Platelet LncRNA STARD4-AS1 and ELOA-AS1 quantitative detection method for non-small cell lung cancer diagnosis

Abstract

The invention provides a detection method for combining results of fluorescent quantitative PCR (polymerase chain reaction) of LncRNA (long non-coding ribonucleic acid) STARD4-AS1 and ELOA-AS1 of blood platelets for NSCLC (non-single-cell LC) diagnosis. The method sequentially comprises the following steps: 1) separating platelets and extracting RNA (Ribonucleic Acid); (2) synthesizing cDNA (complementary deoxyribonucleic acid); (3) screening of the LncRNA; (4) detecting the LncRNA through real-time fluorescent quantitative PCR (Polymerase Chain Reaction); 5) analyzing related results; and 6) establishing a Logistic regression fitting data model. The method is relatively high in sensitivity and specificity; the invention further provides a non-small cell lung cancer diagnostic kit which is high in cost performance and easy to popularize and apply.

Description

Technical Field

[0001] The invention belongs to the field of tumor molecular biology, and specifically relates to the use of a reagent for detecting the expression amount of platelet long non-coding RNA STARD4-AS1 and ELOA-AS1 in the preparation of a diagnostic reagent for non-small cell lung cancer. Technical Background

[0002] Lung cancer is one of the most common malignant tumors in the world, and its morbidity and mortality rate rank first among all tumors. Among them, 80% of lung cancer is non-small cell lung cancer (NSCLC). NSCLC is mainly divided into squamous cell lung carcinoma (LUAD) and lung adenocarcinoma (SCC). Although NSCLC has made great progress in diagnosis, treatment and basic research in recent decades, the prognosis of NSCLC has not been significantly improved overall, and its 5-year survival rate is only 5%-20%. Therefore, for the treatment of lung cancer, the most important thing is still to find effective early diagnostic markers to provide a theoretical basis for combating the invasion and metastasis of cancer cells. LncRNA, as a genetic molecule involved in cancer biology, has emerged in scientific research in recent years. The transcript length of LncRNA is greater than 200nt, and generally does not encode proteins or has limited protein encoding ability. They usually regulate the expression level of target genes at multiple levels (epigenetic regulation, transcriptional regulation, and post-transcriptional regulation) in the form of RNA, and play an important role in the occurrence of non-small cell lung cancer. LncRNA MALAT-1, LncRNA CCAT2 is highly expressed in lung cancer, inducing cell migration and stimulating tumor growth and invasion in vivo; LncRNAMEG3 is expressed lower in NSCLC cancer tissues than in normal tissues and is associated with pathological stage and tumor size. In addition, patients with lower levels of MEG3 expression have relatively poor prognosis. Overexpression of MEG3 reduces NSCLC cell proliferation, induces cell apoptosis in vitro, and hinders tumorigenesis in vivo; LncRNAH19 mainly promotes the growth of lung cancer. Interference with H19 gene expression can reduce the colony formation ability and independent adhesion ability of lung cancer cells. With more and more research, LncRNA has important significance for the treatment and diagnosis of non-small cell lung cancer.

[0003] Secondly, the diagnosis of lung cancer mainly relies on traditional clinical signs of tumor tissue, radiological imaging, biochemical testing and pathological examination, and most of these methods are invasive, causing pain to patients, and have limitations such as tissue heterogeneity; in order to reduce the limitations of tumor tissue obtained, blood-based liquid biopsy methods have become a popular trend in recent years for tissue sample analysis, which currently mainly includes the detection of plasma free DNA, tumor platelets, exosomes and circulating tumor cells. Platelets are the second most abundant cell type in peripheral blood. They are circulating anuclear fragments derived from megakaryocytes in the bone marrow. Although they are anuclear cell fragments, platelets contain rich RNA, and platelets can absorb some tumor markers released by tumors. However, in the existing technology, there is no corresponding mature technology to use tumor-tamed platelets to make a more accurate diagnosis of tumors. Summary of the invention

[0004] In order to solve the deficiencies in the above-mentioned prior art, the present invention provides a detection method for combining the results of platelet LncRNA STARD4-AS1 and ELOA-AS1 fluorescence quantitative PCR for NSCLC diagnosis, which has high sensitivity and specificity; further, it can provide a non-small cell lung cancer diagnostic kit with high cost performance and easy to promote and apply.

