Experimental method for researching influence of pulse electromagnetic field on MC3T3-E1

Abstract

The invention discloses an experimental method for researching the influence of a pulse electromagnetic field on MC3T3-E1, and relates to the technical field of biomedical engineering. Comprising the following steps: S1, culturing cells; s11, preparation of an MC3T3-E1 cell is carried out; s12, carrying out cell passage; s2, pulse electromagnetic field treatment; s21, setting a conventional culture group and a pulse electromagnetic stimulation group, taking a third generation of MC3T3-E1 cells, rinsing the MC3T3-E1 cells twice with a PBS solution free of calcium and magnesium ions, and counting the MC3T3-E1 cells after the MC3T3-E1 cells are prepared into a cell suspension; respectively inoculating into 25ml cell culture flasks and dividing into three groups: a conventional culture group, a conventional culture and pulse electromagnetic stimulation applying group and a conventional culture and pulse electromagnetic stimulation applying group. The invention provides an important theoretical basis for treating osteoporosis by clinically applying the PEMFs; the potential molecular mechanism of PEMFs is disclosed from the perspective of epigenetics methylation regulation.

Description

Technical Field

[0001] The invention relates to the technical field of biomedical engineering, and in particular to an experimental method for studying the influence of a pulse electromagnetic field on MC3T3-E1. Background Art

[0002] Pulsed electromagnetic fields are an emerging non-invasive regulatory technology that is widely used to treat skeletal diseases. Although more and more studies have shown that PEMFs can enhance bone density, its specific mechanism of action is still unclear. In recent years, with the in-depth study of epigenetics, the key regulatory role of DNA methylation in the differentiation of MSCs into osteoblasts has gradually been revealed. This provides a theoretical basis for the speculation that PEMFs may cause changes in gene expression by affecting the DNA methylation status of cells.

[0003] How to better study the effects of pulsed electromagnetic fields on the proliferation and differentiation of embryonic osteoblast precursor cells is an issue that needs to be considered. Summary of the invention

[0004] The purpose of the present invention is to solve the shortcomings of the prior art and to propose an experimental method for studying the influence of pulsed electromagnetic fields on MC3T3-E1.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] An experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1 comprises the following steps:

[0007] S1: Cell culture;

[0008] S11: Preparation of MC3T3-E1 cells;

[0009] S12: cell passaging;

[0010] S2: pulsed electromagnetic field treatment;

[0011] S21: Conventional culture group and pulse electromagnetic stimulation group were set up. The third-generation MC3T3-E1 cells were rinsed twice with PBS solution without calcium and magnesium ions, and then counted after being made into cell suspension; they were inoculated in 25 ml cell culture bottles and divided into three groups:

[0012] Conventional culture group: not treated with PEMFs;

[0013] Conventional culture and pulsed electromagnetic stimulation group: 75 Hz, 1.5 mT, 24 hours;

[0014] Conventional culture group and pulsed electromagnetic stimulation group: 75 Hz, 2mT, 24 hours;

[0015] Stimulate continuously for 8 hours daily under the same conditions and replace the cell culture medium in time to maintain growth vitality;

[0016] S22: setting parameters and performing pulse electromagnetic field treatment;

[0017] S3: Detection and analysis;

[0018] S31: cell proliferation assay;

[0019] S32: apoptosis determination;

[0020] S33: Methylation-specific PCR detection.

[0021] Preferably, in said S11, the preparation of MC3T3-E1 cells specifically comprises the following steps:

[0022] S111: Thawing frozen cells: Thaw the 1 ml cryotube quickly in a 37°C water bath to ensure that the cells recover activity in the shortest time;

[0023] S112: Mixed culture medium: immediately add the thawed cells into 6 ml of complete culture medium and mix evenly to fully resuspend the cells;

[0024] S113: Centrifugation: Centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and resuspend the cells with complete medium to ensure that the residual freezing solution is removed;

[0025] S114: Overnight incubation: Add the cell suspension to 8 ml of complete culture medium and place in a 37°C incubator overnight to allow the cells to adapt to the new environment and begin to proliferate.

