Saccharomyces cerevisiae with high phenolic inhibitor tolerance as well as key gene with high stress resistance and application of saccharomyces cerevisiae

Abstract

The invention provides saccharomyces cerevisiae with high phenolic inhibitor tolerance as well as a key gene with high stress resistance and application of the saccharomyces cerevisiae. The Saccharomyces cerevisiae with high phenolic inhibitor tolerance is classified and named as Saccharomyces cerevisiae S91, the Saccharomyces cerevisiae is preserved in the China General Microbiological Culture Collection Center on April 8, 2024, and the preservation number of the Saccharomyces cerevisiae is CGMCC No.30280; compared with a common starting strain, the saccharomyces cerevisiae S91 has higher endurance capacity and tolerance upper limit of single and multiple phenolic aldehyde inhibitors and can tolerate mixed phenolic aldehyde inhibitors (4-hydroxybenzaldehyde, syringaldehyde and vanillin) with the concentration of 10 mM, the cell growth, the glucose consumption rate and the ethanol production of the saccharomyces cerevisiae S91 are remarkably improved, and the fermentation delay phase is remarkably shortened; the key gene PST2 can strengthen phenolic aldehyde inhibitor tolerance of a fermentation strain, and has application potential in industrial production of cellulosic ethanol.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a strain of brewer's yeast with high tolerance to phenolic inhibitors, a key gene with high stress resistance and an application thereof. Background Art

[0002] Lignocellulose, such as corn stalks and rice stalks, is the largest biomass resource and a renewable resource with great potential to replace fossil energy. It is estimated that the total amount of lignocellulose resources in the world is as high as 180 billion tons. However, lignocellulose is biologically resistant and difficult to be rapidly degraded by cellulase and microorganisms. The pretreatment process can effectively destroy the recalcitrant structure of lignocellulose, but this process will inevitably produce some inhibitors of subsequent cellulase enzymatic hydrolysis and fermentation microbial biological activity. Among them, phenolic inhibitors derived from lignin are difficult to effectively remove from the pretreated raw materials due to their poor water solubility, complex composition and high toxicity. They include phenolic aldehydes, phenolic acids and phenolic alcohols. These three inhibitors are phenolic aldehydes, phenolic acids and phenolic alcohols in order of toxicity.

[0003] Conventional inhibitor removal methods include over-alkali neutralization, water washing, activated carbon adsorption and biological detoxification. However, these methods may also be accompanied by the generation of a large amount of wastewater, by-products and loss of fermentable sugars while removing inhibitors; phenolic inhibitors have poor water solubility and low biodegradation efficiency. After detoxification, a large amount of phenolic inhibitors will still remain, which will have a serious impact on subsequent microbial fermentation. In order to solve the impact of inhibitors, the Chinese invention patent with publication number CN111334443A discloses a saccharomyces cerevisiae strain tolerant to vanillic acid, p-hydroxybenzoic acid and syringic acid and its application, which strengthens the phenolic acid inhibitor tolerance of saccharomyces cerevisiae through adaptive evolution, but can only solve the problem of poor phenolic acid tolerance of the strain, and it is difficult to effectively solve the tolerance problem of more toxic phenolic inhibitors, resulting in low cellulosic ethanol production rate and long fermentation cycle. Summary of the invention

[0004] The purpose of the present invention is to solve the above-mentioned technical problems and provide a brewer's yeast that is tolerant to phenolic inhibitors. The brewer's yeast can have higher phenolic tolerance. The second purpose of the present invention is to provide an application of the brewer's yeast in improving the production rate of cellulosic ethanol and shortening the fermentation cycle. Another purpose of the present invention is to provide a key gene with high tolerance to phenolic inhibitors.

[0005] To achieve the above object, the present invention adopts the following technical solutions: A strain of Saccharomyces cerevisiae tolerant to phenolic inhibitors, the strain is classified and named Saccharomyces cerevisiae ( Saccharomyces cerevisiae) S91, was deposited in the General Microbiology Center of China Microorganism Culture Collection on April 8, 2024, with the deposit number CGMCC No.30280; the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101.

