Sucrose isomerase mutant and application thereof in preparation of isomaltulose

Abstract

The invention relates to the technical field of biology, and discloses a sucrose isomerase mutant and application thereof in preparation of isomaltulose. The amino acid sequence of the sucrose isomerase derived from Serratia symbiosis is subjected to single-point mutation or combined mutation of any point of the 149th site, the 222nd site and the 297th site, so that the catalytic efficiency of the obtained sucrose isomerase mutant for catalyzing sucrose to prepare isomaltulose is improved, and specifically, the selectivity of the isomaltulose is improved, and the enzyme activity of the isomaltulose is improved. When sucrose is isomerized to generate isomaltulose, the selectivity of the mutant to the product isomaltulose is obviously improved. Meanwhile, the catalytic activity of the sucrose isomerase mutant is also improved, so that the efficiency of catalytically preparing isomaltulose by the sucrose isomerase mutant is high, and the reaction time is short.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a sucrose isomerase mutant and application thereof in the preparation of isomaltulose. Background Art

[0002] Isomaltulose, also known as palatinose, is a natural functional sugar, which is formed by combining one molecule of glucose and one molecule of fructose through an α-1,6 glycosidic bond. It is an isomer of sucrose. The appearance and taste of this sugar are similar to sucrose, but its sweetness is slightly lower, about 42% of sucrose. The sweetness characteristics and unique health benefits of isomaltulose have a wide range of application value in the fields of food and health.

[0003] The method of extracting isomaltulose from plants is difficult to meet the current market demand. The methods for preparing isomaltulose that have been developed include chemical synthesis and biotransformation. The chemical synthesis method has high synthesis technology difficulty, high cost, and serious environmental pollution; the microbial transformation method also has many problems, such as long production cycle, difficult separation and extraction, etc. In contrast, the enzyme-catalyzed synthesis method shows obvious advantages. It can directly use sucrose isomerase to react, can be applied to higher concentrations of substrates, and conforms to the concept of green production. Therefore, the enzyme-catalyzed synthesis method is considered to be the most effective method for preparing isomaltulose.

[0004] Sucrose isomerase (SIase, EC 5.4.99.11) can isomerize sucrose into isomaltulose, and has potential value in carbohydrate conversion and the development of new sugar sources. Sucrose isomerase is mainly found in bacteria, such as Klebsiella sp., Serratia plymuthica sp., Protaminobacter rubrumsp., Erwinia sp., and Pantoea persa. However, the currently disclosed sucrose isomerase generally has problems such as weak stability, low catalytic efficiency and isomaltulose product selectivity, and more by-products. These problems limit the efficiency and effect of sucrose isomerase in practical applications, making it difficult to exert its due potential. Summary of the invention

[0005] In order to solve the technical problem of low catalytic efficiency of sucrose isomerase, the present invention provides a sucrose isomerase mutant and its application in the preparation of isomaltulose.

[0006] The specific technical scheme of the present invention is: In a first aspect, the present invention provides a sucrose isomerase mutant, which is obtained by subjecting the amino acid sequence shown in SEQ ID NO.1 to single-point mutation or multi-point combined mutation at the following positions: The amino acid at position 149 was mutated from arginine (R) to glutamine (Q); The amino acid at position 222 was mutated from aspartic acid (D) to glutamic acid (E); The amino acid at position 297 mutated from phenylalanine (F) to tyrosine (Y).

[0007] The present invention improves the catalytic efficiency of the obtained sucrose isomerase mutant for catalyzing the preparation of isomaltulose from sucrose by performing single-point mutations at positions 149, 222, and 297 or any combination of the above multiple points on the amino acid sequence shown in SEQ ID NO.1, which is specifically reflected in the improvement of isomaltulose selectivity and enzyme activity. When isomerizing sucrose to generate isomaltulose, the above mutant significantly improves the selectivity of the product isomaltulose. At the same time, the catalytic activity of the above sucrose isomerase mutant is also improved. Therefore, the above sucrose isomerase mutant has high efficiency in catalyzing the preparation of isomaltulose and short reaction time.

[0008] In a second aspect, the present invention provides a gene encoding the above-mentioned sucrose isomerase mutant.

[0009] In a third aspect, the present invention provides an expression vector or a cloning vector of the above-mentioned encoding gene.

