Method for rapidly detecting mycobacteria

Abstract

The invention discloses a method for rapidly detecting mycobacteria. The method comprises the following steps: using a primer pair for detecting the Mycobacterium tuberculosis, wherein the primer pair comprises an upstream primer and a downstream primer; the upstream primer comprises a nucleotide sequence as shown in SEQ ID NO: 1 or 2, and the downstream primer comprises a nucleotide sequence as shown in any one of SEQ ID NO: 3-6. According to the present invention, the RNA of the MTB viable bacteria in the biological sample can be rapidly and accurately detected with high sensitivity, the detection limit is reduced by 1000 times compared with the existing NASBA kit, the template requirement is reduced, and the better choice is provided for the instant detection of MTB.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, and particularly relates to a method for rapidly detecting mycobacteria. Background Art

[0002] Tuberculosis (TB) caused by Mycobacterium tuberculosis (MTB) is a major public health problem that caused 1.3 million deaths worldwide in 2020. Clinical practice has shown that effective diagnosis of TB plays an important role in the prevention and control of TB. Traditional TB diagnostic methods include etiological, immunological methods, and nucleic acid detection. Microbial culture is generally considered the gold standard for the etiological diagnosis of TB. Although it is convenient to detect live Mycobacterium tuberculosis, the culture method may require multiple clinical visits over up to 8 weeks, resulting in delays in TB treatment. The tuberculin skin test and interferon-γ release assay are important adjunctive diagnostic methods for TB, relying on the reaction of MTB antigens or lymphocytes to antigens, respectively. However, the results of these immunological tests may be complicated by the patient's immune status, for example, after vaccination with Bacillus Calmette-Guérin (BCG) or co-infection with human immunodeficiency virus (HIV).

[0003] Recently, the World Health Organization has emphasized nucleic acid amplification tests (NAATs) for TB diagnosis, including the PCR-based Xpert MTB / RIF technology. One drawback of Xpert MTB / RIF testing is that the economic cost of the accompanying components (GeneXpert system) hinders its widespread use in low-income countries or regions, which actually have a high risk of MTB infection. Nucleic acid amplification tests (NAATs) based on isothermal amplification, such as loop-mediated isothermal amplification (LAMP) and nucleic acid sequence-based amplification (NASBA), have been developed to alleviate the need for infrastructure. However, these NAATs have limited ability to distinguish between dead and live MTB.

[0004] To overcome these drawbacks, rapid and low-cost methods have been developed to specifically detect live MTB. These new diagnostic methods include improved propidium monoazide (PMA) treatment, which allows selective PCR amplification of live MTB DNA, fluorescent chemical probes that can be activated in response to MTB proteins, induced expression of specific MTB proteins, and bioaerosol capture technology.

[0005] Recent studies have shown that clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein (Cas) (CRISPR-Cas) can be used as a rapid nucleic acid detection technology. CRISPR diagnostics rely on the collateral activity of Cas nucleases, which can induce the cleavage of single-stranded oligonucleotide reporter molecules to generate fluorescent or immunogenic signals. Some studies have described the detection of MTB DNA based on CRISPR-Cas12. These diagnostic methods can be achieved through fluorescence signals and lateral flow, enabling point-of-care testing (POCT) of MTB. Interestingly, even in the case of co-infection with human immunodeficiency virus (HIV), CRISPR diagnostics can be used to detect cell-free circulating MTB DNA in human serum. In addition, CRISPR-Cas13a has been used to identify drug-resistant mutations in MTB with single-nucleotide precision. Despite the significant progress made in CRISPR-based MTB diagnostics, it remains challenging to distinguish between dead and live MTB. Summary of the Invention

[0006] The technical problem to be solved by the present invention is the defects in the prior art, such as high false negatives in the detection of Mycobacterium tuberculosis (MTB), low sensitivity for pathogenic mycobacteria, and long time consumption. The present invention provides a method for rapid detection of Mycobacterium. The present invention can rapidly, accurately, and with high sensitivity detect MTB RNA in biological samples, distinguish MTB from NTM, specific mycobacteria and non-specific mycobacteria, providing a better option for the point-of-care testing of MTB.

[0007] The present invention describes a CRISPR-Cas13a-based molecular diagnostic method that can specifically detect MTB ssRNA rather than genomic double-stranded DNA as a diagnostic platform. It can rapidly and specifically detect live MTB. This method is referred to as CRISPR-Live-MTB in the present invention and comprises two consecutive reactions: nucleic acid sequence-based amplification (NASBA) and CRISPR-Cas13a collateral cleavage reaction. Experiments show that CRISPR-Live-MTB can effectively detect the single-stranded RNA (ssRNA) of MTB within 2 hours, with higher specificity compared to double-stranded DNA (dsDNA) detection. Importantly, CRISPR-Live-MTB exhibits a limit of detection (LOD) as low as 2.4 copies for MTB ssRNA, which is 1000-fold lower than the method using only NASBA (2,400 copies), significantly reducing the possibility of missed detection. At this time, the template concentration of CRISPR-Live-MTB only needs 0.2 aM, while a single NASBA requires 0.2 fM. CRISPR-Live-MTB greatly improves the accuracy of MTB detection and reduces the risk of false negatives. In addition, CRISPR-Live-MTB introduces lateral flow and can achieve point-of-care testing (POCT) with a sensitivity of 95% and a specificity of 100%. At the same time, the inventors also detected the signal-to-noise ratio of RNA relative to DNA. Thus, it is shown that CRISPR-Live-MTB of the present invention can be used as a method for rapid, sensitive, and specific detection of live MTB.

