A preparation method of a light-activated CRISPR macromolecular nano-carrier for specific gene therapy

By developing photoactivated CRISPR polymer nanocarriers using semiconductor polymers, and utilizing near-infrared light response to achieve specific delivery and activity regulation of CRISPR, the problems of poor target selectivity and off-target effects in the delivery process of CRISPR/Cas systems have been solved, enabling precise gene therapy at cancer sites.

CN119842052BActive Publication Date: 2026-04-21DONGHUA UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411575906.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-06
Publication Date
2026-04-21
Estimated Expiration
2044-11-06

AI Technical Summary

Technical Problem

Existing CRISPR/Cas systems suffer from poor target selectivity during delivery, resulting in low efficacy and severe side effects, making it difficult to achieve specific enrichment at lesion sites and avoid off-target effects.

Method used

Using semiconductor polymers as optical materials, a photoactivated CRISPR polymer nanocarrier was developed. Through near-infrared light response, specific delivery and activity regulation of CRISPR were achieved. By utilizing the high molar absorptivity and photostability of SPs, combined with endogenous biochemical signals and exogenous physical signals, precise treatment of cancer sites was realized.

Benefits of technology

It achieves specific enrichment and efficient gene editing of CRISPR at cancer sites, reduces off-target risks, has good water solubility and biocompatibility, and shows significant anti-tumor effects in in vitro and in vivo animal experiments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842052B_ABST
    Figure CN119842052B_ABST
Patent Text Reader

Abstract

The application discloses a preparation method of a photo-activated CRISPR high-molecular nano carrier for specific gene therapy, and comprises the following steps: a preparation method of a CRISPR high-molecular nano carrier, a preparation of a stable polymer-DNA carrier, a preparation of a polymer-DNA-sgRNA, performance verification of an organic high-molecular nano carrier, performance and curative effect verification of the organic high-molecular nano carrier at a cell level, and performance and curative effect verification of the organic high-molecular nano carrier at an animal level. The nano carrier is prepared under mild conditions, is safe and reliable, can realize precise regulation and control of CRISPR / Cas9 delivery and activity by using an NIR light response type nano carrier, realizes release of sgRNA, and has a good anti-tumor effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of organic semiconductor nanomaterials technology, and particularly relates to a method for preparing a photoactivated CRISPR polymer nanocarrier for specific gene therapy. Background Technology

[0002] Genome editing based on clustered regularly spaced short palindromic repeats / CRISPR-related proteins (CRISPR / Cas) systems has proven promising for treating cancer and genetic diseases. By disrupting or correcting genes associated with cell growth, survival, and drug resistance, the need for frequent injections can be avoided, and the chance of relapse can be prevented, offering significant advantages for cancer treatment. However, the poor target delivery and selectivity of CRISPR / Cas systems, leading to low efficacy and a range of side effects, have made their use as in vivo therapeutics for cancer challenging. Various non-viral delivery methods for the CRISPR / Cas mechanism have been developed, such as lipid formulations, polymers, and inorganic nanoparticles, and non-viral CRISPR / Cas delivery systems have become an alternative to viral delivery methods. Efficient and precise delivery of CRISPR into the cell nucleus is a fundamental prerequisite for effectively leveraging its gene-editing capabilities and achieving clinical applications. However, most current delivery systems lead to off-target effects, causing serious toxic side effects. Developing responsive non-viral vectors is an effective strategy to address the key clinical translational problem of "how to achieve specific enrichment of CRISPR at the lesion site while avoiding off-target effects." By selectively releasing CRISPR, responsive vectors can increase the relative concentration of CRISPR at lesion sites and activate its activity only when gene editing is needed, potentially avoiding the off-target risks of CRISPR. Currently, both endogenous biochemical signals and exogenous physical signals in living organisms have been used to develop responsive gene vectors. However, because endogenous biochemical signals exist in both normal tissues and lesion sites, the selectivity and specificity of biochemical signal-responsive vectors remain low. In contrast, exogenous physical signals can achieve better selectivity and specificity. Among these, optical signals, which combine economy, safety, and precision, especially near-infrared light with stronger tissue penetration, are the best control signals for responsive non-viral vectors. However, NIR light-responsive non-viral vectors for CRISPR delivery and activity regulation are still rarely reported. The selection of optical materials is crucial for the development of light-responsive non-viral vectors. Summary of the Invention