[0026] Preferably, in S12, the cell passage specifically comprises the following steps:

[0027] S121: Rinse cells: discard the old culture medium in the culture flask, add 2 ml of PBS buffer to the culture flask to rinse the cells twice to maintain the stability of the cells;

[0028] S122: Digest cells: Add 1.5 ml of trypsin solution to digest the cells, place in a 37°C cell culture incubator for 2 minutes, and quickly return to the operating table after observing that the intercellular gaps become larger and the cells become round under the microscope;

[0029] S123: Stop the reaction: Add 6 ml of complete medium to stop the reaction, gently mix and then aspirate to stop the action of trypsin on the cells;

[0030] S124: Centrifugation: Centrifuge at 1000 rpm for 5 minutes, discard the supernatant, resuspend the cells in complete medium, and distribute them into new culture bottles at a ratio of 1:2 for continued culture;

[0031] S125: Replace the culture medium: Observe the cell growth status every day and replace the cell culture medium after 2 days to ensure that the cells have sufficient nutrition and growth space.

[0032] Preferably, in S1, when the cell culture is cryopreserved, the steps specifically include:

[0033] Determine the cryopreservation density: Use a hemocytometer to determine the cryopreservation density and maintain it at 1 million cells per ml ± 5%;

[0034] Centrifugation: After centrifugation at 1000 rpm for 5 minutes, discard the supernatant and collect the cell pellet;

[0035] Prepare cryopreservation solution: add appropriate amount of protein-free non-programmed cell cryopreservation solution to resuspend the cells, and keep the number of live cells in 1 ml cryopreservation solution at one million ± 5%;

[0036] Aliquot cryopreservation tubes: Aliquot the resuspended cells into cryopreservation tubes, mark the name and date, and then place them in a cryopreservation box for cryopreservation;

[0037] Low temperature storage: Finally, store in a -80℃ low temperature refrigerator.

[0038] Preferably: in said S31, the cell proliferation detection is as follows:

[0039] The MC3T3-E1 cell group that had not been treated previously and the MC3T3-E1 cell group that had been treated with PEMF were collected, and 10ul of the cell suspension was taken after resuspending the cells. The concentration was adjusted to 20,000 per milliliter using a cell counting plate. Six replicate wells were set for each group of cells, and 2,000 cells were inoculated in each well of a 96-well plate at 100ul. The absorbance values ​​were measured after 12 hours, 24 hours, 36 hours, and 48 hours, respectively, and growth curves were drawn for analysis.

[0040] Preferably, in S32, the apoptosis condition is determined as follows:

[0041] Flow cytometry was used to measure apoptosis; after resuspending the treated cells, 100ul of the cell suspension was transferred to a 5ml flow tube, FITC Annexin and PI dye solution were added and incubated in the dark for 15 minutes, then binding buffer was added to dilute the dye and maintain stability, and finally Flowjo software was used for data analysis.

[0042] Preferably: in said S33, the methylation-specific PCR detection is as follows:

[0043] The MC3T3-E1 cell model treated with optimal parameters was used for methylation-specific PCR detection to analyze the expression changes of osteogenic differentiation-related genes Runx2, BMP, BSP and TGF-β. The methylation status and mRNA expression level of the gene loci were analyzed by amplification using methylation-specific primer pairs and non-methylated primer pairs.

[0044] Preferably, in S32, apoptosis is determined by flow cytometry, which specifically includes the following steps:

[0045] S321: Preparation of cell suspension: Take the PEMF-treated MC3T3-E1 cells, wash them once with PBS solution, and then add trypsin digestion solution to digest the cells; after the digestion process is completed, add complete culture medium to terminate the reaction, gently blow the cells to make them fall off from the bottom of the culture plate, and transfer the cell suspension to an EP tube; then, centrifuge for 5 minutes to precipitate the cells; after centrifugation, discard the supernatant and retain the cell pellet;

[0046] S322: Wash and resuspend: Wash the cells twice with pre-cooled PBS, centrifuge again after each wash and discard the supernatant; resuspend the cells with PBS to make the cells evenly dispersed in the solution;