[0010] Preferably, the expression vector is a plasmid, a phage or a viral vector.

[0011] In a fourth aspect, the present invention provides a host cell carrying the above-mentioned coding gene or the above-mentioned expression vector, for example, a genetically engineered bacterium for expressing the above-mentioned sucrose isomerase mutant.

[0012] In a fifth aspect, the present invention provides use of the above-mentioned sucrose isomerase mutant in the preparation of isomaltulose.

[0013] The application method comprises the following steps: using sucrose as substrate and using the sucrose isomerase mutant as catalyst.

[0014] Compared with the prior art, the present invention has the following technical effects: 1. The present invention improves the catalytic efficiency of the obtained sucrose isomerase mutant for catalyzing the preparation of isomaltulose from sucrose by performing single-point mutations at positions 149, 222, and 297 or any combination of the above multiple points on the amino acid sequence shown in SEQ ID NO.1, which is specifically reflected in the improvement of isomaltulose selectivity and enzyme activity. When isomerizing sucrose to generate isomaltulose, the above mutant significantly improves the selectivity of the product isomaltulose. At the same time, the catalytic activity of the above sucrose isomerase mutant is also improved. Therefore, the above sucrose isomerase mutant has high efficiency in catalyzing the preparation of isomaltulose and short reaction time.

[0015] 2. The present invention uses the wet cells of the above-mentioned sucrose isomerase mutant to directly apply to the enzymatic catalytic preparation of isomaltulose, which has the outstanding advantages of low production cost and high efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the sucrose conversion rate of sucrose isomerase SI5, SI5-R149Q, SI5-D222E, SI5-F297Y, and Sl5-R149Q / D222E / F297Y at a sucrose concentration of 600 g / L. DETAILED DESCRIPTION

[0017] The present invention will be further described below in conjunction with embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present invention.

[0018] In the following examples, the culture medium involved is composed as follows: LB liquid medium: yeast extract 5 g / L, sodium chloride 10 g / L, peptone 10 g / L.

[0019] In the following embodiments, the detection methods involved are as follows: (1) Method for determining the activity of sucrose isomerase: To 1 mL of 50 mM pH 6.0 citric acid-disodium hydrogen phosphate buffer containing 200 g / L sucrose, add wet bacteria containing recombinant sucrose isomerase at a final concentration of 2 g / L; react at 40°C for 4 min, then terminate the enzymatic reaction in a 100°C boiling water bath for 10 min, centrifuge to obtain the supernatant, and use HPLC to detect the content of isomaltulose in the reaction solution.

[0020] (2) Definition of sucrose isomerase activity unit (U): At pH 6.0 and 40°C, the amount of sucrose converted by each gram of wet bacteria in 4 minutes is defined as one unit of enzyme activity.

[0021] The specific enzyme activity is defined as the enzyme activity per unit wet cell U / g.

[0022] (3) Detection of isomaltulose content: The isomaltulose content was determined using an Agilent liquid chromatograph (Agilent 1260 InfinityⅡLC) and an Elite amino column (SupersilNH2 plus 5um4.6mm*250mm). The mobile phase was acetonitrile:water (75:25), the injection volume was 10μL, the flow rate was 1mL / min, the column temperature was 30℃, the detector was a differential refractive index detector (RID), and the detector temperature was 31.5℃.

[0023] (4) Method for determining the selectivity of isomaltulose product of sucrose isomerase: In 10mL of pH 6.0, 50mM citric acid-sodium hydrogen phosphate buffer, add 0.05g wet bacteria (5g / L) of the recombinant strain containing sucrose isomerase and 1g sucrose (100g / L), and react at 700rpm and 40℃ for 0.5h. Boil for 10min to terminate the reaction. Centrifuge at 12000rpm for 10min, collect the supernatant, dilute the centrifuged supernatant 100 times with ultrapure water, and filter it with a water filter membrane (0.22μm) for high performance liquid chromatography analysis to determine the content of sucrose, isomaltulose, trehalulose, glucose and fructose in the reaction system. Set up three parallel experiments, and the final results are expressed as mean ± standard deviation.