[0006] The brewing yeast S91 was obtained by cultivating in the laboratory of the School of Biological and Food Engineering of Changshu Institute of Technology. Its direct source was distiller's yeast and its discovery date was July 6, 2023. The discoverer was Yan Zhao. Compared with the common starting strain of brewing yeast, the brewing yeast S91 has a higher tolerance to phenolic inhibitors and has a higher upper tolerance limit for both single phenolic aldehydes and multiple phenolic aldehydes. Its cell growth, glucose consumption rate and ethanol production are significantly improved, and the fermentation lag period is significantly shortened.

[0007] Furthermore, a gene PST2 for tolerance to phenolic aldehyde inhibitors was found to be expressed in the Saccharomyces cerevisiae S91 of the present invention, and the nucleotide sequence of the gene is shown in SEQ ID No. 1. The expression of the gene can significantly improve the phenolic aldehyde tolerance of the strain.

[0008] Furthermore, the present invention provides an expression vector pYX212-PST2 of the above-mentioned gene PST2 for tolerance to phenolic inhibitors, and the nucleotide sequence of the expression vector pYX212-PST2 is shown in SEQ ID No.2.

[0009] Preferably, a strong promoter TEF1 and a strong terminator CYC1 are inserted into the expression vector to enhance the expression of key genes.

[0010] Furthermore, the present invention provides a recombinant engineered bacterium, which can express the above-mentioned gene for tolerance to phenolic inhibitor.

[0011] Furthermore, the present invention provides the use of the above-mentioned Saccharomyces cerevisiae with high tolerance to phenolic inhibitors or the above-mentioned recombinant engineered bacteria in the production of alcohols by fermenting a fermentation substrate containing phenolic inhibitors.

[0012] Furthermore, the present invention provides the use of the above-mentioned gene for tolerance to phenolic inhibitors or the above-mentioned expression vector in enhancing the phenolic inhibitor tolerance of a strain or in breeding strains tolerant to phenolic inhibitors.

[0013] Furthermore, the phenolic inhibitor includes at least one of 4-hydroxybenzaldehyde, syringaldehyde and vanillin.

[0014] Preferably, when the fermentation substrate contains only a single phenolic inhibitor, the strain can tolerate up to 12 mM 4-hydroxybenzaldehyde, 14 mM syringaldehyde, and 12 mM vanillin.

[0015] Preferably, when the fermentation substrate contains the same concentration of three phenolic inhibitors 4-hydroxybenzaldehyde, syringaldehyde and vanillin, the upper tolerance limit concentration can reach 10 mM.

[0016] Furthermore, the fermentation substrate containing phenolic inhibitors is fermented to produce alcohol substances, wherein the fermentation substrate is unenzymatically hydrolyzed lignocellulose or enzymatically hydrolyzed lignocellulose; and the alcohol substance is ethanol.

[0017] Furthermore, the application comprises the following steps: enzymolysis of the pretreated lignocellulosic material with cellulase, the amount of cellulase used is 15-20 FPU / g lignocellulosic material, saccharification for 36-48 h, temperature is 45-50°C, filtering and sterilizing to obtain a hydrolyzate, and finally inoculating the above-mentioned brewer's yeast S91 or the above-mentioned recombinant engineered bacteria as a strain into the hydrolyzate, and the concentration of the seed liquid strain is 1.2×10 8 ~2.5×10 8 CFU / mL; CFU (Colony-Forming Units) represents the total number of colonies per unit volume; the inoculation amount is 5%~10% (v / v), and the fermentation is carried out at 30~35℃ for 48~72 h.

[0018] Furthermore, the above application includes the following steps: mixing the pretreated lignocellulosic material, cellulase and the expanded bacterial strain, wherein the amount of cellulase is 15-20 FPU / g material, the bacterial strain inoculation amount is 5%-10% (v / v), and fermenting at 30-35°C for 72-96 hours; the bacterial strain is the above-mentioned Saccharomyces cerevisiae S91 or the above-mentioned recombinant engineered bacteria, and the concentration of the seed liquid bacterial strain is 1.2×10 8 ~2.5×10 8 CFU / mL.