[0003] Semiconducting polymers (SPs) are a novel class of biomedical materials. They possess a purely organic structure and are bioinert, avoiding the toxicity risks associated with heavy metal ions and exhibiting good biocompatibility. They have been widely used in disease diagnosis and treatment. Through the design of their chemical structures, SPs can possess various optical properties. Furthermore, compared to small molecule dyes, SPs have higher molar absorptivity and photostability. Therefore, SPs can serve as excellent optical materials for developing NIR-responsive carriers. In view of this, this invention aims to develop a photoactivated CRISPR polymer nanocarrier based on semiconductor polymers for specific gene therapy, specifically for CRISPR activity regulation and precision cancer gene therapy.

[0004] The present invention provides a method for preparing a photoactivated CRISPR polymeric nanocarrier for specific gene therapy, comprising:

[0005] Step S1: Weigh 50 mg of monomer 1, 45 mg of monomer 2, 4 mg of bis(triphenylphosphine)palladium dichloride, and 4 mg of tris(o-methylphenyl)phosphine and dissolve them in 5 mL of anhydrous chlorobenzene. Stir vigorously at 100 °C for 10 min. After completion, filter the mixture and purify it by Soxhlet extraction with methanol to obtain SPBr.

[0006] Step S2: Weigh 12 mg SPBr and 3 mg sodium azide and dissolve them in a mixed solution of 6 mL tetrahydrofuran and 3 mL N,N-dimethylformamide. Stir at room temperature for 24 h. Dissolve the crude product in dichloromethane, wash it three times with brine, and then collect it in a flask. Dry it under vacuum to obtain polymer SPN3.

[0007] Step S3: Weigh 8 mg SPN3 and 40 mg DNBS-PEG and dissolve them in 4 mL of tetrahydrofuran. Fill the mixture with argon gas through three vacuum-argon gas cycles. Stir the mixture for 12 h at room temperature in the dark under argon gas. After removing THF under reduced pressure, dissolve the crude product in water, dialyze it, and then freeze-dry it to obtain the final product SP. NH ;

[0008] Step S4: Take 1 mg SP NH 4OD single-stranded DNA was dissolved in 2 mL of ultrapure water, and the pH was adjusted to 6 with 10 mmol hydrochloric acid solution. After stirring at room temperature for 24 h, the mixture was washed by ultrafiltration to obtain the control nanosystem, denoted as SP. ND ;

[0009] Step S5: Add 4OD of guide RNA to the solution obtained in step S4, heat in a water bath at 95℃ for 2 minutes, then cool down, and finally cool to 25℃. After cycling 5 times, ultrafiltration and washing are performed to obtain the photoactivated CRISPR polymeric nanocarrier for specific gene therapy, denoted as SP. NDR(G) .

[0010] This invention further confirms the application of the aforementioned photoactivated CRISPR polymeric nanocarriers for specific gene therapy in anti-tumor applications. The invention is simple and easy to perform, and the prepared organic polymeric nanomaterials exhibit good water solubility, colloidal stability, and biocompatibility. In vitro and in vivo animal experiments show that these organic polymeric nanomaterials have excellent anti-tumor effects. The organic polymeric nanomaterials prepared by this method have potential applications in the field of precision anti-tumor therapy.

[0011] The preparation method of the present invention has the following advantages compared with the prior art:

[0012] The photoactivated CRISPR polymeric nanocarriers prepared in this invention for specific gene therapy exhibit good water solubility and biocompatibility. In vitro and in vivo animal experiments show that this system possesses excellent gene therapy performance and can effectively induce gene damage within cancer cells. The photoactivated CRISPR polymeric nanocarriers prepared by this method have potential applications in the precise activation of anticancer agents and the treatment of cancer. Attached Figure Description

[0013] Figure 1 Here are schematic diagrams of the monomer structure; where a is the schematic diagram of monomer 1 and b is the schematic diagram of monomer 2.