[0047] S323: Staining treatment: transfer the resuspended cell suspension to a 5 ml flow tube, add FITC Annexin and PI dye solution, gently mix the cell suspension, and incubate at 25°C in the dark for 15 minutes to allow the dye to fully bind to the cells;

[0048] S324: Flow cytometer detection: Check that the sheath fluid is full, the waste liquid bucket is emptied, add ultrapure water, the water level is between lower and upper, turn on the main power, and preheat for 30 minutes; open CytExpert to select the graph and channel, click the startup process to initialize, put 2ml of ultrapure water and EP tube into the sampler, and wait for 10 minutes after starting; mix the sample and run it on the machine, adjust the gain to select the target cell population; use Flowjo software to analyze and adjust the raw data;

[0049] S325: Data analysis: Flowjo software was used to analyze the apoptosis of cells in different groups, and apoptosis rate bar graphs or pie charts were drawn for comparison; SPSS software was used for data statistical analysis.

[0050] Preferably, in S33, the MC3T3-E1 cell model treated with optimal parameters is used to perform methylation-specific PCR detection, which specifically includes the following steps:

[0051] DNA extraction: Take an appropriate amount of cell sample and use the standard phenol-chloroform extraction method to extract genomic DNA; dissolve the extracted DNA in TE buffer for later use;

[0052] Methylation primer design: Design specific methylation primer pairs and non-methylation primer pairs based on target genes Runx2, BMP, BSP and TGF-β; methylation primer pairs can amplify methylated gene fragments, while non-methylation primer pairs can only amplify non-methylated gene fragments;

[0053] PCR amplification: Prepare the following reaction system: 2×Taq Master Mix 25.0ul, 10μM gene primer 2.5ul+2.5ul, methylation recovery product 2ul, ddH2O 18ul; mix well and perform PCR amplification; reaction conditions: 98℃ for 10 minutes, then 64℃ for 2.5 hours, and finally at 4℃ for up to 20 hours;

[0054] Electrophoresis analysis;

[0055] Result analysis: The differential bands of the amplification products of the methylated primer pair and the non-methylated primer pair were detected by electrophoresis to determine the methylation status of the target gene site; the changes in the mRNA expression levels of each group of genes were calculated using the relative quantitative method.

[0056] Preferably, the electrophoresis analysis is specifically as follows: adding 500ul of Trizol to the cell sample for lysis, adding chloroform to mix evenly and standing for 5 minutes, centrifuging for 10 minutes and then aspirating the upper layer of liquid into a new EP tube; adding an equal volume of isopropanol to mix and standing for 10 minutes, centrifuging for 10 minutes and then collecting the precipitate and washing it with 75% ethanol; dissolving it in DEPC water and measuring the concentration with a spectrophotometer; determining the expression levels of Runx2, BMP, BSP, and TGF-β genes after reversing into cDNA; and using glyceraldehyde phosphate dehydrogenase as the reaction internal reference for correction.

[0057] The beneficial effects of the present invention are:

[0058] 1. The present invention provides an important theoretical basis for the clinical application of PEMFs in the treatment of osteoporosis; it reveals the potential molecular mechanism of PEMFs from the perspective of epigenetic methylation regulation.

[0059] 2. The present invention uses methylation-specific PCR detection to find that the expression of osteogenic differentiation-related factors such as Runx2 and BMP in MC3T3-E1 cells after PEMFs treatment is not significantly different, while BSP expression is relatively low, TGF-β is not methylated and its expression is relatively increased; this indicates that PEMFs may promote the proliferation and differentiation of MC3T3-E1 cells by regulating the methylation level of TGF-β; this provides a new perspective for understanding the molecular mechanism of PEMFs. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 This is a comparison chart of the relative expression levels of Runx2, BMP, BSP, and TGF-β genes in an experimental method proposed by the present invention for studying the effect of pulsed electromagnetic fields on MC3T3-E1. DETAILED DESCRIPTION

[0061] The technical solution of the present invention is further described in detail below in conjunction with specific implementation methods.