[0008] The present invention solves the above technical problems through the following technical solutions.

[0009] In the first aspect of the present invention, a primer pair for detecting Mycobacterium tuberculosis is provided, and the primer pair comprises an upstream primer and a downstream primer;

[0010] The upstream primer comprises a nucleotide sequence shown in SEQ ID NO: 1 or 2, and the downstream primer comprises a nucleotide sequence shown in any one of SEQ ID NOs: 3-6.

[0011] In some embodiments of the present invention, the upstream primer and the downstream primer are selected from the following combinations:

[0012] (1) The upstream primer comprises a nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises a nucleotide sequence shown in SEQ ID NO: 6;

[0013] (2) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 4;

[0014] (3) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 4;

[0015] (4) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 6;

[0016] (5) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 3;

[0017] (6) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 5;

[0018] (7) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 5;

[0019] (8) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 3.

[0020] In some embodiments of the present invention, the 5'-end of the upstream primer further comprises a T7 promoter sequence.

[0021] The second aspect of the present invention provides a nucleic acid detection kit for nucleic acid-dependent amplification, and the nucleic acid detection kit comprises the primer pair as described in the first aspect.

[0022] In some embodiments of the present invention, the nucleic acid detection kit further comprises reverse transcriptase, RNase inhibitor, and RNA polymerase.

[0023] In some preferred embodiments of the present invention, the nucleic acid detection kit further comprises an RNA template.

[0024] In some preferred embodiments of the present invention, the RNA polymerase is T7 RNA polymerase.

[0025] The third aspect of the present invention provides a reaction system for nucleic acid-dependent amplification, and the reaction system comprises the primer pair as described in the first aspect.

[0026] In some embodiments of the present invention, the working concentration of the primer pair is 0.05 - 1 μM, preferably 0.25 - 1 μM.

[0027] In some embodiments of the present invention, the reaction system further includes reverse transcriptase, RNase inhibitor, and RNA polymerase.

[0028] The fourth aspect of the present invention provides an amplification method for nucleic acid-dependent amplification, which includes adding an RNA template to the reaction system as described in the third aspect for an amplification reaction.

[0029] In some embodiments of the present invention, the RNA template is a 16S rRNA template.

[0030] In some embodiments of the present invention, the working concentration of the RNA template is at least 0.2 aM.

[0031] In some embodiments of the present invention, the working concentration of the RNA template is 1 to 1000 times lower than the working concentration of the NASBA kit, such as the NECB-24 instruction manual.

[0032] In some embodiments of the present invention, the temperature of the amplification reaction is 41 - 42 °C.

[0033] The fifth aspect of the present invention provides a crRNA for detecting Mycobacterium, which includes a spacer sequence of the nucleotide sequence shown in any one of SEQ ID NO: 9 - 21.

[0034] In some embodiments of the present invention, the spacer sequence is a nucleotide sequence with a length of 28 bp located at the 3' end of the nucleotide sequence shown in any one of SEQ ID NO: 9 - 21.

[0035] In some specific embodiments of the present invention, the crRNA includes a spacer sequence of the nucleotide sequence shown in SEQ ID NO: 15.

[0036] The sixth aspect of the present invention provides a crRNA for detecting Mycobacterium tuberculosis, Mycobacterium gordonae, Mycobacterium abscessus, Mycobacterium fortuitum, Mycobacterium avium, Mycobacterium intracellulare or Mycobacterium kansasii, and the crRNA respectively comprises a spacer sequence having a nucleotide sequence shown in any one of SEQ ID NO: 9-14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 or SEQ ID NO: 21.

[0037] In some embodiments of the present invention, the spacer sequence is a nucleotide sequence with a length of 28 bp located at the 3'-end of the nucleotide sequence.

[0038] The seventh aspect of the present invention provides a CRISPR detection kit, and the CRISPR detection kit comprises the crRNA as described in the fifth aspect or the sixth aspect.

[0039] In some embodiments of the present invention, the CRISPR detection kit further comprises a Cas protein, such as LwaCas13a;

[0040] In some preferred embodiments of the present invention, the CRISPR detection kit further comprises an ssRNA fluorescent probe, and the ssRNA fluorescent probe comprises, for example, a nucleotide sequence shown in SEQ ID NO: 7.

[0041] The eighth aspect of the present invention provides a reaction system for CRISPR detection, and the reaction system comprises the crRNA as described in the fifth aspect or the sixth aspect.