[0014] Figure 2 SP for the preparation of this invention NH SP ND and SP NDR Transmission electron microscope images (Figure a) and particle size distribution map (Figure b);

[0015] Figure 3 SP prepared for this invention NH SP ND and SP NDR The ultraviolet spectrum;

[0016] Figure 4 SP prepared for this invention NH SP ND and SP NDR The fluorescence emission spectrum;

[0017] Figure 5 SP prepared for this inventionNH SP ND and SP NDR Infrared spectrum;

[0018] Figure 6 SP prepared for this invention NH SP ND and SP NDR The photothermal heating curve;

[0019] Figure 7 SP prepared for this invention NDR Release efficiency of sgRNA under different light exposure times;

[0020] Figure 8 The present invention relates to A549 cells tested by the CCK-8 assay, which were then subjected to PBS buffer (control) and SP prepared according to the present invention. NH and SP ND Cell viability after 6 hours of treatment;

[0021] Figure 9 This invention uses flow cytometry to analyze A549 cells after passing through PBS buffer (control) and SP prepared according to this invention. ND and SP NDR Fluorescence intensity after 6 hours of treatment.

[0022] Figure 10 A549 cells carrying green fluorescent protein (GFP) captured by an inverted fluorescence microscope were processed with PBS buffer (control) and SP prepared according to this invention. ND and SP NDRG Fluorescence signal after processing and illumination.

[0023] Figure 11 The present invention relates to A549 cells tested by the CCK-8 assay, which were then subjected to PBS buffer (control) and SP prepared according to the present invention. NH and SP NDR Cell viability after 6 hours of treatment followed by light exposure;

[0024] Figure 12 SP prepared for this invention ND and SP NDRG After injecting the tumor into a mouse subcutaneous tumor in situ, the mice were irradiated with an 808nm laser for 5 minutes, and the fluorescence signals were recorded at 0, 1, 2, and 4 days later.

[0025] Figure 13 SP prepared for this invention ND and SP NDR After injecting the tumor into the subcutaneous tumor of mice in situ, the tumors were treated with an 808nm laser emitter for 10 minutes, and the changes in tumor volume were recorded over 30 days. Detailed Implementation

[0026] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0027] A method for preparing a photoactivated CRISPR polymeric nanocarrier for specific gene therapy includes the following steps:

[0028] Step S1: Weigh 50 mg of monomer 1, 45 mg of monomer 2, 4 mg of palladium dichloride bis(triphenylphosphine) chloride (PdCl2(PPh3)2), and 4 mg of tri-o-tolylphosphine, dissolve them in 5 mL of anhydrous chlorobenzene, stir vigorously at 100 °C for 10 min, filter the mixture after completion, and purify it by Soxhlet extraction with methanol to obtain SPBr.

[0029] Step S2: Weigh 12 mg SPBr and 3 mg sodium azide (NaN3) and dissolve them in a mixed solution of 6 mL tetrahydrofuran (THF) and 3 mL N,N-dimethylformamide (DMF). Stir at room temperature for 24 h. Dissolve the crude product in dichloromethane, wash three times with brine, collect in a flask, and dry under vacuum to obtain polymer SPN3.

[0030] Step S3: Weigh 8 mg SPN3 and 40 mg DNBS-PEG and dissolve them in 4 mL of tetrahydrofuran (THF). Fill the mixture with argon gas through three vacuum-argon gas cycles. Stir the mixture for 12 h at room temperature in the dark under argon atmosphere. After removing THF under reduced pressure, dissolve the crude product in water, dialyze it, and then freeze-dry it to obtain the final product SPN3. NH .

[0031] Step S4: Take 1 mg SP NH 4OD single-stranded DNA (ssDNA) was dissolved in 2 mL of ultrapure water, and the pH was adjusted to 6 with 10 mmol hydrochloric acid solution. After stirring at room temperature for 24 h, the mixture was washed by ultrafiltration to obtain the control nanosystem, denoted as SP. ND .

[0032] Step S5: Add 4OD of guide RNA (sgRNA) to the solution obtained in step S4, heat in a water bath at 95℃ for 2 min, then cool down, and finally cool to 25℃. After cycling 5 times, ultrafiltration and washing are performed to obtain a photoactivated CRISPR polymeric nanocarrier for specific gene therapy, denoted as SP. NDR(G) .