[0019] Preferably, the strains need to be activated and expanded before inoculation to obtain primary seed solution and secondary seed solution. The preparation methods of the primary seed solution and secondary seed solution are as follows: S1. Activation of strains: Activate Saccharomyces cerevisiae preserved in 25%-30% (v / v) glycerol in YEPD solid medium (by mass, 1%-2% glucose, 0.5%-1% yeast extract, 0.5%-1% peptone, 0.1%-0.2% potassium dihydrogen phosphate, 1.5%-2% agar powder) for 24-48 h until a single colony grows. The culture temperature is 30-35°C. S2. Primary seed liquid: Pick a single colony of Saccharomyces cerevisiae and inoculate it into YEPD liquid medium (by mass, 1%~2% glucose, 0.5%~1% yeast extract, 0.5%~1% peptone, 0.1%~0.2% potassium dihydrogen phosphate), and culture it at 30~35℃ and 150~200 rpm for 12~16 h; S3. Secondary seed solution: Pipette the primary seed solution and inoculate it into the fermentation medium (by mass, 2%~4% glucose, 0.5%~1% yeast extract, 0.5%~1% peptone, 0.1%~0.2% potassium dihydrogen phosphate) with an inoculum amount of 5%~10% (v / v). Culture at 30~35℃ and 150~200 rpm for 12~16 h.

[0020] Preferably, the above-mentioned pretreatment method includes one of a dilute acid method or an alkaline treatment method.

[0021] More preferably, when the pretreatment method is the dilute acid method, the pretreatment conditions are: the concentration of the sulfuric acid solution is 1-5%wt, the pretreatment temperature is 100-180°C, the time is controlled at 3-60 min, and the material-liquid ratio (by mass) is 1:1-1:10.

[0022] More preferably, when the pretreatment method is an alkali treatment method, the pretreatment conditions are: the concentration of NaOH solution is 1-4%wt, the pretreatment temperature is 80-120°C, the time is controlled at 6-24 h, and the material-liquid ratio (by mass) is 1:1-1:10.

[0023] Preferably, the lignocellulosic material is at least one of corn straw, rice straw, wheat straw, corncob residue, bamboo and sawdust.

[0024] The beneficial effects of the present invention are as follows: (1) The Saccharomyces cerevisiae strain S91 of the present invention has a higher tolerance to a single phenolic inhibitor than the starting strain, with the upper tolerance limit for syringaldehyde and 4-hydroxybenzaldehyde increased from 10 mM to 12 mM concentration, and the upper tolerance limit for syringaldehyde increased from 12 mM to 14 mM concentration.

[0025] (2) The Saccharomyces cerevisiae strain S91 of the present invention has a higher tolerance to mixed phenolic inhibitors than the starting strain; at a concentration of 8 mM, the cell growth and ethanol production of Saccharomyces cerevisiae S91 were increased by 9.1 and 10.9 times, respectively, compared with the starting strain; at a concentration of 10 mM, the cell growth and ethanol production of Saccharomyces cerevisiae S91 were increased by 1.2 and 4.3 times, respectively, compared with the starting strain.

[0026] (3) The brewer's yeast strain S91 of the present invention has excellent fermentation performance when carrying out cellulosic ethanol fermentation. Compared with the starting strain, the glucose consumption rate, ethanol production rate and cell viability of the brewer's yeast S91 within 48 h were increased by 65.4%, 63.3% and 1.9 times, respectively, and the fermentation lag phase was shortened by more than 12 h.

[0027] (4) Compared with the control strain carrying an empty plasmid, the cell growth and ethanol production of the recombinant strain overexpressing PST2 in the present invention, Saccharomyces cerevisiae pYX212-PST2, were increased by 4.2 and 4.5 times, respectively, under the condition of 8 mM mixed phenolic inhibitors, and by 1.6 and 2.5 times, respectively, under the condition of 10 mM mixed phenolic inhibitors.