[0062] Embodiment 1:

[0063] An experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1 comprises the following steps:

[0064] S1: Cell culture;

[0065] S11: Preparation of MC3T3-E1 cells;

[0066] S12: cell passaging;

[0067] S13: Cryopreservation of cells;

[0068] S2: pulsed electromagnetic field treatment;

[0069] S21: Conventional culture group and pulse electromagnetic stimulation group were set up. The third-generation MC3T3-E1 cells were rinsed twice with PBS solution without calcium and magnesium ions, and then counted after being made into cell suspension; they were inoculated in 25ml cell culture bottles and divided into three groups: conventional culture group (not treated with PEMFs); conventional culture group with pulse electromagnetic stimulation (75 Hz, 1.5mT, 24 hours); conventional culture group with pulse electromagnetic stimulation (75 Hz, 2mT, 24 hours); under the same conditions, the cells were stimulated continuously for 8 hours every day and the cell culture medium was replaced in time to maintain growth vitality;

[0070] S22: setting parameters and performing pulsed electromagnetic fields (PEMFs) treatment;

[0071] S3: Detection and analysis;

[0072] S31: cell proliferation assay;

[0073] S32: apoptosis determination;

[0074] S33: Methylation-specific PCR detection.

[0075] Wherein, in said S11, the preparation of MC3T3-E1 cells specifically comprises the following steps:

[0076] S111: Thawing frozen cells: Thaw the 1 ml cryotube quickly in a 37°C water bath to ensure that the cells recover activity in the shortest time;

[0077] S112: Mixed culture medium: immediately add the thawed cells into 6 ml of complete culture medium and mix evenly to fully resuspend the cells;

[0078] S113: Centrifugation: Centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and resuspend the cells with complete medium to ensure that the residual freezing solution is removed;

[0079] S114: Overnight incubation: Add the cell suspension to 8 ml of complete culture medium and place in a 37°C incubator overnight to allow the cells to adapt to the new environment and begin to proliferate.

[0080] Wherein, in said S12, the cell passage specifically comprises the following steps:

[0081] S121: Rinse cells: discard the old culture medium in the culture flask, add 2 ml of PBS buffer to the culture flask to rinse the cells twice to maintain the stability of the cells;

[0082] S122: Digest cells: Add 1.5 ml of trypsin solution to digest the cells, place in a 37°C cell culture incubator for 2 minutes, and quickly return to the operating table after observing that the intercellular gaps become larger and the cells become round under the microscope;

[0083] S123: Stop the reaction: Add 6 ml of complete medium to stop the reaction, gently mix and then aspirate to stop the action of trypsin on the cells;

[0084] S124: Centrifugation: Centrifuge at 1000 rpm for 5 minutes, discard the supernatant, resuspend the cells in complete medium, and distribute them into new culture bottles at a ratio of 1:2 for continued culture;

[0085] S125: Replace the culture medium: Observe the cell growth status every day and replace the cell culture medium after 2 days to ensure that the cells have sufficient nutrition and growth space.

[0086] Wherein, in said S1, when the cell culture is cryopreserved, the steps specifically include:

[0087] Determine the cryopreservation density: Use a hemocytometer to determine the cryopreservation density and maintain it at 1 million cells per ml (± 5%).

[0088] Centrifugation: After centrifugation at 1000 rpm for 5 minutes, discard the supernatant and collect the cell pellet;

[0089] Prepare cryopreservation solution: add appropriate amount of protein-free non-programmed cell cryopreservation solution to resuspend the cells, and keep the number of live cells in 1 ml of cryopreservation solution at one million (±5%);

[0090] Aliquot cryopreservation tubes: Aliquot the resuspended cells into cryopreservation tubes, mark the name and date, and then place them in a cryopreservation box for cryopreservation;

[0091] Cryogenic storage: Finally, store the cells in a -80℃ low-temperature refrigerator to ensure long-term stable storage of the cells.

[0092] Among them, in S22, pulsed electromagnetic fields (PEMFs) treatment is performed, specifically as follows: using the HB320 double-ring ordinary pulse magnetic field therapy device produced by Suzhou Haobo Medical Equipment Co., Ltd., setting the intensity to 1.5mT and 2mT, the frequency to 75 Hz for treatment, and continuous stimulation for 8 hours per day.