[0042] In some embodiments of the present invention, the working concentration of the crRNA is 0.1-2.5 ng / μL, preferably 0.5-2.5 ng / μL.

[0043] In some embodiments of the present invention, the reaction system further comprises a Cas protein, such as LwaCas13a.

[0044] In some embodiments of the present invention, the working concentration of the Cas protein is 45-50 nM.

[0045] In some embodiments of the present invention, the reaction system further includes an ssRNA fluorescent probe, and the ssRNA fluorescent probe includes, for example, a nucleotide sequence shown in SEQ ID NO:7.

[0046] In some embodiments of the present invention, the working concentration of the ssRNA fluorescent probe is 0.25 - 0.5 μM.

[0047] The ninth aspect of the present invention provides a method for CRISPR detection, which includes the step of adding a sample to be tested into the reaction system as described in the eighth aspect for reaction.

[0048] In some embodiments of the present invention, the temperature of the reaction is 35 - 37 °C.

[0049] In some embodiments of the present invention, the CRISPR detection is for non - diagnostic purposes, such as laboratory detection of environmental samples and plant samples.

[0050] In some embodiments of the present invention, the CRISPR detection is an in vitro detection.

[0051] The tenth aspect of the present invention provides a method for detecting Mycobacterium tuberculosis, which includes the steps of sequentially performing RNA nucleic acid - dependent amplification and Cas13a - based CRISPR detection on a sample to be tested; the RNA nucleic acid - dependent amplification includes using the primer pair as described in the first aspect, the nucleic acid detection kit as described in the second aspect, or the reaction system as described in the third aspect for RNA amplification.

[0052] In some embodiments of the present invention, the CRISPR detection includes using the crRNA as described in the fifth or sixth aspect, the CRISPR detection kit as described in the seventh aspect, or the reaction system as described in the eighth aspect for detection.

[0053] In some embodiments of the present invention, the Mycobacterium tuberculosis is live Mycobacterium tuberculosis.

[0054] In some embodiments of the present invention, the method is for non - diagnostic purposes;

[0055] In some preferred embodiments of the present invention, the reaction temperature of the RNA amplification is 41 - 42 °C.

[0056] In some preferred embodiments of the present invention, a heat activation step is further included before the RNA amplification; the heat activation preferably includes heat activation of nucleic acid and nuclease inhibitor, and the temperature of the heat activation is preferably 65 - 67 °C.

[0057] In some embodiments of the present invention, the reaction temperature for the detection is 35 - 37 °C.

[0058] The eleventh aspect of the present invention provides an application of the primer pair as described in the first aspect, the nucleic acid detection kit as described in the second aspect, the reaction system as described in the third aspect, the crRNA as described in the fifth or sixth aspect, the CRISPR detection kit as described in the seventh aspect, or the reaction system as described in the eighth aspect in detecting Mycobacterium pathogens or in preparing reagents or devices for detecting Mycobacterium pathogens.

[0059] In some embodiments of the present invention, the Mycobacterium pathogens are selected from Mycobacterium tuberculosis, Mycobacterium gordonae, Mycobacterium abscessus, Mycobacterium fortuitum, Mycobacterium avium, Mycobacterium intracellulare, and Mycobacterium kansasii.

[0060] Based on common general knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain various preferred examples of the present invention.

[0061] The reagents and raw materials used in the present invention are all commercially available.

[0062] The positive and progressive effects of the present invention are as follows:

[0063] Compared with the existing NASBA detection, the CRISPR-Live-MTB of the present invention greatly reduces the detection limit. For example, the LOD of the NASBA reaction is 2,400 copies (corresponding to a template concentration of 0.2 fM), and the LOD of CRISPR-Live-MTB (1-hour NASBA + 1-hour CRISPR reaction) is only 2.4 copies (corresponding to a template concentration of 0.2 aM), indicating that CRISPR-Live-MTB can significantly reduce the template concentration, greatly improve the accuracy of MTB detection, and reduce the risk of false negatives.

[0064] In addition, CRISPR-Live-MTB can also achieve point-of-care testing (POCT) with 95% sensitivity and 100% specificity in a short time, effectively monitoring the drug treatment effect and disease progression, and helping patients in developing countries where transportation and face-to-face consultations are inconvenient and lead to interruptions in clinical practice. Description of the Drawings

[0065] Figure 1 Schematic diagram of CRISPR-Live-MTB of the present invention; in the figure: a is the CRISPR-Live-MTB method, designing CRISPR RNA (crRNA) targeting the 16S rRNA gene to detect MTB RNA. Conventional RNA extraction methods can be used as the input of RNA. The signal reading can be a fluorescence signal or a colorimetric strip of a lateral flow test strip. RT is reverse transcription, and T7 is the gray part. b is the traditional culture method.