[0024] (5) Isomaltulose selectivity (the calculation method for trehalulose, glucose and fructose is the same as that for isomaltulose) is calculated using the following formula:

[0025] Example 1 Construction of recombinant E. coli BL21(DE3) / pET-28a(+)-SI5 (1) In this example, sucrose isomerase SI5 from Serratia symbiotica was used as the wild-type enzyme, and the amino acid sequence of wild-type SI5 is shown in SEQ ID NO. 1. The codon encoding the wild-type enzyme SI5 was optimized to obtain the optimized nucleotide sequence shown in SEQ ID NO. 2, and a 6×His tag was inserted at the C-terminus of the nucleotide sequence shown in SEQ ID NO. 2 to synthesize the gene, cloned into the vector pET-28a(+), and the cloning sites were NcoⅠ and XhoⅠ to obtain the recombinant plasmid pET-28a(+)-SI5, which was stored at -20°C.

[0026] (2) Add 10 μL of recombinant plasmid pET-28a(+)-SI5 to 100 μL of E. coli BL21(DE3) competent cells and mix gently. Place the cells on ice for 30 min, heat shock the cells in a 42°C water bath for 90 s, and quickly place the cells on ice for 2 min. Add 800 μL of LB culture medium and culture the cells on a shaker at 37°C and 200 rpm for 1.5 h. Collect the cells by centrifugation at 5000 rpm for 2 min, resuspend the cells in 80 μL of the supernatant, and spread the cells on a LB solid culture medium plate containing 100 μg / mL kanamycin. Invert the plate and culture it in a 37°C constant temperature incubator overnight to prepare recombinant E. coli BL21(DE3) / pET-28a(+)-SI5.

[0027] Example 2 Mutation Design and Construction of Sucrose Isomerase Site-directed mutagenesis was performed according to the amino acid sequence of wild-type SI5 (as shown in SEQ ID NO.1). Primers were designed, and sucrose isomerase mutant plasmids pET-28a(+)-SI5-R149Q, pET-28a(+)-SI5-D222E, pET-28a(+)-SI5-F297Y, and pET-28a(+)-SI5-R149Q / D222E / F297Y were obtained by site-directed mutagenesis using the E. coli BL21(DE3) / pET-28a(+)-SI5 expression vector prepared in Example 1 as a template.

[0028] The primers used for the design of site-directed mutagenesis of sucrose isomerase are as follows: (1) Single point mutation: The 149th amino acid of wild-type SI5 was mutated from arginine (R) to glutamine (Q). The primers for the sucrose isomerase mutant plasmid pET-28a(+)-SI5-R149Q obtained by site-directed mutagenesis were: The upstream primer was: ACACCAGCGACCAGCATGCGTGGTTCGTGAAGAGC; The downstream primer is: ATGCTGGTCGCTGGTGTGATTGATGACGATGT.

[0029] (2) Single point mutation: The amino acid 222 of wild-type SI5 was mutated from aspartic acid (D) to glutamic acid (E). The primers for the sucrose isomerase mutant plasmid pET-28a(+)-SI5-D222E obtained by site-directed mutagenesis were: The upstream primer was: GTTCGTCAGGAACTGTATAAGATGTTACGTTTCTGGCTG; The downstream primer is: TACAGTTCCTGACGAACATTGCTGTTGTCCCA.

[0030] (3) Single point mutation: The amino acid 297 of wild-type SI5 was mutated from phenylalanine (F) to tyrosine (Y). The primers for the sucrose isomerase mutant plasmid pET-28a(+)-SI5-F297Y obtained by site-directed mutagenesis were: The upstream primer was: ATTGTATGGTATCCCGCTGGACCAATCTATCA; The downstream primer is: GCGGGATACCATACAATTCGCCAGCCGTCGCA.

[0031] (4) The 149th amino acid of the wild-type SI5 was mutated from arginine (R) to glutamine (Q), the 222th amino acid was mutated from aspartic acid (D) to glutamate (E), and the 297th amino acid was mutated from phenylalanine (F) to tyrosine (Y). The sucrose isomerase mutant plasmid pET-28a(+)-SI5-R149Q / D222E / F297Y obtained by site-directed mutagenesis was simultaneously generated using the primers contained in the above single point mutations.