[0093] Wherein, in said S31, the cell proliferation detection is specifically as follows:

[0094] The untreated MC3T3-E1 cell group and the PEMF-treated MC3T3-E1 cell group were collected, and 10ul of the cell suspension was taken after resuspending the cells. The concentration was adjusted to 20,000 per milliliter using a cell counting plate; 6 replicate wells were set for each group of cells, and 2000 cells were inoculated in 100ul per well of a 96-well plate; the absorbance values ​​(OD values) were measured after 12 hours, 24 hours, 36 hours, and 48 hours, respectively, and the growth curve was drawn for analysis.

[0095] Among them, in said S32, the apoptosis situation is determined as follows:

[0096] Flow cytometry (FCM) was used to measure apoptosis; after resuspending the treated cells, 100ul of the cell suspension was transferred to a 5ml flow tube, FITC Annexin and PI dye solution were added and incubated in the dark for 15 minutes, then binding buffer was added to dilute the dye and maintain stability, and finally Flowjo software was used for data analysis.

[0097] Among them, in said S33, the methylation-specific PCR detection is as follows:

[0098] The MC3T3-E1 cell model treated with optimal parameters was used for methylation-specific PCR detection to analyze the expression changes of osteogenic differentiation-related genes such as Runx2, BMP, BSP and TGF-β. The methylation status and mRNA expression level of the gene loci were analyzed by amplification using methylation-specific primer pairs and non-methylated primer pairs.

[0099] Wherein, in said S32, apoptosis is determined by flow cytometry (FCM), which specifically includes the following steps:

[0100] S321: Preparation of cell suspension: Take the PEMF-treated MC3T3-E1 cells, wash them once with PBS solution, and then add trypsin digestion solution to digest the cells; after the digestion process is completed, add complete culture medium to terminate the reaction, gently blow the cells to make them fall off from the bottom of the culture plate, and transfer the cell suspension to an EP tube; then, centrifuge for 5 minutes to precipitate the cells; after centrifugation, discard the supernatant and retain the cell pellet;

[0101] S322: Wash and resuspend: Wash the cells twice with pre-cooled PBS, centrifuge again after each wash and discard the supernatant; resuspend the cells with PBS to make the cells evenly dispersed in the solution;

[0102] S323: Staining treatment: transfer the resuspended cell suspension to a 5 ml flow tube, add FITC Annexin and PI dye solution, gently mix the cell suspension, and incubate at 25°C in the dark for 15 minutes to allow the dye to fully bind to the cells;

[0103] S324: Flow cytometer detection: Check that the sheath fluid is full, the waste liquid bucket is emptied, add ultrapure water, the water level is between lower and upper, turn on the main power, and preheat for 30 minutes; open CytExpert to select the graph and channel, click the startup process to initialize, put 2ml of ultrapure water and EP tube into the sampler, and wait for 10 minutes after starting; mix the sample and run it on the machine, adjust the gain to select the target cell population; use Flowjo software to analyze and adjust the raw data;

[0104] S325: Data analysis: Flowjo software was used to analyze the apoptosis of cells in different groups, and apoptosis rate bar graphs or pie charts were drawn for comparison; SPSS software was used for data statistical analysis to determine the significance of differences between groups.

[0105] Wherein, in said S33, methylation-specific PCR detection is performed using the MC3T3-E1 cell model treated with optimal parameters, which specifically includes the following steps:

[0106] DNA extraction: Take an appropriate amount of cell sample and use the standard phenol-chloroform extraction method to extract genomic DNA; dissolve the extracted DNA in TE buffer for later use;

[0107] Methylation primer design: Design specific methylation primer pairs and non-methylation primer pairs based on target genes such as Runx2, BMP, BSP and TGF-β; methylation primer pairs can amplify methylated gene fragments, while non-methylation primer pairs can only amplify non-methylated gene fragments;