[0028] Deposit of biological materials: This yeast ( Saccharomyces cerevisiae ) S91, deposited on April 8, 2024 in the General Microbiology Center of China Microorganism Culture Collection Administration, the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101, the deposit number is CGMCC No.30280. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the adaptive evolution map of Saccharomyces cerevisiae S91; Figure 1 I means 21 transfers in stage I; II means 22-64 transfers in stage II; III means 65-91 transfers in stage III; Figure 1 (a) and (b) respectively show the changes in cell growth, glucose consumption and ethanol concentration at different stages.

[0030] Figure 2 The cell growth of Saccharomyces cerevisiae S91 under three single phenolic inhibitor conditions; Figure 2 (a), (b) and (c) respectively represent the growth of S91 and the starting strain Saccharomyces cerevisiae at concentrations of 10 mM, 12 mM and 14 mM of a single phenolic inhibitor, where Saccharomyces cerevisiae S91 is referred to as “S.cerevisiae S91”.

[0031] Figure 3 The fermentation results of Saccharomyces cerevisiae S91 under three mixed phenolic inhibitors are shown; Figure 3(a) and (b) show the cell growth and ethanol production of Saccharomyces cerevisiae S91 and the starting strain Saccharomyces cerevisiae as a control under the conditions of 8 mM and 10 mM concentrations of three mixed phenolic inhibitors, respectively.

[0032] Figure 4 for cellulosic ethanol fermentation by Saccharomyces cerevisiae S91; Figure 4 (a) and (b) respectively show the cell growth and ethanol concentration changes of Saccharomyces cerevisiae S91 and the starting strain Saccharomyces cerevisiae under the conditions of 8 mM and 10 mM concentrations of three mixed phenolic inhibitors using cellulose as substrate.

[0033] Figure 5 The fermentation results of the recombinant strain of Saccharomyces cerevisiae pYX212-PST2 under three mixed phenolic inhibitor conditions; Figure 5 (a) and (b) respectively show the cell growth and ethanol concentration changes of the recombinant strain of Saccharomyces cerevisiae pYX212-PST2 and the starting strain Saccharomyces cerevisiae as a control under the conditions of 8 mM and 10 mM concentrations of three mixed phenolic inhibitors. DETAILED DESCRIPTION

[0034] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only embodiments of a part of the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention. The following culture media and related reagents are commercially available unless otherwise specified, and the strain used as a control is Saccharomyces cerevisiae Saccharomyces cerevisiae .

[0035] Example 1 Obtaining Saccharomyces cerevisiae S91 with high resistance to phenolic inhibitors 1. Experimental Methods In this embodiment, brewer's yeast in wine koji is used as the starting strain, and three mixed phenolic inhibitors (vanillin, syringaldehyde, 4-hydroxybenzaldehyde) are added exogenously, and the concentrations of the three phenolic inhibitors are kept consistent. In this embodiment, by adding a gradually increasing concentration of mixed phenolic inhibitors, after the cell growth (measurement of OD600) reaches stability, the concentration of the mixed phenolic inhibitor is increased; after the strain gradually adapts to a higher concentration of mixed phenolic inhibitors, the concentration of the mixed phenolic inhibitor is further increased. Among them, the initial concentration of the mixed phenolic inhibitor can be determined according to the tolerance of the strain itself. It must be ensured that the strain can grow at the initial concentration (recommended 2~4 mM), and then the concentration of the inhibitor is increased step by step, and each change span is 2 mM. During the fermentation, the glucose consumption and ethanol production are simultaneously measured.

[0036] 2. Experimental results The experimental results are as follows Figure 1 As shown by Figure 1 As shown in (a) and (b), the continuous transfer in stage I was carried out in the fermentation medium supplemented with 4 mM mixed phenolic inhibitors. The OD of the strain after 21 transfers was 600 After reaching stability (around 21.1), the culture entered Phase II. Phase II (22-64 transfers) was a fermentation medium supplemented with 6 mM mixed phenolic inhibitors. 600 Gradually reaching stability (around 18.7) and entering stage III culture; stage III (65-91 transfers) is when the OD of the strain is increased in the fermentation medium supplemented with 8mM mixed phenolic inhibitors. 600 It gradually reached stability (around 13.8), ending the adaptive evolution screening process and obtaining an evolved strain of Saccharomyces cerevisiae S91 with high resistance to phenolic inhibitors.