[0032] The reaction system for PCR amplification of site-directed mutagenesis was 0.5 μL of dNTP Mix, 0.5 μL of DNA Polymerase, 10 μL of 2×Phanta Max Buffer, 1 μL of E. coli BL21 (DE3) / pET-28a (+) -SI5 plasmid, 6 μL of ddH2O, and 1 μL of each primer.

[0033] PCR program: 98°C pre-denaturation for 5 min, 98°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 4 min, for 33 cycles.

[0034] After the PCR, the amplified fragments were subjected to nucleic acid gel electrophoresis. The amplified fragments containing the target bands were purified using a kit, and 10 μL of the purified product was added to 100 μL of E. coli BL21 (DE3) competent cells and gently mixed. After ice bathing for 30 minutes, heat shock was performed in a 42°C water bath for 90 seconds. After heat shock, it was quickly placed on ice for 2 minutes, and then 800 μL of LB culture medium was added. The culture was placed at 37°C and shaken at 200 rpm for 1.5 hours. The bacteria were collected after centrifugation at 5000 rpm for 2 minutes, 80 μL of the supernatant was taken to resuspend the bacteria, and then spread on an LB solid culture medium plate containing 100 μg / mL kanamycin, and inverted in a 37°C constant temperature incubator for overnight culture.

[0035] A single colony was picked and placed in a 10 mL LB liquid culture medium tube containing 100 μg / mL kanamycin, and cultured at 37°C, 200 rpm, with shaking for about 12 h. The plasmid was extracted and sent to Beijing Qingke Biotechnology Co., Ltd. (Hangzhou) for sequencing verification, and plasmids pET-28a(+)-SI5-R149Q, pET-28a(+)-SI5-D222E, pET-28a(+)-SI5-F297Y, and pET-28a(+)-SI5-R149Q / D222E / F297Y were prepared respectively.

[0036] Example 3 Expression of recombinant sucrose isomerase and its mutants and preparation of wet cells (1) Take 10 μL of the plasmid pET-28a(+)-SI5 prepared in Example 1, and the plasmids pET-28a(+)-SI5-R149Q, pET-28a(+)-SI5-D222E, pET-28a(+)-SI5-F297Y, and pET-28a(+)-SI5-R149Q / D222E / F297Y prepared in Example 2, respectively, and add them to 100 μL of E. coli After gently mixing the BL21 (DE3) competent cells, ice bath for 30 minutes, heat shock in a 42°C water bath for 90 seconds, quickly place on ice for 2 minutes, add 800 μL LB culture medium, place at 37°C, shake on a shaker at 200 rpm for 1.5 hours, collect the cells after centrifugation at 5000 rpm for 2 minutes, take 80 μL of supernatant to resuspend the cells, and then spread them on LB solid culture medium plates containing 100 μg / mL kanamycin, and invert them in a 37°C constant temperature incubator for overnight culture. Recombinant Escherichia coli expressing wild-type sucrose isomerase SI5 and its different mutants were prepared by this step.

[0037] (2) Pick a single colony from step (1) and place it in a 10 mL LB liquid culture medium test tube containing 100 μg / mL kanamycin, and shake and culture it in a shaker at 37°C and 200 rpm for about 8 h. Inoculate the seed solution grown in the test tube into a shake flask containing 100 μg / mL kanamycin in an LB liquid culture medium at a 2% inoculation volume (volume ratio), and culture the bacteria at 37°C and 180 rpm until the OD 600 When the pH value reaches 0.7, IPTG with a final concentration of 0.4 mM is added, and the mixture is induced and cultured at 25°C for 12 hours, and then centrifuged at 4°C and 8000 rpm for 10 minutes, the supernatant is discarded, and the precipitate is collected. By this step, wet cells of recombinant Escherichia coli containing wild-type sucrose isomerase SI5 and recombinant sucrose isomerase SI5-R149Q, SI5-D222E, SI5-F297Y, and SI5-R149Q / D222E / F297Y are obtained respectively. The wet cells can be directly used as biocatalysts.