[0033] Preferably, the molar ratio of monomer 1 to monomer 2 in step S1 of the present invention is 0.075 mmol:0.072 mmol.

[0034] Preferably, the mass ratio of SPBr to NaN3 in step S2 of the present invention is 12:3.

[0035] Preferably, the mass ratio of SPN3 to DNBS-PEG in step S3 of the present invention is 1:5.

[0036] Preferably, in step S4 of the present invention, SP NDR The sequence of the ssDNA complementary to the guide RNA is: AGCACAATTTGCCGTAGGTA and SP. NDRG The sequence of the guide RNA complementary ssDNA is CCGGTGTTCAAGTCGCACAG, and the optimal pH of the reaction system is 6.

[0037] Preferably, in step S4 of the present invention, SP NDR The crRNA sequence of the sgRNA is: TACCTACGGCAAATTGTGCT, SP NDRG The crRNA sequence of the sgRNA is GGCCACAAGTTCAGCGTGTC.

[0038] Preferably, the ultrafiltration washing conditions in steps S4 and S5 of the present invention are 30 kDaltons and a rotation speed of 800-1200 r / min.

[0039] The technical solution of the present invention will be described in detail below with reference to embodiments:

[0040] Example 1

[0041] 50 mg of monomer 1, 45 mg of monomer 2, 4 mg of (PdCl2(PPh3)2), and 4 mg of Tri-o-tolylphosphine were dissolved in 5 mL of anhydrous chlorobenzene. The structures of monomer 1 and monomer 2 are as follows: Figure 1As shown. The mixture was vigorously stirred at 100℃ for 10 min, then filtered and purified by Soxhlet extraction with methanol to obtain SPBr. 12 mg SPBr and 3 mg NaN3 were weighed and dissolved in a mixed solution of 6 mL THF and 3 mL LDM, and stirred at room temperature for 24 h. The crude product was dissolved in dichloromethane, washed three times with brine, collected in a flask, and dried under vacuum to obtain polymer SPN3. 8 mg SPN3 and 40 mg DNBS-PEG were weighed and dissolved in 4 mL tetrahydrofuran (THF), and the mixture was stirred for 12 h at room temperature in a dark argon atmosphere using a three-stage vacuum-argon cycle. After removing THF under reduced pressure, the crude product was dissolved in water, dialyzed, and then lyophilized to obtain SPBr. NH Take 1mg SP NH 4OD ssDNA was dissolved in 2 mL of ultrapure water, and the pH was adjusted to 6 with 10 mmol hydrochloric acid solution. After stirring at room temperature for 24 h, the mixture was washed by ultrafiltration to obtain the control nanosystem SP. ND Add 4 OD of sgRNA, heat in a water bath at 95°C for 2 minutes, then cool down to 25°C. Repeat this cycle 5 times, followed by ultrafiltration and washing to obtain SP. NDR(G) .

[0042] Example 2

[0043] Dynamic light scattering (DLS) and transmission electron microscopy (TEM) were used to detect the SP prepared in this invention. NH SP ND and SP NDR Hydrated particle size and morphology ( Figure 2 SP is prepared using ultrapure water. NH 3000 μL of a 10 μg / mL solution was used. 5 μL of the nanoparticle suspension was dropped onto the surface of a copper mesh and allowed to air dry. The mesh was then imaged using a JEM-2100 transmission electron microscope. The TEM images show the SP nanoparticles prepared according to this invention. NH SP ND and SP NDR It presents as uniformly dispersed spherical nanoparticles. Particle size was measured using a Malvern particle size analyzer, and as shown by the DLS test results, the SP prepared in this invention... NH SP ND and SP NDR The hydration particle sizes are 26.4 nm, 20.2 nm, and 50.3 nm, respectively.

[0044] Example 3

[0045] The SP prepared in this invention was determined using a UV-Vis absorption spectrometer. NH SP ND and SP NDR The ultraviolet-visible absorption spectrum, such as Figure 3 SP is prepared using ultrapure water. NH 3000 μL of a 10 μg / mL solution was used to measure the UV absorption of different materials within the wavelength range of 200-900 nm using a UV spectrophotometer. The results showed that the SP prepared in this invention... ND and SP NDR There is significant absorption at 260 nm. Since the UV absorption of RNA and DNA is base-dependent, and at the same concentration, SP... ND The absorbance here is lower than that at SP. NDR The maximum absorbance peak at this point is 260 nm. The difference in absorbance at 260 nm indicates the effective loading of ssDNA and sgRNA.