[0037] The screened brewer's yeast S91 has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101, and the deposit number is CGMCC No.30280.

[0038] Example 2 Expansion of Saccharomyces cerevisiae The method for the expansion of brewer's yeast is as follows: S1. Activation of strains: Saccharomyces cerevisiae preserved in 30% (v / v) glycerol was activated in YEPD solid medium (by mass, 2% glucose, 1% yeast extract, 1% peptone, 0.2% potassium dihydrogen phosphate, 2% agar powder) for 48 h until a single colony grew. The culture temperature was 30°C. S2. Seed liquid: Pick a single colony of Saccharomyces cerevisiae and inoculate it into YEPD liquid medium (by mass, 2% glucose, 1% yeast extract, 1% peptone, 0.2% potassium dihydrogen phosphate) and culture it at 30°C and 200 rpm for 12 h; S3. Secondary seed solution: The above seed solution was inoculated into the fermentation medium (4% glucose, 1% yeast extract, 1% peptone, 0.2% potassium dihydrogen phosphate by mass) with an inoculation amount of 10% (v / v) and cultured at 30°C and 200 rpm for 12 h.

[0039] Example 3 Evaluation of the tolerance of the highly phenolic tolerant Saccharomyces cerevisiae S91 to a single phenolic inhibitor 1. Experimental Methods In order to analyze the tolerance of Saccharomyces cerevisiae S91 to a single phenolic inhibitor, this example compares the cell growth of Saccharomyces cerevisiae S91 under the conditions of 10mM, 12mM, and 14mM of three single phenolic inhibitors, vanillin, syringaldehyde, and 4-hydroxybenzaldehyde. The primary seed liquid was inoculated into the fermentation medium with exogenously added phenolic inhibitors at 10% (v / v), and transferred to fresh medium every 24h at 30℃ and 200rpm. The transfer amount was 10% (v / v), and the starting strain was used as a control. The growth of the strain was investigated by exogenously adding single vanillin, syringaldehyde, and 4-hydroxybenzaldehyde to the fermentation medium. Cell growth was measured by measuring the OD at 12h. 600 The absorbance value was measured.

[0040] 2. Experimental results like Figure 2 As shown in (a), (b) and (c), Saccharomyces cerevisiae S91 showed strong tolerance to the three single phenolic inhibitors, with the upper tolerance limit for syringaldehyde and 4-hydroxybenzaldehyde increased to 12 mM concentration, and the upper tolerance limit for vanillin increased to 14 mM concentration.

[0041] Example 4 Evaluation of the tolerance of highly phenolic aldehyde-tolerant Saccharomyces cerevisiae to three mixed phenolic aldehyde inhibitors 1. Experimental Methods In order to analyze the tolerance of Saccharomyces cerevisiae S91 to three mixed phenolic inhibitors, this example compares the cell growth and ethanol production of Saccharomyces cerevisiae S91 under the conditions of 8 mM and 10 mM of three mixed phenolic inhibitors, with the starting strain as the control. In this example, three same concentrations of vanillin, syringaldehyde and 4-hydroxybenzaldehyde were exogenously added to the fermentation medium to investigate the fermentation of the strain, wherein the cell growth was measured by measuring the OD value for 12 h. 600 The ethanol in the fermentation process was determined by high performance liquid chromatography.

[0042] 2. Experimental results like Figure 3 As shown in (a) and (b), Saccharomyces cerevisiae S91 showed strong tolerance under the conditions of three mixed phenolic inhibitors. At 8 mM concentration, the cell growth and ethanol production of Saccharomyces cerevisiae S91 increased by 9.1 and 10.9 times respectively compared with the starting strain; at 10 mM concentration, the cell growth and ethanol production of Saccharomyces cerevisiae S91 increased by 1.2 and 4.3 times respectively compared with the starting strain. Combining the results of this example and Example 3, it is shown that the tolerance of Saccharomyces cerevisiae S91 to single phenolic inhibitors and mixed phenolic inhibitors has been significantly improved.