[0005] The technical solution of the present invention to achieve the above-mentioned purpose is as follows:

[0006] In a first aspect, the present invention provides the use of a reagent for detecting the expression of platelet long non-coding RNA STARD4-AS1 and ELOA-AS1 in the preparation of a diagnostic reagent for non-small cell lung cancer, characterized in that the reagent for detecting the expression of long non-coding RNA STARD4-AS1 and ELOA-AS1 is a real-time fluorescence quantitative PCR detection reagent; the real-time fluorescence quantitative PCR detection reagent comprises detection primers specifically used for real-time fluorescence quantitative PCR designed and synthesized according to the nucleotide sequences of long non-coding RNA STARD4-AS1 and ELOA-AS1, and the specific primers are shown in SEQ ID NO.3-8 in the sequence table;

[0007] The method for detecting platelet long-chain non-coding RNA includes extraction of sample RNA, preparation of sample cDNA, and amplification of long-chain non-coding RNA, and the specific steps include:

[0008] 1) Extraction of platelet RNA: Extract platelet RNA according to the instructions of BioTeKe's blood total RNA rapid extraction kit;

[0009] 2) Preparation of cDNA: TaKaRa kit PrimeScript TMFast RT reagent Kit with gDNA Eraser reverse transcribes the extracted platelet RNA into cDNA;

[0010] 3) Amplification of long non-coding RNA: Using Takara SYBR green TB Green Premix EX Taq TM Fast qPCR: Fluorescence quantitative PCR amplification was performed using reverse transcribed cDNA as a template according to the operating steps specified in the kit instructions;

[0011] Real-time fluorescence quantitative PCR amplification was performed to obtain the expression fold change of the target RNA expression in the sample to be tested relative to the internal reference gene GAPDH. -ΔCt , Y = -13.579*(STARD4-AS1)-8.366*(ELOA-AS1)+2.603, where (STARD4-AS1) and (ELOA-AS1) are the expression levels of STARD4-AS1 and ELOA-AS1 in platelets. -ΔCt , where ΔCt = Ct value of target gene - Ct value of internal reference gene GAPDH, Ct value is the Ct value of each gene detected by real-time fluorescence quantitative technology; when the Y value is less than 0.1214, it is judged as positive for non-small cell lung cancer, otherwise it is negative.

[0012] In a second aspect, the present invention provides a real-time quantitative PCR detection kit for the diagnosis of non-small cell lung cancer, comprising detection primers specifically designed and synthesized for real-time quantitative PCR based on the nucleotide sequences of long non-coding RNA STARD4-AS1 and ELOA-AS1, and the specific primers are shown in SEQ ID NO.3-8 in the sequence listing.

[0013] The detection preparation of the present invention can be used to detect the expression levels of long non-coding RNA STARD4-AS1 and ELOA-AS1 in platelets. Combined with the quantitative expression results of platelet STARD4-AS1 and ELOA-AS1, a Logistic regression fitting data model for the diagnosis of non-small cell lung cancer is established. The model has high diagnostic efficacy and sensitivity for non-small cell lung cancer and has far-reaching clinical significance and applicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Workflow diagram of the present invention.