[0046] Example 4

[0047] By comparing the SP prepared in this invention NH SP ND and SP NDR The fluorescence absorption spectrum of the SP prepared in this invention was observed. NH SP ND and SP NDR A similar absorption peak was observed at 850 nm, indicating that the loading of ssDNA and sgRNA had no significant effect on fluorescence absorption.

[0048] Example 5

[0049] SP prepared by this invention NH SP ND and SP NDR Nanoparticles are formulated into SP using ultrapure water. NH 1000 μL of a 100 μg / mL solution was frozen at -80°C for 24 hours, then dried using a freeze dryer, and detected using Fourier transform infrared spectroscopy (FTIR) with the potassium bromide assay method. Figure 5 As shown, SP ND and SP NDR At 950cm -1 And 1650cm -1 A new absorption peak appears at 950 cm⁻¹. -1 The spectral peak at 1652 cm⁻¹ is attributed to the OPO antisymmetric stretching vibration of the ribose-phosphate backbone. -1 This is attributed to the stretching vibration of the C=O double bond in DNA bases. The hydrogen bonds between the two bases are intermolecular and occur at 3200 cm⁻¹. -1 The absorption peak at the point proves the generation of hydrogen bonds. Hybrid double strands require hydrogen bonds, which have low bond energy but can simultaneously form an interaction force sufficient to maintain their structural stability.

[0050] Example 6

[0051] SP prepared by this invention NH SP ND and SP NDR Nanoparticles are formulated into SP using ultrapure water. NH A 50 μL solution of 800 μg / mL was placed in a 1.5 mL conical centrifuge tube and irradiated with an 808 nm laser emitter. SP was observed to... NH SP ND and SP NDR All three types of nanoparticles can be heated to 79°C in a short time to release sgRNA, which also demonstrates the effect of nucleic acid loading on SP. NH The heating performance is not affected.

[0052] Example 7

[0053] SP prepared by this invention NH SP ND and SP NDR Nanoparticles are formulated into SP using ultrapure water. NH 50 μL of an 800 μg / mL solution was added to a 1.5 mL conical centrifuge tube. After irradiation with an 808 nm laser emitter, the solution was diluted to 3000 μL with ultrapure water. Following complete ultrafiltration, the supernatant was collected and its volume calculated. The fluorescence intensity of the supernatant was measured using a fluorescence spectrometer to calculate the amount of sgRNA-Cy3 released. Figure 7 As shown, after 120 seconds of light exposure, the release of sgRNA can reach 42%.

[0054] Example 8

[0055] The SP prepared in this invention was evaluated using A549 cells as a model cell. ND and SP NDR The effects of two types of nanoparticles on cell proliferation. Different concentrations of SP were prepared using sterile PBS. ND and SP NDR Nanoparticle solution, sterilized by overnight UV irradiation. Prepare SP. ND and SP NDR Nanoparticles (SP) ND and SP NDRCells were cultured in 96-well plates with concentrations of 100, 200, 300, 400, 500, 600, 700, and 800 μg / mL, with five replicates per group. A control group was also included. Cells were incubated at 37°C in a 5% CO2 incubator for 6 hours. A culture medium containing 10% CCK-8 was added to each well, and the plates were incubated at 37°C in a 5% CO2 incubator for another 1.5-2 hours. The plates were then removed from the incubator, and the OD value of each well at 450 nm was measured using a microplate reader. The effect of different concentrations of the medium on cell proliferation was compared with that of PBS buffer as a control, and cell viability was calculated based on these values. Figure 8 (As shown). The final results showed that the cell viability was all above 80%, which fully demonstrates that the synthesized SP... ND and SP NDR It has good biocompatibility and can be used for in vivo therapy.