[0043] Example 5: Cellulosic ethanol fermentation using corn stalks 1. Experimental Methods In this embodiment, corn stalks were selected as raw materials and were acid pretreated. The pretreatment conditions were: 4%wt sulfuric acid dosage, pretreatment temperature of 121°C, duration controlled at 30 min, material-liquid ratio (by mass) of 1:2, and 10% (w / w) Ca(OH)2 was used to adjust the pH value of the pretreated material to 5.5. Saccharification was carried out in a 5 L fermenter equipped with a spiral agitator. The solid content after adding the pretreated material was 15% (w / w), the amount of cellulase used in the saccharification stage was 20 FPU / g material, the saccharification temperature was 50°C, the speed was 100 rpm, and the saccharification liquid was obtained after saccharification for 12 h. After measurement, the total phenol content in the saccharified liquid reached 3.2 g / L, including vanillin, syringaldehyde, and 4-hydroxybenzaldehyde.

[0044] After cooling to 30°C, the cultured starting strain and the secondary seed solution of Saccharomyces cerevisiae S91 in Example 2 were inoculated into the saccharification solution at an inoculation rate of 10% (v / v) and a rotation speed of 150 rpm for cellulosic ethanol fermentation. During the fermentation, glucose consumption and ethanol production were measured, and the results were analyzed by dilution coating (dilution 10 -6 ~10 -8 ) Determine CFU, i.e. cell growth status.

[0045] 2. Experimental results like Figure 4 As shown in (a) and (b), during the simultaneous saccharification and fermentation of corn straw with phenolic inhibitors, Saccharomyces cerevisiae S91 exhibited excellent cellulosic ethanol fermentation performance. Compared with the starting strain, the glucose consumption rate, ethanol production rate and cell viability of Saccharomyces cerevisiae S91 within 48 h increased by 65.4%, 63.3% and 1.9 times, respectively, and the fermentation lag phase was shortened by more than 12 h.

[0046] Example 6 Construction of recombinant strains of Saccharomyces cerevisiae and analysis of its tolerance to phenolic inhibitors 1. Experimental Methods (1) Construction of recombinant strains of Saccharomyces cerevisiae In this example, genes related to phenolic inhibitor tolerance in Saccharomyces cerevisiae S91 were screened by combining transcriptomics analysis with bioinformatics analysis, and a gene PST2 with significantly upregulated expression in Saccharomyces cerevisiae S91 was obtained, the nucleotide sequence of which is shown in SEQ ID No.1.

[0047] The PST2 gene fragment was obtained by extracting the yeast genome and amplifying it by PCR; wherein the key gene PST2 shown in the nucleotide sequence SEQ ID No.1 was amplified; the primer PST2-F sequence was shown in SEQ ID No.3; the PST2-R sequence was shown in SEQ ID No.4, and the specific sequence was: PST2-F: CGCGGATCCATGCCAAGAGTAGCTATCATCA; PST2-R: CCCAAGCTTTCAAAACTTTGCAACGGTTTC.

[0048] The amplification conditions were as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 58°C for 10 s, and extension at 72°C for 1 min, for 30 cycles; and post-extension at 72°C for 10 min.

[0049] The PST2 gene fragment was amplified and then ligated with double enzyme digestion. The PST2 fragment was inserted into the BamHI and HindIII sites of the pYX212 vector, and then ligated into the expression vector after enzyme digestion and purification to obtain an expression vector, whose nucleotide sequence is shown in SEQ ID No.2; the expression vector was transformed into Saccharomyces cerevisiae by lithium acetate transformation method; and the recombinant strain carrying pYX212-PST2 was screened on YNB plates (6.7 g / L YNB, 20 g / L glucose, 60 mg / L leucine, 20 mg / L tryptophan, 20 mg / L histidine, 2% agar) using uracil auxotrophic marker.

