Streptococcus pneumoniae capsular polysaccharides and conjugates thereof

Abstract

The present invention relates to isolated Streptococcus pneumoniae serotype 15B capsular polysaccharides and methods for their preparation. The invention also relates to immunogenic conjugates comprising Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein, methods for their preparation and immunogenic compositions comprising them.

Description

[0001] This application is a divisional application corresponding to the parent application with the application number CN201580005248.X, the application date of January 15, 2015, and the invention title of "Streptococcus pneumoniae Capsular Polysaccharides and Their Conjugates". Technical Field

[0002] The present invention relates to isolated Streptococcus pneumoniae serotype 15B capsular polysaccharides and methods for their preparation. The present invention also relates to immunogenic conjugates comprising Streptococcus pneumoniae serotype 15B capsular polysaccharides covalently linked to carrier proteins, methods for their preparation, and immunogenic compositions and vaccines comprising them. Background Art

[0003] Streptococcus pneumoniae is a Gram-positive, lancet-shaped coccus that typically occurs in pairs (diplococci), but can also occur in short chains or as single cells. They grow readily on blood agar plates, have glistening colonies and display α-hemolysis, unless cultured anaerobically, in which case they exhibit β-hemolysis. Most pneumococcal serotypes have a capsule, which is a polysaccharide coating around each cell. This capsule is a determinant of virulence in humans as it interferes with phagocytosis by preventing antibodies from attaching to the bacterial cell. Currently, over 90 known pneumococcal capsular serotypes have been identified, with the 23 most common serotypes accounting for approximately 90% of invasive diseases globally. As a vaccine, the pneumococcal polysaccharide coating can confer a reasonable degree of immunity to Streptococcus pneumoniae in individuals with a developed or unimpaired immune system, while capsular polysaccharides conjugated to a suitable carrier protein allow for an immune response in infants and also in the elderly, who are at greatest risk of pneumococcal infection.

[0004] Since the introduction of the first 7-valent pneumococcal conjugate vaccine (PCV7 or Prevnar) in 2000, invasive diseases from those seven serotypes (4, 6B, 9V, 14, 18C, 19F, and 23F) have almost disappeared. The addition of serotypes 1, 3, 5, 6A, 7F, and 19A in Prevnar 13 has further reduced the number of invasive pneumococcal diseases.

[0005] However, the incidence of invasive pneumococcal disease caused by non-vaccine serotypes (such as Streptococcus pneumoniae serotypes 15A, 15B, and 15C) has recently increased (see, for example, Beall B. et al., Journal of Clinical Microbiology. 44(3):999-1017, 2006, or Jacobs et al., Clin Infect Dis. (2008) 47(11):1388-1395). None of the currently available pneumococcal vaccines provide adequate protection against S. pneumoniae serotype 15B in humans, and particularly in children less than 2 years of age. Accordingly, there is a need for an immunogenic composition that can be used to induce an immune response against S. pneumoniae serotype 15B. It would be an additional benefit if such an immunogenic composition could also be used to protect a subject against S. pneumoniae serotype 15C and / or 15A. SUMMARY OF THE INVENTION

[0006] In one aspect, the present disclosure provides an isolated S. pneumoniae serotype 15B capsular polysaccharide having a molecular weight of 5 kDa - 500 kDa.

[0007] In a further aspect, the present disclosure provides an isolated S. pneumoniae serotype 15B capsular polysaccharide that contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM, preferably at least 0.6 mM acetate per mM of the S. pneumoniae serotype 15B capsular polysaccharide.

[0008] In a further aspect, the present disclosure provides an isolated S. pneumoniae serotype 15B capsular polysaccharide that contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM, preferably at least 0.6 mM glycerol per mM of the S. pneumoniae serotype 15B capsular polysaccharide.

[0009] In a further aspect, the present disclosure provides an immunogenic conjugate that comprises an isolated S. pneumoniae serotype 15B capsular polysaccharide as disclosed herein covalently linked to a carrier protein. In one aspect, the carrier protein is CRM 197 .

[0010] In a further aspect, the present disclosure provides an immunogenic composition that comprises an immunogenic conjugate as disclosed herein and a physiologically acceptable vehicle. In one aspect, the immunogenic composition further comprises at least one additional antigen. In one aspect, the immunogenic composition further comprises an adjuvant.

[0011] In a further aspect, the present disclosure provides a vaccine that comprises an immunogenic composition as disclosed herein.

[0012] In a further aspect, the present disclosure provides a method for producing the isolated serotype 15B polysaccharide as disclosed herein, the method comprising the steps of:

[0013] (a) preparing a fermentation culture of Streptococcus pneumoniae serotype 15B bacterial cells;

[0014] (b) lysing the bacterial cells in the fermentation culture;

[0015] (c) purifying the Streptococcus pneumoniae serotype 15B capsular polysaccharide from the fermentation culture; and,

[0016] (d) sizing the purified Streptococcus pneumoniae serotype 15B capsular polysaccharide by high pressure homogenization.

[0017] In a further aspect, the present disclosure provides a method for producing an activated Streptococcus pneumoniae serotype 15B capsular polysaccharide, the method comprising the step of reacting the isolated Streptococcus pneumoniae serotype 15B capsular polysaccharide as disclosed herein with an oxidizing agent. In one aspect, the present disclosure provides an activated serotype 15B capsular polysaccharide obtainable or obtained by the above method.