[0108] PCR amplification: Prepare the following reaction system: 2×Taq Master Mix (Dye Plus) 25.0ul, 10μM gene primer (F+R) 2.5ul+2.5ul, methylation recovery product 2ul, ddH2O 18ul; mix well and perform PCR amplification; reaction conditions: 98°C for 10 minutes, then 64°C for 2.5 hours, and finally at 4°C for up to 20 hours;

[0109] Electrophoresis analysis: add 500ul Trizol to the cell sample for lysis, add chloroform to mix evenly and let stand for 5 minutes, centrifuge for 10 minutes and then draw the upper liquid into a new EP tube; add an equal volume of isopropanol to mix and let stand for 10 minutes, centrifuge for 10 minutes and then collect the precipitate and wash with 75% ethanol; dissolve in DEPC water and measure the concentration with a spectrophotometer; reverse into cDNA and measure the expression of Runx2, BMP, BSP, TGF-β genes, such as Figure 1 As shown; glyceraldehyde phosphate dehydrogenase (GAPDH) was used as the internal reference for the reaction.

[0110] Result analysis: The differential bands of the amplification products of the methylated primer pair and the non-methylated primer pair were detected by electrophoresis to determine the methylation status of the target gene site; the changes in the mRNA expression levels of each group of genes were calculated using the relative quantitative method, and statistical analysis was performed to determine the significance of the differences.

[0111] The following are the primer sequences of the genes:

[0112]

[0113] ① Runx2 primer sequence

[0114] Primer sequences:

[0115] MSP-mu-Runx2-F: TTAATATGTAAATTTAGAGTGGCGT MSP-mu-Runx2-R: CCTATTTTCATTAATTAAAAACGAT

[0116] Amplification length: 119

[0117] Tm: 55

[0118] U-mu-Runx2-F: TTAATATGTAAATTTAGAGTGGTGT

[0119] U-mu-Runx2-R: CCTATTTTCATTAATTAAAAACAAT

[0120] Amplification length: 119

[0121] Tm: 55

[0122] ②BMP primer sequence

[0123] Primer sequences:

[0124] MSP-mu-BMP-F: TTTTTTTGTGGGGTTGTTAATTC

[0125] MSP-mu-BMP-R:AAACCAAAATAAATAACGTTACGTT Amplification length: 184

[0126] Tm: 55

[0127] U-mu-BMP-F:TTTTTTTTGTGGGTTGTTAATTTG

[0128] U-mu-BMP-R:AAAAAACCAAAATAAATAACATTACATT Amplification length: 187

[0129] Tm: 55

[0130] ③BSP primer sequence

[0131] Primer sequences:

[0132] MSP-mu-BSP-F: TTTATGTATTGTTTTATTTCGTTTCG MSP-mu-BSP-R: TATTCAATCTACTTAATCGTCCGAC Amplification length: 121

[0133] Tm: 55

[0134] U-mu-BSP-F:TATTTTTTATGTATTGTTTTATTTTGTTTTU-mu-BSP-R:TATTCAATCTACTTAATCATCCAAC

[0135] Amplification length: 126

[0136] Tm: 55

[0137] ④TGF-β primer sequence

[0138] Primer sequences:

[0139] MSP-mu-TGF-β-F: GGTGGTGGGTTATAGTTGTTGTAC

[0140] MSP-mu-TGF-β-R: TAACAATCTCCAAAATCCACGTA

[0141] Amplification length: 231

[0142] Tm: 55

[0143] U-mu-TGF-β-F: GGTGGTGGGTTATAGTTGTTGTAT

[0144] U-mu-TGF-β-R:AACTAACAATCTCCAAAATCCACATA

[0145] Amplification length: 234

[0146] Tm: 55

[0147] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. An experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1, characterized in that: The steps include: S1: Cell culture; S11: Preparation of MC3T3-E1 cells; S12: cell passaging; S2: pulsed electromagnetic field treatment; S21: Conventional culture group and pulse electromagnetic stimulation group were set up. The third-generation MC3T3-E1 cells were rinsed twice with PBS solution without calcium and magnesium ions, and then counted after being made into cell suspension; they were inoculated in 25 ml cell culture bottles and divided into three groups: Conventional culture group: not treated with PEMFs; Conventional culture and pulsed electromagnetic stimulation group: 75 Hz, 1.5 mT, 24 hours; Conventional culture group and pulsed electromagnetic stimulation group: 75 Hz, 2mT, 24 hours; Stimulate continuously for 8 hours daily under the same conditions and replace the cell culture medium in time to maintain growth vitality; S22: setting parameters and performing pulse electromagnetic field treatment; S3: Detection and analysis; S31: cell proliferation assay; S32: apoptosis determination; S33: Methylation-specific PCR detection.