[0050] (2) Analysis of phenolic inhibitor tolerance of recombinant strains of Saccharomyces cerevisiae In order to analyze the tolerance of the recombinant strain of Saccharomyces cerevisiae to mixed phenolic inhibitors, the cell growth and ethanol production of Saccharomyces cerevisiae pYX212-PST2 under the conditions of 8 mM and 10 mM mixed phenolic inhibitors were compared in this example, and the strain carrying the empty plasmid was used as a control.

[0051] 2. Experimental results The experimental results are as follows Figure 5 As shown by Figure 5As can be seen from (a) and (b), compared with the control strain carrying the empty plasmid pYX212, the overexpression of the PST2 gene significantly enhanced the strain's tolerance to phenolic inhibitors. The cell growth and ethanol production of Saccharomyces cerevisiae pYX212-PST2 increased by 4.2 and 4.5 times, respectively, under 8 mM mixed phenolic inhibitor conditions, and increased by 1.6 and 2.5 times, respectively, under 10 mM mixed phenolic inhibitor conditions.

[0052] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the solution. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents based on the understanding of the present solution without departing from the purpose and scope of the technical solution of the present invention, which should be included in the scope of the claims of the present invention.

Claims

1. A strain of Saccharomyces cerevisiae tolerant to phenolic inhibitors, characterized in that: Saccharomyces cerevisiae ( Saccharomyces cerevisiae )S91, was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on April 8, 2024, with the deposit number CGMCC No.30280.

2. A gene PST2 for tolerance to phenolic inhibitors, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID No.

1.

3. An expression vector pYX212-PST2 of the gene PST2 for tolerance to phenolic inhibitors as claimed in claim 2, characterized in that: The nucleotide sequence of the expression vector pYX212-PST2 is shown in SEQ ID No.

2.

4. A recombinant engineered bacterium, characterized in that: A gene expressing the phenolic aldehyde inhibitor tolerance substance according to claim 2.

5. Use of the phenolic inhibitor-tolerant gene PST2 according to claim 2 or the expression vector pYX212-PST2 according to claim 3 in enhancing the phenolic inhibitor tolerance of strains or in breeding strains tolerant to phenolic inhibitors.

6. Use of the phenolic inhibitor-tolerant Saccharomyces cerevisiae strain of claim 1 or the recombinant engineered bacteria of claim 4 in producing alcohols by fermenting a fermentation substrate containing a phenolic inhibitor.

7. The use according to claim 6, characterized in that: The phenolic inhibitor is at least one of 4-hydroxybenzaldehyde, syringaldehyde and vanillin.

8. The use according to claim 6, characterized in that: In the method of producing alcohols by fermenting a fermentation substrate containing phenolic inhibitors, the fermentation substrate is unenzymatically hydrolyzed lignocellulose or enzymatically hydrolyzed lignocellulose; and the alcohols are ethanol.

9. The use according to claim 6, characterized in that: The steps include: The pretreated lignocellulosic material is hydrolyzed by cellulase, the amount of cellulase is 15-20 FPU / g lignocellulosic material, saccharification is performed for 36-48 hours at a temperature of 45-50°C, and a hydrolyzate is prepared after filtration and sterilization. Finally, the brewer's yeast S91 according to claim 1 or the recombinant engineered bacteria according to claim 5 is inoculated as a strain into the hydrolyzate, and the seed solution concentration of the strain is 1.2×10 8 ~2.5×10 8 CFU / mL; inoculation volume is 5%~10% (v / v), fermentation is carried out at 30~35℃ for 48~72 h; The pretreatment method includes a dilute acid method or an alkali treatment method.

10. The use according to claim 6, characterized in that: The method comprises the following steps: mixing pretreated lignocellulose material, cellulase and expanded bacterial strain, controlling the solid content between 20% and 35% (w / w), using 15 to 20 FPU / g material of cellulase, inoculating 5 to 10% (v / v) of bacterial strain, fermenting at 30 to 35°C for 72 to 96 hours; the bacterial strain is the brewer's yeast S91 described in claim 1 or the recombinant engineered bacteria described in claim 5, and the concentration of the bacterial strain is 1.2×10 8 ~2.5×10 8 CFU / mL; The pretreatment method includes a dilute acid method or an alkali treatment method.

Images