[0015] Figure 2 The expression levels of platelet STARD4-AS1 and ELOA-AS1 in the present invention

[0016] LUAD-lung adenocarcinoma; SCC-lung squamous cell carcinoma; Normal-healthy control group; Relative expression was expressed as 2 -ΔCt express

[0017] A: Expression of the target gene STARD4-AS1 in platelets of non-small cell lung cancer

[0018] B: Expression of target gene ELOA-AS1 in platelets of non-small cell lung cancer

[0019] Figure 3 Diagnosis ROC curve of platelet target genes STARD4-AS1 and ELOA-AS1 in the present invention

[0020] A: ROC curve of STARD4-AS1 in platelets in lung adenocarcinoma and lung squamous cell carcinoma

[0021] B: ROC curve of ELOA-AS1 in platelets in lung adenocarcinoma and lung squamous cell carcinoma

[0022] C: ROC curve of STARD4-AS1 and ELOA-AS1 in platelets for combined diagnosis of lung adenocarcinoma and lung squamous cell carcinoma

[0023] Figure 4 Analysis diagram of the relationship between platelet and plasma target genes and clinical pathological parameters in the present invention

[0024] A: Analysis of the relationship between NSCLC platelet STARD4-AS1 and TNM (tumor stage)

[0025] B: Analysis of the relationship between platelet ELOA-AS1 and TNM (tumor stage) in NSCLC

[0026] C: Analysis of the relationship between platelet ELOA-AS1 and M (distant metastasis) in NSCLC DETAILED DESCRIPTION

[0027] The features and advantages of the present invention can be further understood through the following detailed description in conjunction with the accompanying drawings. The embodiments provided are only illustrative of the method of the present invention and do not limit the rest of the content disclosed by the present invention in any way.

[0028] Platelets from 140 NSCLC patients (81 adenocarcinomas and 59 squamous cell carcinomas) and 45 healthy controls were used to detect STARD4-AS1 and ELOA-AS1 and establish the model. The workflow is shown in Figure 1 As shown, the specific detection method includes the following steps:

[0029] 1. Collection and storage of platelets and plasma

[0030] The venous blood of the subjects was collected in a 2 mL anticoagulant tube and centrifuged to separate platelets within 12 hours at room temperature. First, centrifuge at 120g for 20 minutes at room temperature to separate into two layers. The upper platelet-rich plasma was transferred to a new EP tube (note that part of the plasma should be retained when absorbing, not all of it). Then, centrifuge at 360g for 20 minutes. The precipitate was platelets. After washing twice with PBS, 300ul DEPC water was added to extract RNA.

[0031] 2. Platelet RNA extraction (blood total RNA rapid extraction kit, BioTeKe)

[0032] 1) Add 900ul of lysis buffer RLS to the platelet suspension and lyse by pipetting

[0033] 2) Centrifuge at 12000 rpm for 10 min at 4°C and transfer the supernatant into a new enzyme-free EP tube.

[0034] 3) Add 180ul chloroform, cover the EP tube tightly, shake for 15s and incubate at room temperature for 10min

[0035] 4) Centrifuge at 12000 rpm for 10 min at 4°C and take 550 ul of the upper aqueous phase.

[0036] 5) Add an equal volume of 70% ethanol, invert and mix, and transfer to the adsorption column RA

[0037] 6) Centrifuge at 1000 rpm for 3 min and discard the waste liquid

[0038] 7) Add 500ul of protein removal solution RE, centrifuge at 12000rpm for 3min, and discard the waste liquid

[0039] 8) Add 700ul of RE rinse solution, centrifuge at 12000rpm for 3min, and discard the waste liquid

[0040] 9) Add 500ul of RE rinse solution for a second rinse, centrifuge at 12000rpm for 3min, and discard the waste liquid

[0041] 10) Centrifuge at 12000rpm for 4min and discard the remaining liquid

[0042] 11) Place the adsorption column RA into a new enzyme-free EP tube, add 30ul of RNase free water in a 56°C water bath, and centrifuge at 12000rpm for 3min to collect platelet RNA

[0043] 12) RNA concentration and purity were measured and stored at -80℃

[0044] 3. cDNA synthesis (PrimeScript TMFastRTreagentKitwith gDNAEraser, Takara)

[0045] 1) Removal of genomic DNA:

[0046]

[0047] Mix well, centrifuge and place in PCR instrument at 42℃ for 2min, 4℃∞

[0048] 2) Reverse transcription:

[0049] Step 1 reaction solution 16ul

[0050] 5x RT Primer Mix 4ul

[0051] Total volume 20ul

[0052] Mix well, centrifuge and place in PCR instrument at 37℃ for 10min, 85℃ for 5s, 4℃ for ∞

[0053] 4. Screening of lncRNA: High-throughput sequencing was performed using one lung adenocarcinoma case and one healthy control group, and STARD4-AS1 and ELOA-AS1 with significant expression differences were screened based on p<0.001 and log 2 (fold change)>14.8.