[0066] Figure 2 Specific detection of MTB RNA by NASBA and NASBA-based CRISPR-Live-MTB methods was compared. a-b are the specificities of detecting MTB RNA and DNA using NASBA: a is CRISPR-Live-MTB; b is the input concentrations of RNA and DNA templates in the above two reactions ranging from 107 to 108 copies. The NASBA method has a continuous reaction for 2 h, and in the CRISPR-Live-MTB method, the NASBA reaction is for 1 h and the CRISPR reaction is for 1 h; c is the LOD determined by the NASBA method (n = 2 biological replicates; mean ± standard deviation); d is the LOD determined by the CRISPR-Live-MTB method (n = 3 technical replicates; mean ± standard deviation). The cut-off value for the positive signal is set higher than the mean ± 3 standard deviations of the blank control group.

[0067] Figure 3 Interspecies reactivity of MTB-specific and universal crRNAs. a is a schematic diagram of detecting mycobacteria using species-specific or universal crRNAs; b is the results of the reaction of MTB-specific crRNA (taking MTB-crRNA5 as an example) and mycobacteria universal crRNA with Cas13a. c is the LOD of detecting mycobacteria determined using universal crRNA and MTB RNA templates. Data from three technical replicates are presented as mean ± standard deviation. The cut-off value for the positive signal is equal to the mean ± 3 standard deviations of the blank control group.

[0068] Figure 4Lateral flow CRISPR-Live-MTB for the detection of MTB and NTM. a is a schematic diagram of the design of lateral flow CRISPR-Live-MTB; b-c are the results of MTB-specific detection using MTB-crRNA5, where b is the image of the lateral flow test strip and c is the quantitative analysis of the strip density of the test strip; d-e are the results of detecting mycobacteria using universal crRNA, where d is the image of the lateral flow test strip and e is the quantitative analysis of the strip density of the test strip; f-g are the LODs of MTB RNA determination using MTB-crRNA5; where f is the image of the lateral flow test strip and g is the quantitative analysis of the strip density of the test strip; h-i are the LODs of detecting MTB RNA using universal crRNA, where h is the image of the lateral flow test strip and i is the quantitative analysis of the strip density of the test strip. Data from three technical replicates are expressed as mean ± standard deviation. The cut-off value for the positive signal was set equal to the mean of the blank control group ± 3 standard deviations.

[0069] Figure 5 Schematic diagram for the detection of live MTB using lateral flow CRISPR-Live-MTB in clinical samples; a is a schematic diagram of CRISPR-Live-MTB without RNA extraction, RT is room temperature, and LFD is lateral flow detection; b are the results of CRISPR-Live-MTB detection using a lateral flow test strip. The control band (C) is shown at the bottom and the test band (T) is shown at the top. Imaging was performed 3 min after adding the sample. c is the quantitative analysis of the strip density in (b). Data from three technical replicates are expressed as mean ± standard deviation. The cut-off value for the positive signal was set equal to the mean of the blank control group ± 3 standard deviations. PPA (positive predictive agreement) is the positive predictive consistency, and NPA (negative predictive agreement) is the negative predictive consistency.

[0070] Figure 6 Schematic diagram of the design of crRNA and NASBA primers for the detection of live MTB; a is the sequence alignment of 16S rRNA from MTB and 6 non-MTB mycobacteria (NTM), and shows the binding sites of NASBA primers and Cas13a crRNA; b is the screening of crRNA for the detection of MTB ssRNA conjugated with NASBA. 1 nM ssRNA template, MTB-NASBA-FWD-1 and MTB-NASBA-REV-2 primers were used; c is the screening of NASBA primer combinations for the detection of MTB ssRNA conjugated with Cas13a cleavage; 1 nM ssRNA template and MTB-crRNA5 were used; in b-c, data from three technical replicates are expressed as mean ± standard deviation. Background fluorescence has been removed for each group.

[0071] Figure 7 Kinetics of NASBA and CRISPR-Live-MTB fluorescence signal output; a-b are LOD determinations of NASBA (a) and CRISPR-Live-MTB (b), corresponding to Figure 2 c-d below. c is the NASBA-coupled Cas13a reaction without RNA amplification; d is the 60-min endpoint fluorescence signal of channel c. Data from three technical replicates are presented as mean ± standard deviation.

[0072] Figure 8 Schematic diagram of species-specific detection of MTB and NTM using the CRISPR-Live-MTB platform; a is a schematic diagram for evaluating species-specific crRNAs; b is the interspecies cross-reactivity evaluation of species-specific crRNAs; synthetic mycobacterial RNA is used as a template; the abbreviations are as follows: M.tb represents M.tuberculosis H37Rv, M.ab represents M.abscessus, M.av represents M.avium, M.fo represents M.fortuitum, M.go represents M.gordonae, M.in represents M.intracellulare, M.ka represents M.kansasii, E.coli represents Escherichia coli, A.ba represents A.baumannii, K.pn represents K.pneumoniae, P.ae represents P.aeruginosa, S.au represents Staphylococcusaureus. Data are shown as mean ± standard deviation (n = 3 technical replicates). Detailed implementation manners

[0073] The present invention will be further illustrated below by way of examples, but the present invention is not limited to the scope of the described examples. For the experimental methods without specific conditions noted in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0074] Example 1

[0075] 1. Materials and methods

[0076] (1) Strains and clinical samples

[0077] Mycobacterium tuberculosis H37Rv (ATCC27294) is preserved in the Second Affiliated Hospital of Fujian Medical University. M.tuberculosis is cultured at 37 °C in Middlebrook 7H9 liquid medium.