2. An experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1 according to claim 1, characterized in that: In S11, the preparation of MC3T3-E1 cells specifically includes the following steps: S111: Thawing frozen cells: Thaw the 1 ml cryotube quickly in a 37°C water bath to ensure that the cells recover activity in the shortest time; S112: Mixed culture medium: immediately add the thawed cells into 6 ml of complete culture medium and mix evenly to fully resuspend the cells; S113: Centrifugation: Centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and resuspend the cells with complete medium to ensure that the residual freezing solution is removed; S114: Overnight incubation: Add the cell suspension to 8 ml of complete culture medium and culture in a 37°C incubator overnight to allow the cells to adapt to the new environment and begin to proliferate.

3. The experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1 according to claim 2, characterized in that: In S12, the cell passage specifically includes the following steps: S121: Rinse cells: discard the old culture medium in the culture flask, add 2 ml of PBS buffer to the culture flask to rinse the cells twice to maintain the stability of the cells; S122: Digest cells: Add 1.5 ml of trypsin solution to digest the cells, place in a 37°C cell culture incubator for 2 minutes, and quickly return to the operating table after observing that the intercellular gaps become larger and the cells become round under the microscope; S123: Stop the reaction: Add 6 ml of complete medium to stop the reaction, gently mix and then aspirate to stop the action of trypsin on the cells; S124: Centrifugation: Centrifuge at 1000 rpm for 5 minutes, discard the supernatant, resuspend the cells in complete medium, and distribute them into new culture bottles at a ratio of 1:2 for continued culture; S125: Replace the culture medium: Observe the cell growth status every day and replace the cell culture medium after 2 days to ensure that the cells have sufficient nutrition and growth space.

4. The experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1 according to claim 1, characterized in that: In S1, when the cell culture is cryopreserved, the steps specifically include: Determine the cryopreservation density: Use a hemocytometer to determine the cryopreservation density and maintain it at 1 million cells per ml ± 5%; Centrifugation: After centrifugation at 1000 rpm for 5 minutes, discard the supernatant and collect the cell pellet; Prepare cryopreservation solution: add appropriate amount of protein-free non-programmed cell cryopreservation solution to resuspend the cells, and keep the number of live cells in 1 ml cryopreservation solution at one million ± 5%; Aliquot cryopreservation tubes: Aliquot the resuspended cells into cryopreservation tubes, mark the name and date, and then place them in a cryopreservation box for cryopreservation; Low temperature storage: Finally, store in a -80℃ low temperature refrigerator.

5. The experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1 according to claim 1, characterized in that: In S31, the cell proliferation detection is as follows: The MC3T3-E1 cell group that had not been treated previously and the MC3T3-E1 cell group that had been treated with PEMF were collected, and 10ul of the cell suspension was taken after resuspending the cells. The concentration was adjusted to 20,000 per milliliter using a cell counting plate. Six replicate wells were set for each group of cells, and 2,000 cells were inoculated in each well of a 96-well plate at 100ul. The absorbance values ​​were measured after 12 hours, 24 hours, 36 hours, and 48 hours, respectively, and growth curves were drawn for analysis.

6. The experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1 according to claim 5, characterized in that: In the S32, apoptosis was determined as follows: Flow cytometry was used to measure apoptosis; after resuspending the treated cells, 100ul of the cell suspension was transferred to a 5ml flow tube, FITC Annexin and PI dye solution were added and incubated in the dark for 15 minutes, then binding buffer was added to dilute the dye and maintain stability, and finally Flowjo software was used for data analysis.