[0054] 5. Real-time fluorescence quantitative PCR:

[0055] TB Green Premix EX Taq using Takara SYBR green TM Fast qPCR, according to the steps specified in the kit instructions: 20ul system, 10ul SYBR mix + 1.6ul primer + 2ul cDNA + 6.4ul ddH2O, reaction program: 95℃ pre-denaturation for 3min, 95℃ for 20sec, 60℃ for 30sec, 72℃ for 30sec 40-cycles. Then according to 2 -ΔCt The expression levels of the two target genes and the internal reference in platelets and plasma were calculated by the method. Table 1 below shows the primers used.

[0056] in:

[0057] SEQ ID NO.3-4 correspond to the upstream primer and downstream primer of STARD4-AS1 in the following table respectively;

[0058] SEQ ID NO.5-6 correspond to the upstream primer and downstream primer of ELOA-AS1 in the following table respectively;

[0059] SEQ ID NO.7-8 correspond to the upstream primer and downstream primer of GAPDH in the following table respectively;

[0060] Table 1 Primer sequences

[0061] Gene name Gene sequence Upstream primer Downstream primer STARD4-AS1 NR_040093.1 GCACAAGAAACTCAGGCCAA GCGGCGGATCAGTAGTCAC ELOA-AS1 NR_038280.1 TCAGCATTCTCCTCGACAAGTG GTTTCCCATCCAACCAGACGA GAPDH NM_002046.7 GGAGTCCACTGGCGTCTTCA GTCATGAGTCCTTCCACGATACC

[0062] 6. Results Analysis

[0063] 1) STARD4-AS1, ELOA-AS1 expression:

[0064] Adoption 2 -ΔCt For the quantitative data analysis of the two target genes, ΔCt = Ct value of the target gene - Ct of the internal reference gene. The Ct value of the target gene is the Ct value of the target gene STARD4-AS1 and ELOA-AS1 detected by real-time fluorescence quantitative technology, as shown in the attached Figure 2 :LUAD-lung adenocarcinoma; SCC-lung squamous cell carcinoma; Normal-healthy control group; Relative expression was expressed as 2 -ΔCt Indicates that non-parametric tests were used for comparison among multiple groups, *P<0.05, **P<0.01***p<0.001, ****p<0.0001; According to the results, the expression of STARD4-AS1 and ELOA-AS1 in lung adenocarcinoma and lung squamous cell carcinoma was significantly increased compared with the healthy control group; but there was no difference in the expression of STARD4-AS1 and ELOA-AS1 between lung adenocarcinoma and lung squamous cell carcinoma.

[0065] 2) ROC diagnostic performance analysis:

[0066] ROC analysis of the diagnostic value of the target genes STARD4-AS1 and ELOA-AS1 in platelets in non-small cell lung cancer was performed. The results are shown in the attached figure. Figure 3 and Table 2; from the attached Figure 3 As shown in Table 2, platelet STARD4-AS1 has better diagnostic efficacy than ELOA-AS1, but when the two LncRNAs are used for combined diagnosis, the diagnostic efficacy is significantly higher than that of a single LncRNA, indicating that platelet STARD4-AS1 and ELOA-AS1 can better diagnose NSCLC.