[0078] The collected clinical samples do not contain any personal information and the samples are only used for molecular diagnostic purposes.

[0079] (2) Sample processing and RNA preparation

[0080] The samples were processed using the N-acetyl-L-cysteine (NALC)-NaOH method. Approximately 5 mL of sputum was inactivated by thorough mixing with an equal volume of N-acetyl-L-cysteine (NALC)-NaOH solution and left at room temperature for 15 min. The resulting precipitate was rinsed once with sterile 0.9% NaCl solution and resuspended in 1.5 mL of sterile 0.9% NaCl solution. 500 μL of the processed sputum was transferred to a new sterile, nuclease-free 1.5 mL tube. Centrifugation was performed at 10,000 g for 5 min, and the pellet was resuspended in 50 μL of lysis buffer (10 mM sodium citrate, pH 8.0) and vortexed. The bacteria in the resuspended pellet were lysed at room temperature for 15 min using a water bath sonicator (Shanghai Shengyan Ultrasonic Instrument Co., Ltd.) at 300 W, followed by centrifugation at 10,000 g for 5 min. The obtained supernatant was used as a template for subsequent experiments.

[0081] (3) Expression and purification of LwCas13a protein

[0082] Purification of the Cas13a (LwCas13a) protein from Leptotrichia wadei had only minor modifications compared to the method described by Gootenberg JS, Abudayyeh OO, Lee JW, et al. Nucleic acid detection with CRISPR-Cas13a / C2c2 Science. 2017 Apr 28;356(6336):438-442. The codon-optimized LwCas13a coding gene (SEQ ID NO: 23) was cloned into the bacterial expression vector pET28a. A 6×His tag (positions 3478 - 3495 of SEQ ID NO: 23) was added to the N-terminus of LwCas13a, and its expression was controlled by the T7 promoter (SEQ ID NO: 24). The expression vector of LwCas13a was transformed into Escherichia coli BL21(DE3). Fresh colonies were picked and cultured in Luria-Bertani (LB) medium supplemented with 50 μg / mL kanamycin at 37 °C with shaking overnight. The culture (10 mL) was inoculated into 2 L of LB medium containing 50 μg / mL kanamycin and cultured with shaking at 37 °C and 220 rpm. When OD 600When it reached 0.6 - 0.8, isopropyl - D - 1 - thiogalactopyranoside (IPTG) was added to the culture to a final concentration of 0.5 mM. The culture was incubated overnight with shaking at 16 °C to induce protein expression. The cells were harvested by centrifugation at 5,200 g for 15 min at 4 °C and stored at -80 °C.

[0083] For protein purification, the cells were resuspended in lysis buffer (20 mM Tris - HCl, 500 mM NaCl, 1 mM DTT, pH 8.0) and sonicated on ice for 10 min with the following conditions: amplitude 100, 5 s on and 5 s off as one cycle. The obtained debris was removed by centrifugation at 10,000 g for 1 h at 4 °C, and the supernatant was filtered using a Stericup 0.22 μm filter membrane (EMD Millipore). The filtered supernatant was passed through a Ni - NTA column (Qiagen) for affinity purification. Further purification was performed using fast protein liquid chromatography (FPLC) with a Superdex 200 filtration column (GE Healthcare Life Sciences). The purified protein was analyzed by SDS - PAGE and exchanged into storage buffer (50 mM Tris - HCl, pH 7.5, 600 mM NaCl, 5% (v / v) glycerol, 2 mM dithiothreitol (DTT)) and stored at -80 °C.

[0084] (4) NASBA primer design and crRNA preparation

[0085] The 16S rRNA sequences of MTB H37Rv (ATCC27294) and 6 other reference strains were obtained from the NCBI database and aligned using MEGAX to identify conserved regions and variable regions. NASBA primers were designed for the gene - conserved nucleotide regions of 16S rRNA. A T7 promoter sequence was ligated to the 5' end of the NASBA upstream primer. The primer sequences are shown in Table 1 and were synthesized by Genewiz.

[0086] The DNA template for crRNA, including the ligated T7 promoter sequence, was synthesized using Genewiz's primers. The template of crRNA was annealed to form short T7 primers (T7 - 3G), and then crRNA was transcribed overnight at 37 °C using the HiScribe T7 Quick High Yield RNA Synthesis Kit. According to the instructions, crRNA was purified using RNAiso Plus (Takara, 9108). The purified crRNA was stored at -80 °C.

[0087] Primers Used in the Examples in Table 1

[0088]

[0089] The underlined part is the target binding sequence; the capital and bold part is the T7 promoter sequence.