7. The experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1 according to claim 6, characterized in that: In S33, the methylation-specific PCR test is performed as follows: The MC3T3-E1 cell model treated with optimal parameters was used for methylation-specific PCR detection to analyze the expression changes of osteogenic differentiation-related genes Runx2, BMP, BSP and TGF-β. The methylation status and mRNA expression level of the gene loci were analyzed by amplification using methylation-specific primer pairs and non-methylated primer pairs.

8. The experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1 according to claim 6, characterized in that: In the S32, apoptosis is determined by flow cytometry, which specifically includes the following steps: S321: Preparation of cell suspension: Take the PEMF-treated MC3T3-E1 cells, wash them once with PBS solution, and then add trypsin digestion solution to digest the cells; after the digestion process is completed, add complete culture medium to terminate the reaction, gently blow the cells to make them fall off from the bottom of the culture plate, and transfer the cell suspension to an EP tube; then, centrifuge for 5 minutes to precipitate the cells; After centrifugation, the supernatant was discarded and the cell pellet was retained; S322: Wash and resuspend: Wash the cells twice with pre-cooled PBS, centrifuge again after each wash and discard the supernatant; resuspend the cells with PBS to make the cells evenly dispersed in the solution; S323: Staining treatment: transfer the resuspended cell suspension to a 5 ml flow tube, add FITC Annexin and PI dye solution, gently mix the cell suspension, and incubate at 25°C in the dark for 15 minutes to allow the dye to fully bind to the cells; S324: Flow cytometer detection: Check that the sheath fluid is full, the waste liquid bucket is emptied, add ultrapure water, the water level is between lower and upper, turn on the main power, and preheat for 30 minutes; open CytExpert to select the graph and channel, click the startup process to initialize, put 2ml of ultrapure water and EP tube into the sampler, and wait for 10 minutes after starting; mix the sample and run it on the machine, adjust the gain to select the target cell population; use Flowjo software to analyze and adjust the raw data; S325: Data analysis: Flowjo software was used to analyze the apoptosis of cells in different groups, and apoptosis rate bar graphs or pie charts were drawn for comparison; SPSS software was used for data statistical analysis.

9. The experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1 according to claim 7, characterized in that: In S33, the MC3T3-E1 cell model treated with optimal parameters is used to perform methylation-specific PCR detection, which specifically includes the following steps: DNA extraction: Take an appropriate amount of cell sample and use the standard phenol-chloroform extraction method to extract genomic DNA; dissolve the extracted DNA in TE buffer for later use; Methylation primer design: Design specific methylation primer pairs and non-methylation primer pairs based on target genes Runx2, BMP, BSP and TGF-β; methylation primer pairs can amplify methylated gene fragments, while non-methylation primer pairs can only amplify non-methylated gene fragments; PCR amplification: Prepare the following reaction system: 2×Taq Master Mix 25.0ul, 10μM gene primer 2.5ul+2.5ul, methylation recovery product 2ul, ddH2O 18ul; mix well and perform PCR amplification; reaction conditions: 98℃ for 10 minutes, then 64℃ for 2.5 hours, and finally at 4℃ for up to 20 hours; Electrophoresis analysis; Result analysis: The differential bands of the amplification products of the methylated primer pair and the non-methylated primer pair were detected by electrophoresis to determine the methylation status of the target gene site; the changes in the mRNA expression levels of each group of genes were calculated using the relative quantitative method.

10. An experimental method for studying the effect of pulsed electromagnetic field on MC3T3-E1 according to claim 9, characterized in that: The electrophoresis analysis is specifically as follows: adding 500ul of Trizol to the cell sample for lysis, adding chloroform to mix evenly and standing for 5 minutes, centrifuging for 10 minutes and then aspirating the upper liquid into a new EP tube; adding an equal volume of isopropanol to mix and standing for 10 minutes, centrifuging for 10 minutes and then collecting the precipitate and washing it with 75% ethanol; dissolving it in DEPC water and measuring the concentration with a spectrophotometer; determining the expression levels of Runx2, BMP, BSP, and TGF-β genes after reversing into cDNA; and using glyceraldehyde phosphate dehydrogenase as a reaction internal reference for correction.

Images