[0056] Example 9

[0057] Flow cytometry was used to evaluate the effect of A549 cells on SP ND and SP NDR Intake. For example, Figure 9 As shown, A549 cells and SP prepared in this invention ND and SP NDR Cells were co-cultured at 800 μg / mL for 6 h, collected, washed with PBS, and the mean fluorescence intensity of the cells was measured by flow cytometry to assess the susceptibility of A549 cells to SP. ND and SP NDR The intake of SP. As can be seen from the graph, compared to no SP... ND and SP NDR For A549 cells co-incubated with SP cells, ND and SP NDR Co-incubated A549 cells exhibited a stronger fluorescence signal. This indicates that the SP cells prepared in this invention... ND and SP NDR It can be effectively taken up by A549 cells.

[0058] Example 10

[0059] Fluorescence microscopy was used to observe the fluorescence signals in cells to assess the effectiveness of nanoparticles in gene knockout within cells. For example... Figure 10 As shown, A549 cells carrying GFP (green fluorescent protein) were used as model cells to evaluate the SP (SP) prepared in this invention. ND and SP NDRG Gene knockout efficiency of two types of nanoparticles (800 μg / mL) in vitro. A549 cells and SP prepared in this invention. ND and SP NDRG(50 μL) and 1640 RPMI medium containing Cas9 active protein (50 μg / 100 mL) were co-cultured for 6 h, and an 808 nm laser emitter (1 W / cm²) was used. 2 Irradiate for 30 seconds, then irradiate again for 30 seconds after a 30-second interval. Repeat this cycle 5 times. After culturing in a cell incubator for 2 hours, discard the nanoparticles and then culture for another 72 hours. Finally, observe and measure the fluorescence signal of the cells using an inverted fluorescence microscope.

[0060] Example 11

[0061] Using the CCK-8 method to evaluate SP ND and SP NDR The therapeutic effect on A549 cells. For example... Figure 11 As shown, A549 cells and SP prepared in this invention ND and SP NDR (50 μL, 800 μg / mL) and co-cultured in 1640 RPMI medium containing Cas9 active protein (50 μg / 100 mL) for 6 h, using an 808 nm laser emitter (1 W / cm²). 2 Irradiation was performed for 30 seconds, followed by a 30-second interval, and then another 30-second irradiation. This cycle was repeated 5 times. After 2 hours of incubation, the nanoparticles were discarded, and the cells were incubated for 72 hours. The viability of A549 cells was evaluated using the CCK-8 assay. The figure shows that, compared to other treatment groups, the light-treated SP cells... NDR Cell viability was significantly low (only 22.7% of A549 cells survived). These experimental results demonstrate that the SP cells prepared in this invention... NDR Laser irradiation can effectively induce the death of A549 cells.

[0062] Example 12

[0063] In vivo fluorescence imaging was used to assess the effective gene knockout of nanoparticles in mice. For example... Figure 12 75 μL of cells with a cell count of 8 × 10⁸ were added. 6 A suspension of A549 cells carrying GFP was injected into subcutaneous tissue to construct a subcutaneous lung cancer tumor model. One week later, the tumor-bearing mice were randomly divided into 3 groups, and PBS and SP were injected into the tumor in situ. ND and SP NDRG (30 μL, 1000 μg / mL, Cas9 active protein (10 μg / mL)), 1 h later, using an 808 nm laser emitter (1 W / cm²). 2After irradiation for 120 seconds, repeated 5 times, in vivo near-infrared fluorescence imaging of mice was performed using an IVIS imaging system with excitation and emission wavelengths of 488 nm and 510 nm, respectively. This was recorded as day 0, and the acquired images were analyzed using Living Image software. Data was collected every 24 hours to observe changes in fluorescence intensity at the tumor site. Figure 12 It can be seen that SP NDRG After in situ injection into mouse tumors, the fluorescence intensity in the tumor area gradually decreased four days later. This result indicates that after sgRNA (GFP) is released into the cell, it can correctly enter the cell nucleus under the guidance of Cas9 protein to perform gene editing, thereby disrupting the GFP gene carried by the genome and preventing its correct expression. This also proves that the nanocarrier has good gene editing efficiency in vivo after being correctly loaded with guide RNA.