[0090] T7 Promoter Sequence (SEQ ID NO: 24):

[0091] TAATACGACTCACTATAGGG

[0092] (5) RT-PCR

[0093] Reverse transcribe 2 μL of the RNA sample into cDNA using the rimeScript RT reagent Kit (Takara). The PCR primers are shown in Table 1. The 10 μL reaction system contains 0.5 μL of the reverse-transcribed cDNA product, 5 μL of PowerUp SYBR Green MasterMix (Applied Biosystems), 0.5 μL of each upstream primer and downstream primer (the stock solutions are both 10 μM), mix at 4°C and incubate in a QuantStudio 6Flex System thermocycler (Applied Biosystems). The RT-PCR reaction conditions are as follows: 50°C for 2 min, 95°C for 2 min, denaturation at 95°C for 15 s, and 1 min. Collect fluorescence signals at the 60°C annealing / extension step in each cycle.

[0094] (6) RNA-Specific Isothermal Amplification of NASBA

[0095] RNA-specific isothermal amplification was performed according to the instructions using a commercial NASBA kit (NECB-24, Life Sciences). Briefly, each 20 μL reaction system contained 6.7 μL reaction buffer (Life Sciences, NECB-24), 3.3 μL Nucleotide Mix (Life Sciences, NECN-24), 0.5 μL nuclease-free water, 0.4 μL of 12.5 μM NASBA primer, 0.1 μL of Murine RNase inhibitor (Vazyme, R301-01), and 4 μL of RNA (negative control was water). The above components were mixed at 4 °C and incubated at 65 °C for 2 min, then at 41 °C for 10 min. After that, 5 μL of enzyme mix (LifeSciences, NEC-1-24) was added to each reaction system, and the reaction mixture was incubated at 41 °C for 1 to 2 h. Fluorescent NASBA was performed by adding 50 nM RNA probe (shown in Table 1) to the 20 mL reaction system. The 5' end of the RNA probe was labeled with 6-carboxyfluorescein (FAM) phosphoramidite, and the 3' end was labeled with 4-[4-(dimethylamino)phenylazo]benzoic acid N-succinimidyl ester (DABCYL). The fluorescence signal of NASBA was detected by a SpectraMax iD3 Multi-Mode Microplate Reader (Molecular Devices) with an excitation wavelength of 485 nm and an emission wavelength of 520 nm.

[0096] (7) LwCas13a reaction

[0097] The LwCas13a assay was performed as described above. Each 20 μL reaction system contained 50 nM purified LwCas13a, 0.25 μM FAM-BQ1-labeled ssRNA probe (Genescript), 10 ng crRNA (shown in Table 2), 6 mM MgCl 2, 20 mM Tris-HCl, pH 7.4, 0.1 μL murine RNase inhibitor (Vazyme, R301-01) and 3 μL NASBA product. The reactants were incubated at 37 °C for 1 h, and the fluorescence signal was collected by a SpectraMax iD3 Multi-Mode Microplate Reader with an excitation wavelength of 485 nm and an emission wavelength of 520 nm. The fluorescence kinetics was measured every 5 min. For the lateral flow-based detection, a commercially available lateral flow test strip (Milenia HybriDetect 1, TwistDx) was used to perform the reaction according to the instructions. The FAM-BQ1-labeled ssRNA probe was replaced with a FAM-biotin-labeled ssRNA probe, and the final concentration was adjusted to 1 μM in 20 μL of the LwCas13a reaction solution. LwCas13a was reacted at 37 °C for 1 h, and then 20 μL of the product was transferred to 100 μL of Hybridetect assay buffer and spotted onto the lateral flow test strip. The band intensity of the test strip could be directly read with the naked eye or imaged by a camera for further densitometric analysis.

[0098] Table 2 crRNAs used in the examples

[0099]

[0100]

[0101] The underlined part is the spacer sequence.

[0102] The sequence of the LwCas13a construct used in the examples (SEQ ID NO: 22):

[0103]

[0104] The codon-optimized LwCas13a sequence (SEQ ID NO: 23) used in the examples:

[0105]

[0106] 2. Results

[0107] As Figure 1 shown, in the NASBA reaction, MTB rRNA is first reverse transcribed into complementary DNA (cDNA), and then the rRNA in the RNA-DNA dimer is degraded by RNase H. Double-stranded DNA (dsDNA) is synthesized using the cDNA as a template. Through the T7 transcription reaction, the newly synthesized dsDNA generates RNA products. Importantly, during this process, due to the lack of the T7 promoter, MTB genomic DNA no longer serves as a template for RNA production. Therefore, the NASBA reaction of the present invention enables RNA-dependent amplification of MTB. The product of the NASBA reaction is used in the Cas13a reaction to induce collateral cleavage of the ssRNA reporter molecule for subsequent fluorescence analysis or lateral flow analysis.

[0108] As Figure 2 and Figure 6 shown, comparative analysis shows that MTB-crRNA5 produces the strongest fluorescence signal. Unless otherwise specified, the subsequent experiments in the examples are all based on MTB-crRNA5.

[0109] In addition, NASBA amplification plays an important role in the output of the fluorescence signal. The inventors designed two upstream primers, two downstream primers, and their combinations to quantify the amplification efficiency through the fluorescence signal of the reaction between Cas13a and MTB-crRNA5. It was found that the combination of MTB-NASBA-FWD-1 and MTB-NASBA-REV-4 had the highest efficiency.