[0067] Table 2 Diagnostic sensitivity and specificity

[0068]

[0069] 3) Analysis of the relationship between LncRNA and clinical pathological parameters:

[0070] The relationship between STARD4-AS1, ELOA-AS1 and pathological type, gender, age, TNM stage, T (primary tumor), N (regional lymph node involvement), and M (distant metastasis) was analyzed using nonparametric tests. Figure 4 The analysis results with differential expression are shown, *P<0.05, **P<0.01, ***p<0.001, ****p<0.0001; Figure 4 Relative expression uses 2 -ΔCt TNM represents the staging of non-small cell lung cancer, N represents the involvement of regional lymph nodes, and M represents distant metastasis. The results showed that STARD4-AS1 was only positively correlated with the TNM staging of non-small cell lung cancer, and the higher the stage, the higher the expression of STARD4-AS1. ELOA-AS1 was positively correlated not only with the stage of non-small cell lung cancer, but also with M, that is, the higher the expression of ELOA-AS1 was, the more distant metastasis occurred.

[0071] 7.Logistic regression fitting data model establishment:

[0072] Y = -13.579*(STARD4-AS1)-8.366*(ELOA-AS1)+2.603, where (STARD4-AS1) and (ELOA-AS1) are the expression levels of STARD4-AS1 and ELOA-AS1 in platelets. -ΔCt When the Y value is less than 0.1214, it is judged as positive (NSCLC patient), otherwise it is negative (non-NSCLC patient).

Claims

1. Use of a reagent for detecting the expression of platelet long non-coding RNA STARD4-AS1 and ELOA-AS1 in the preparation of a diagnostic reagent for non-small cell lung cancer, characterized in that: The nucleotide sequence of the long non-coding RNA STARD4-AS1 is SEQ ID NO.1, and the nucleotide sequence of the long non-coding RNA ELOA-AS1 is SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The reagent for detecting the expression amount of long non-coding RNA STARD4-AS1 and ELOA-AS1 is a real-time fluorescence quantitative PCR detection reagent.

3. The use according to claim 2, characterized in that: The real-time fluorescence quantitative PCR detection reagent includes detection primers specifically used for real-time fluorescence quantitative PCR designed and synthesized according to the long-chain non-coding RNA with nucleotide sequences of SEQ ID NO.1 and SEQ ID NO.2, and the specific primers are shown in SEQ ID NO.3-8 in the sequence table.

4. The use according to claim 3, characterized in that: The detection method of platelet long non-coding RNA includes extraction of sample RNA, preparation of sample cDNA, and amplification of long non-coding RNA. The specific steps include: 1) Extraction of platelet RNA: Use RNA rapid extraction reagent to extract platelet RNA; 2) Preparation of cDNA: Reverse transcription of the extracted platelet RNA was performed using a reverse transcription reagent to synthesize cDNA; 3) Amplification of long non-coding RNA: Use a fluorescent quantitative PCR kit to perform fluorescent quantitative PCR amplification with reverse transcribed cDNA as a template.

5. The use according to claim 4, characterized in that: Real-time fluorescence quantitative PCR amplification was performed to obtain the expression fold change of the target RNA expression in the sample to be tested relative to the internal reference gene GAPDH. -ΔCt , substituting into the formula Y = -13.579*(STARD4-AS1)-8.366*(ELOA-AS1)+2.603, where (STARD4-AS1) and (ELOA-AS1) are the expression levels of STARD4-AS1 and ELOA-AS1 in platelets. -ΔCt , where ΔCt = Ct value of target gene - Ct value of internal reference gene GAPDH, Ct value is the Ct value of each gene detected by real-time fluorescence quantitative technology; when the Y value is less than 0.1214, it is judged as positive for non-small cell lung cancer, otherwise it is negative.

6. A real-time quantitative PCR detection kit for the diagnosis of non-small cell lung cancer, characterized in that: The method comprises designing and synthesizing detection primers specific for real-time quantitative PCR according to the long non-coding RNA with nucleotide sequences of SEQ ID NO.1 and SEQ ID NO.2, and the specific primers are shown as SEQ ID NO.3-8 in the sequence table.

Images