of the repeat sequence. Oligonucleotide sequences were designed according to the sequence information using Oligo7, 5′-TAMRA or FAM fluorescently labeled oligonucleotide probes were synthesized, and probes were screened using fluorescence in situ hybridization to finally obtain the Artemisia argyi nucleotype probe.

3. A mugwort nucleus type probe set as claimed in claim 1, characterized in that: The probe set includes probe set Multiplex #1 and probe set Multiplex #2. Probe set Multiplex #1 includes TAMRA-labeled probes C8-21, C4-13, C10-9, Co-516, C10-7, C5-2 and Tel-1; probe set Multiplex #2 includes FAM-labeled probes C1-1, C1-12, C10-10 and C5-14.

4. A method for using the mugwort nucleotype probe as claimed in claim 1, characterized in that: The method comprises the following steps: (1) The 11 nuclear probes were divided into probe set Multiplex #1 and probe set Multiplex #2. The probe set Multiplex #1 included TAMRA-labeled C8-21, C4-13, C10-9, Co-516, C10-7, C5-2 and Tel-1, and the concentration of each probe was 1000 ng / μl; the probe set Multiplex #2 included FAM-labeled C1-1, C1-12, C10-10 and C5-14, and the concentration of each probe was 1000 ng / μl; (2) Take 5 μL of each probe in probe set Multiplex #1 and probe set Multiplex #2 and 5 μL of 100 μg / mL DAPI stock solution and add them to 40 mL of 2× PBS buffer to prepare probe staining solution; (3) The chromosome preparation of the prophase of mitosis of the root tip cells of Artemisia argyi was placed in the probe staining solution, and immersed for staining at 37° C. for 10-12 hours; rinsed with distilled water for 10-15 times, blown dry, and then dripped with a sealing agent and covered with a coverslip, observed and photographed under a fluorescence microscope, and the karyotype and pairing of Artemisia argyi were analyzed according to the chromosome banding pattern.

5. Use of the mugwort nucleotype probe as claimed in claim 1 in analyzing the chromosome composition of mugwort.

6. Use of the mugwort karyotype probe as claimed in claim 1 in analyzing mugwort karyotype construction and chromosome pairing.

Images