[0038] Example 4 Determination of Isomaltulose Product Selectivity of Recombinant Sucrose Isomerase The wet cells prepared in Example 3, i.e., sucrose isomerase SI5 and its mutants SI5-R149Q, SI5-D222E, SI5-F297Y, and SI5-R149Q / D222E / F297Y, were used to catalyze the substrate sucrose to determine the isomaltulose product selectivity of sucrose isomerase. The following steps were followed: In 10mL of pH 6.0, 50mM citric acid-sodium hydrogen phosphate buffer, add 0.05g of wet bacteria (5g / L) of the recombinant strain containing sucrose isomerase and 1g of sucrose (100g / L), and react at 700rpm and 40℃ for 0.5h. The reaction was terminated by boiling for 10min. Centrifuge at 12000rpm for 10min, collect the supernatant, dilute the centrifuged supernatant 100 times with ultrapure water, and filter it with a water filter membrane (0.22μm) for high performance liquid chromatography analysis to determine the content of sucrose, isomaltulose, trehalulose, glucose and fructose in the reaction system. Set up three sets of parallel experiments, and the final results are expressed as mean ± standard deviation. The measurement results are shown in Table 1 below.

[0039] Table 1 Results of isomaltulose selectivity determination of SI5 and mutants The results showed that the original isomaltulose product selectivity of sucrose isomerase SI5 was 72.4%, and the isomaltulose product selectivity of the mutants was greatly improved, among which the isomaltulose product selectivity of the mutant SI5-R149Q / D222E / F297Y was increased by 18.85% compared with the wild type. This shows that the sucrose isomerase mutant prepared by the present invention is conducive to improving the isomaltulose product selectivity of sucrose isomerase.

[0040] Example 5 Determination of the enzyme activity of recombinant sucrose isomerase The wet cells prepared in Example 3, i.e., sucrose isomerase SI5 and its mutants SI5-R149Q, SI5-D222E, SI5-F297Y, and SI5-R149Q / D222E / F297Y, were used to catalyze the substrate sucrose to determine the enzymatic activity of each enzyme. The following steps were followed: To 1 mL of 50 mM, pH 6.0 citric acid-disodium hydrogen phosphate buffer containing 100 g / L sucrose, add wet cells with a final concentration of 2 g / L; react at 40°C for 4 min, then terminate the enzymatic reaction in a 100°C boiling water bath for 10 min, centrifuge to obtain the supernatant, and use an HPLC differential detector to detect the content of isomaltulose in the reaction solution.

[0041] Definition of sucrose isomerase activity unit (U): Under the conditions of pH 6.0 and 40°C, the micromolar amount of sucrose converted by one gram of wet bacteria in 4 minutes is defined as one enzyme activity unit.

[0042] Comparison of enzyme activities: The enzyme activity of sucrose isomerase SI5 reacted under the same conditions was defined as 100%, and the relative enzyme activity of the mutant was calculated based on the enzyme activity of sucrose isomerase, that is, the enzyme activity of the mutant was divided by the enzyme activity of sucrose isomerase SI5 to obtain the specific enzyme activity. The measurement results are shown in Table 2 below.

[0043] Table 2 Results of enzyme activity determination of SI5 and mutants The results showed that the original enzyme activity of sucrose isomerase SI5 was 24.37 U / g, and the enzyme activities of mutants R149Q, D222E, and R149Q / D222E / F297Y were increased by 1.29 times, 1.08 times, and 1.34 times, respectively, compared with the original enzyme activity. This indicates that the sucrose isomerase mutant prepared by the present invention is also beneficial to improving the enzyme activity of sucrose isomerase.

[0044] Example 6 Application of wild-type sucrose isomerase SI5 in the preparation of isomaltulose. The wet bacteria (whole cells) of recombinant Escherichia coli BL21 (DE3) / pET-28a (+) -SI5 containing the expression recombinant plasmid obtained in Example 3 were used as biocatalysts, and sucrose was used as a substrate to carry out a bioconversion reaction to prepare isomaltulose. The composition and catalytic conditions of the catalytic system are as follows: a 10 mL reaction system containing 50 mM, pH 6.0 citric acid-disodium hydrogen phosphate buffer, 5 g / L of recombinant sucrose isomerase SI5, an initial substrate final concentration of 600 g / L, a 40°C water bath, a magnetic stirring of 700 rpm, and timed sampling of the reaction. The sampling volume was 100 μL and diluted 600 times with 75% acetonitrile. The conversion rate at different times was determined by HPLC analysis. The results are as follows Figure 1 shown.