[0110] The examples compared the sensitivity and specificity of detecting MTB RNA relative to DNA. The reaction time was fixed at 2 h. Among them, the NASBA reaction included a continuous 2-h reaction, and CRISPR-Live-MTB included a 1-h NASBA reaction and a subsequent 1-h CRISPR reaction. The results showed that both NASBA and CRISPR-Live-MTB exhibited higher fluorescence intensities when using ssRNA as a template than when using DNA as a template, and the fluorescence signal intensity of CRISPR-Live-MTB was higher.

[0111] After that, the inventors compared the limit of detection (LOD) of the fluorescent NASBA reaction in CRISPR-Live-MTB. As Figure 7As shown, the results indicate that the LOD of the 2-hour NASBA reaction is 2,400 copies (corresponding to a template concentration of 0.2 fM); the LOD of CRISPR-Live-MTB (1-hour NASBA + 1-hour CRISPR reaction) is only 2.4 copies (corresponding to a template concentration of 0.2 aM), indicating the importance of the CRISPR reaction in CRISPR-Live-MTB.

[0112] As Figure 3 shown, the screening of crRNA indicates that MTB-crRNA5 has higher specificity for MTB compared to NTM and non-mycobacterial bacteria. In addition, as Figure 8 shown, the inventors also designed a genus Mycobacterium universal crRNA based on the conserved genomic sequences of MTB and NTM, which has broad activity against all mycobacteria tested, including MTB and NTM, while retaining specificity for relatively unrelated bacteria. The LOD determination of the universal crRNA when using MTB RNA as the template is 2.4 copies (corresponding to a template concentration of 0.2 aM). The similar single-digit LOD values of MTB-crRNA5 and the genus Mycobacterium universal crRNA indicate that the CRISPR-Live-MTB of the present invention is a highly sensitive diagnostic platform.

[0113] To explore the application of CRISPR-Live-MTB in POCT, a lateral flow-based signal reading method was designed. In this case, the reporter molecule of the fluorescent matrix was replaced by FAM-biotin-labeled ssRNA, enabling the cleavage signal to be displayed on a commercially available lateral flow test strip. As Figure 4 shown, the interaction based on immobilized streptavidin and flow-through biotin shows the control line. In the presence of MTB RNA, ssRNA will be cleaved and free FAM molecules will be released, enabling them to be captured by anti-FAM antibody conjugated to gold nanoparticles, showing the test line.

[0114] The results indicate that the LODs of MTB-crRNA5 and the genus Mycobacterium universal crRNA are consistent with the fluorescence reaction, both being 2.4 copies (corresponding to a template concentration of 0.2 aM). These results demonstrate that the lateral flow CRISPR-Live-MTB for detecting live MTB is rapid, specific, and highly sensitive.

[0115] To detect MTB RNA more rapidly, the inventors attempted to integrate a RNA preparation method without extraction in CRISPR-Live-MTB. Therefore, the above clinical samples were inactivated for 15 min and then sonicated for 15 min by the NALC-NaOH method to release RNA. The obtained RNA samples were subjected to CRISPR-Live-MTB detection, and the results were analyzed by lateral flow test strips and a densitometer.

[0116] As Figure 5 shown, the test results indicate that among 60 samples, 40 samples (S1 - S40) have been confirmed to contain live MTB by culture method, and the other 20 samples (S41 - S60) do not contain live MTB. Using CRISPR-Live-MTB for testing, with the control group using the average threshold of positive signal plus three times the standard deviation (mean + 3SD), 38 out of 40 samples confirmed positive by culture were confirmed to contain live MTB, and the other two were S18 and S39, showing a sensitivity of approximately 95.0%. All 20 negative samples (S41 - S60) were negative by CRISPR-Live-MTB, showing a specificity of 100.0%. Overall, CRISPR-Live-MTB can achieve a positive detection rate of 100.0% and a negative detection rate of 90.9%.

Claims

1. A primer pair for detecting Mycobacterium tuberculosis, characterized in that, the primer pair comprises an upstream primer and a downstream primer; the upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1 or 2, and the downstream primer comprises the nucleotide sequence shown in any one of SEQ ID NO: 3-6.

2. The primer pair according to claim 1, characterized in that, the upstream primer and the downstream primer are selected from the following combinations: (1) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 6; (2) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 4; (3) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 4; (4) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 6; (5) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 3; (6) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 5; (7) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 5; (8) The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 3; Preferably, the 5' end of the upstream primer further includes a T7 promoter sequence.

3. A nucleic acid detection kit for nucleic acid-dependent amplification, characterized in that, the nucleic acid detection kit includes the primer pair according to claim 1 or 2; Preferably, the nucleic acid detection kit further includes reverse transcriptase, RNase inhibitor, and RNA polymerase; More preferably, the RNA polymerase is T7 RNA polymerase; and / or, the nucleic acid detection kit further includes an RNA template.