[0064] Example 13

[0065] Tumor volume in tumor-bearing mice was monitored to assess the treatment efficacy in different experimental groups. Figure 13 ) 75 μL of cells with a cell count of 8 × 10⁸ 6 A549 cell suspension was injected into subcutaneous tissue to construct a subcutaneous lung cancer tumor model. PBS and SP were then injected intratumorally. ND and SP NDR (30 μL, 1000 μg / mL, Cas9 active protein (10 μg / mL)), 1 h later, using an 808 nm laser emitter (1 W / cm²). 2 Irradiation was performed for 120 seconds, repeated 5 times, with tumor volume recorded every other day. Thirty days after treatment, all mice were euthanized, and the tumors were removed and photographed. The images show that the SP treated with light... NDR The tumor volume in the phototherapy group was significantly lower than that in other treatment groups, and the SP group under phototherapy had significantly smaller tumor volumes. NDR It can effectively kill A549 cancer cells.

[0066] A method for preparing a photoactivated CRISPR polymeric nanocarrier for specific gene therapy includes: preparation of the CRISPR polymeric nanocarrier, preparation of a stable polymer-DNA carrier, preparation of a polymer-DNA-sgRNA, performance verification of the organic polymeric nanocarrier, performance and efficacy verification of the organic polymeric nanocarrier at the cellular level, and performance and efficacy verification of the organic polymeric nanocarrier at the animal level. The nanocarrier is prepared under mild and safe conditions, and can achieve precise regulation of CRISPR / Cas9 delivery and activity using NIR photoresponsive nanocarriers, thereby releasing sgRNA and exhibiting good anti-tumor effects.

Claims

1. A method for preparing a photoactivatable CRISPR macronanocarrier for specific gene therapy, characterized in that, Includes the following steps: Step S1: Weigh 50 mg of monomer 1, 45 mg of monomer 2, 4 mg of bis(triphenylphosphine)palladium dichloride, and 4 mg of tris(o-methylphenyl)phosphine and dissolve them in 5 mL of anhydrous chlorobenzene. Stir vigorously at 100 °C for 10 min. After completion, filter the mixture and purify it by Soxhlet extraction with methanol to obtain SPBr. The monomer 1 is 2,6-dibromo-4,4-bis(6-bromohexyl)-4H-cyclopentano[2,1-b:3,4-b]dithiophene; the monomer 2 is 4,7-bis(5-trimethylstanyl-2-thienyl)-2,1,3-benzotriazole. Step S2: Weigh 12 mg SPBr and 3 mg sodium azide and dissolve them in a mixed solution of 6 mL tetrahydrofuran and 3 mL N,N-dimethylformamide. Stir at room temperature for 24 h. Dissolve the crude product in dichloromethane, wash it three times with brine, collect it in a flask, and dry it under vacuum to obtain polymer SPN3. Step S3: Weigh 8 mg SPN3 and 40 mg DNBS-PEG into 4 mL tetrahydrofuran, fill argon by three vacuum-argon cycles, and stir the mixture at room temperature in the dark argon environment for 12 h; after removing THF under reduced pressure, dissolve the obtained crude product in water, freeze-dry after dialysis, and obtain the final product SPN4. NH ; Step S4: Take 1 mg SP NH 4 OD single-stranded DNA was dissolved in 2 mL of ultrapure water, and the pH was adjusted to 6 with 10 mmol hydrochloric acid solution. After stirring at room temperature for 24 h, the mixture was ultrafiltered and washed to obtain the control nanosystem, denoted as SP. ND ; Step S5: Add 4 OD of guide RNA to the solution obtained in step S4, heat in a water bath at 95 °C for 2 min, then cool down, and finally cool to 25 °C. After cycling 5 times, ultrafiltration and washing are performed to obtain the photoactivated CRISPR polymeric nanocarrier for specific gene therapy, denoted as SP. NDR(G) ; The sequence of the ssDNA complementary to the guide RNA in the SP NH The sequence of the ssDNA complementary to the guide RNA in the SP NDR(G) The sequence of the ssDNA complementary to the guide RNA in the SP 2. The method for preparing a photo-activated CRISPR macromolecular nanocarrier for specific gene therapy according to claim 1, characterized in that: The ultrafiltration washing conditions in steps S4 and S5 are 30 kDaltons and a rotation speed of 800~1200 r / min.