[0045] The results showed that the sucrose conversion rate was 84% ​​after 7 h of catalysis.

[0046] Example 7 Application of sucrose isomerase mutant SI5-R149Q in the preparation of isomaltulose The recombinant Escherichia coli BL21 (DE3) / pET-28a (+) -SI5-R149Q wet bacteria (whole cells) containing the expression recombinant plasmid obtained in Example 3 was used as a biocatalyst, and sucrose was used as a substrate to carry out a bioconversion reaction to prepare isomaltulose. The composition and catalytic conditions of the catalytic system are the same as those in Example 6. The conversion rate at different times was determined by HPLC analysis. The results are as follows: Figure 1 shown.

[0047] The results showed that after 7 hours of catalysis, the sucrose conversion rate was 96%, and the sucrose isomerase mutant SI5-R149Q as a catalyst increased by 14.3% compared with the wild type.

[0048] Example 8 Application of sucrose isomerase mutant SI5-D222E in the preparation of isomaltulose The wet bacteria (whole cells) of the recombinant Escherichia coli BL21(DE3) / pET-28a(+)-SI5-D222E containing the expression recombinant plasmid obtained in Example 3 were used as biocatalysts, and sucrose was used as a substrate to carry out a bioconversion reaction to prepare isomaltulose. The composition and catalytic conditions of the catalytic system are the same as those in Example 6. The conversion rates at different times were determined by HPLC analysis. The results are as follows: Figure 1 shown.

[0049] The results showed that after 7 hours of catalysis, the sucrose conversion rate was 93%, and the sucrose isomerase mutant SI5-D222E as a catalyst increased by 10.7% compared with the wild type.

[0050] Example 9 Application of sucrose isomerase mutant SI5-F297Y in the preparation of isomaltulose The recombinant Escherichia coli BL21 (DE3) / pET-28a (+) -SI5-F297Y wet bacteria (whole cells) containing the expression recombinant plasmid obtained in Example 3 was used as a biocatalyst, and sucrose was used as a substrate to carry out a bioconversion reaction to prepare isomaltulose. The composition and catalytic conditions of the catalytic system are as follows: The same as in Example 6, and the conversion rate at different times was determined by HPLC analysis. The results are as follows: Figure 1 shown.

[0051] The results showed that the sucrose conversion rate was 80% after 7 h of catalysis.

[0052] Example 10 Application of sucrose isomerase mutant SI5-R149Q / D222E / F297Y in the preparation of isomaltulose The recombinant Escherichia coli containing the expression recombinant plasmid obtained in Example 3 was used to generate the recombinant E. coli. BL21(DE3) / pET-28a(+)-SI5-R149Q / D222E / F297Y wet bacteria (whole cells) were used as biocatalysts, and sucrose was used as substrate to carry out bioconversion reactions to prepare isomaltulose. The composition and catalytic conditions of the catalytic system were the same as those in Example 6. The conversion rates at different times were determined by HPLC analysis. The results were as follows: Figure 1 shown.

[0053] The results showed that the sucrose conversion rate was 94% after 7 h of catalysis, and the sucrose isomerase mutant The catalyst SI5-R149Q / D222E / F297Y increased by 11.9% compared with the wild type.

[0054] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0055] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A sucrose isomerase mutant, characterized in that: The amino acid sequence shown in SEQ ID NO.1 is obtained by single point mutation or multi-point combined mutation at the following positions: The 149th amino acid mutated from arginine to glutamine; The amino acid at position 222 mutated from aspartic acid to glutamic acid; The amino acid at position 297 mutated from phenylalanine to tyrosine.

2. A gene encoding the sucrose ligase mutant according to claim 1.

3. An expression vector comprising the coding gene according to claim 2.

4. The expression vector according to claim 3, characterized in that: The expression vector is a plasmid, a phage or a virus vector.

5. A cloning vector comprising the encoding gene according to claim 2.

6. A host cell comprising the sucrose isomerase mutant of claim 1 or the encoding gene of claim 2.

7. Use of the sucrose isomerase mutant according to claim 1 in the preparation of isomaltulose.

8. The use according to claim 7, characterized in that: The preparation comprises the following steps: Sucrose is used as a substrate, and the sucrose isomerase mutant according to claim 1 is used as a catalyst.

Images