4. A reaction system for nucleic acid-dependent amplification, characterized in that, the reaction system includes the primer pair according to claim 1 or 2; Preferably: the working concentration of the primer pair is 0.05-1 μM, preferably 0.25-1 μM; and / or, the reaction system further includes reverse transcriptase, RNase inhibitor, and RNA polymerase.

5. An amplification method for nucleic acid-dependent amplification, characterized in that, the amplification method includes adding an RNA template to the reaction system according to claim 4 for an amplification reaction; Preferably, the RNA template is a 16S rRNA template; and / or, the working concentration of the RNA template is at least 0.2 aM, or 1 to 1000 times lower than the working concentration in the NASBA kit, such as the NECB-24 instruction manual; and / or, the temperature of the amplification reaction is 41 - 42 °C.

6. A crRNA for detecting Mycobacterium, characterized in that the crRNA comprises a spacer sequence having a nucleotide sequence shown in any one of SEQ ID NOs: 9 - 21; Preferably, the spacer sequence is a nucleotide sequence with a length of 28 bp located at the 3' end of the nucleotide sequence shown in any one of SEQ ID NOs: 9 - 21; and / or, the crRNA comprises a spacer sequence having a nucleotide sequence shown in SEQ ID NO:

15.

7. A crRNA for detecting Mycobacterium tuberculosis, Mycobacterium gordonae, Mycobacterium abscessus, Mycobacterium fortuitum, Mycobacterium avium, Mycobacterium intracellulare or Mycobacterium kansasii, characterized in that the crRNA respectively comprises a spacer sequence having a nucleotide sequence shown in any one of SEQ ID NOs: 9 - 14, shown in SEQ ID NO: 16, shown in SEQ ID NO: 17, shown in SEQ ID NO: 18, shown in SEQ ID NO: 19, shown in SEQ ID NO: 20 or shown in SEQ ID NO: 21; Preferably, the spacer sequence is a nucleotide sequence with a length of 28 bp located at the 3' end of the nucleotide sequence.

8. A CRISPR detection kit, characterized in that the CRISPR detection kit includes the crRNA as claimed in claim 6 or 7; Preferably, the CRISPR detection kit further includes a Cas protein, such as LwaCas13a; More preferably, the CRISPR detection kit further includes an ssRNA fluorescent probe, and the ssRNA fluorescent probe preferably comprises a nucleotide sequence shown in SEQ ID NO:

7.

9. A reaction system for CRISPR detection, characterized in that the reaction system includes the crRNA as claimed in claim 6 or 7; Preferably, the working concentration of the crRNA is 0.1 - 2.5 ng / μL, preferably 0.5 - 2.5 ng / μL; and / or, the reaction system further comprises a Cas protein, such as LwaCas13a; and / or, the working concentration of the Cas protein is 45 - 50 nM; and / or, the reaction system further comprises an ssRNA fluorescent probe, and the ssRNA fluorescent probe preferably comprises a nucleotide sequence as shown in SEQ ID NO:7; and / or, the working concentration of the ssRNA fluorescent probe is 0.25 - 0.5 μM.

10. A method for CRISPR detection, characterized in that, the method comprises the step of adding a sample to be tested into the reaction system as claimed in claim 9 for reaction; Preferably, the temperature of the reaction is 35 - 37 °C; and / or, the CRISPR detection is for non-diagnostic purposes.

11. A method for detecting Mycobacterium tuberculosis, characterized in that, the method comprises the steps of performing RNA nucleic acid-dependent amplification and Cas13a-based CRISPR detection on the sample to be tested in sequence; the RNA nucleic acid-dependent amplification comprises using the primer pair as claimed in claim 1 or 2, the nucleic acid detection kit as claimed in claim 3, or the reaction system as claimed in claim 4 for RNA amplification; Preferably, the CRISPR detection comprises using the crRNA as claimed in claim 6 or 7, the CRISPR detection kit as claimed in claim 8, or the reaction system as claimed in claim 9 for detection; and / or, the Mycobacterium tuberculosis is live Mycobacterium tuberculosis; and / or, the method is for non-diagnostic purposes; and / or, the method is in vitro; More preferably, the reaction temperature of the RNA amplification is 41 - 42 °C; and / or, a heat activation step is further included before the RNA amplification; the temperature of the heat activation is preferably 65 - 67 °C; and / or, the reaction temperature of the CRISPR detection is 35 - 37 °C.

12. Use of the primer pair as claimed in claim 1 or 2, the nucleic acid detection kit as claimed in claim 3, the reaction system as claimed in claim 4, the crRNA as claimed in claim 6 or 7, the CRISPR detection kit as claimed in claim 8, or the reaction system as claimed in claim 9 in detecting mycobacterial pathogens or in preparing reagents or devices for detecting mycobacterial pathogens; Preferably, the Mycobacterium pathogen is selected from Mycobacterium tuberculosis, Mycobacterium gordonae, Mycobacterium abscessus, Mycobacterium fortuitum, Mycobacterium avium, Mycobacterium intracellulare, and Mycobacterium kansasii.

Images