[0018] In a further aspect, the present disclosure provides a method for preparing an immunogenic conjugate comprising a Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein, the method comprising the steps of:

[0019] (a) mixing the activated polysaccharide as disclosed herein with the carrier protein;

[0020] (b) reacting the mixed activated polysaccharide and carrier protein with a reducing agent to form a serotype 15B capsular polysaccharide-carrier protein conjugate. In one aspect, the present disclosure provides an immunogenic conjugate obtainable or obtained by the above method.

[0021] In a further aspect, the present disclosure provides a method of protecting a subject from infection with Streptococcus pneumoniae serotype 15B, the method comprising administering to the subject an immunogenic amount of the immunogenic composition or vaccine as disclosed herein.

[0022] In a further aspect, the present disclosure provides a method of treating or preventing Streptococcus pneumoniae infection, disease or condition associated with Streptococcus pneumoniae serotype 15A, 15B and / or 15C in a subject, the method comprising the step of administering a therapeutically or prophylactically effective amount of the immunogenic composition or vaccine as disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 — Structure of the repeating unit of pneumococcal capsular polysaccharide serotype 15B. DETAILED DESCRIPTION

[0024] The present invention can be more easily understood by referring to the following detailed description of the preferred embodiments of the present invention and the examples included herein. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, certain preferred methods and materials are still described herein. Certain terms may be used according to the following definitions in the description of the embodiments and the claiming of the present invention.

[0025] Definitions

[0026] As used herein, the "molecular weight" of a polysaccharide or polypeptide-carrier protein conjugate refers to the molecular weight calculated by size exclusion chromatography (SEC) in combination with a multi-angle laser scattering detector (MALLS).

[0027] As used herein, the term "free polysaccharide" refers to serotype 15B capsular polysaccharide that is not covalently conjugated to a carrier protein but is present in a serotype 15B capsular polysaccharide-carrier protein conjugate composition. The free polysaccharide can non-covalently link (i.e., non-covalently bind, adsorb, or be entrapped in or entrapping) the polysaccharide carrier protein conjugate.

[0028] The percentage of free polysaccharide is measured after the final purification of the serotype 15B capsular polysaccharide-carrier protein conjugate. Preferably, it is measured within 4 weeks after the final purification. It is expressed as a percentage of the total polysaccharide in the sample.

[0029] As used herein, the term "serotype 15B polysaccharide" or "serotype 15B capsular polysaccharide" refers to the capsular polysaccharide of Streptococcus pneumoniae serotype 15B.

[0030] As used herein, the term "serotype 15B glycoconjugate" or "serotype 15B conjugate" refers to an isolated serotype 15B polysaccharide covalently conjugated to a carrier protein.

[0031] As used herein, the term "degree of oxidation" (DO) refers to the number of sugar repeating units per aldehyde group generated when an isolated polysaccharide is activated with an oxidizing agent. The degree of oxidation of a polysaccharide can be determined using conventional methods known to those skilled in the art.

[0032] As used herein, the term "subject" refers to a mammal, including a human, or to a bird, fish, reptile, amphibian, or any other animal. The term "subject" also includes a household pet or a research animal. Non-limiting examples of household pets and research animals include: dogs, cats, pigs, rabbits, rats, mice, gerbils, hamsters, guinea pigs, ferrets, monkeys, birds, snakes, lizards, fish, turtles, and frogs. The term "subject" also includes livestock animals. Non-limiting examples of livestock animals include: alpacas, bison, camels, cows, deer, pigs, horses, llamas, mules, donkeys, sheep, goats, rabbits, reindeer, yaks, chickens, geese, and turkeys.

[0033] Isolated serotype 15B capsular polysaccharide

[0034] As shown in Figure 1 the polysaccharide repeating unit of serotype 15B consists of a branched trisaccharide backbone (one N-acetylglucosamine (Glc p NAc), one galactopyranose (Gal p ), and one glucopyranose (Glc p )) with an αGal p -βGal p disaccharide branch attached to the C4 hydroxyl of Glc p NAc. Phosphoglycerol is attached to the C3 hydroxyl of the βGal p residue in the disaccharide branch. The serotype 15B capsular polysaccharide is O-acetylated and the total amount of O-acetylation is about 0.8 to 0.9 O-acetyl groups per polysaccharide repeating unit (see, for example, C. Jones et al., Carbohydrate Research, 340 (2005) 403-409). The capsular polysaccharide from serotype 15C has the same backbone structure as serotype 15B but lacks O-acetylation.

[0035] The isolated serotype 15B polysaccharide of the present invention can be obtained by a method comprising the following steps:

[0036] (a) Preparing a fermentation culture of serotype 15B Streptococcus pneumoniae bacterial cells;

[0037] (b) Lysing the bacterial cells in the fermentation culture;

[0038] (c) Purifying the serotype 15B polysaccharide from the fermentation culture; and,

[0039] (d) Tailoring the purified serotype 15B polysaccharide by high pressure homogenization.

[0040] Serotype 15B polysaccharides can be obtained directly from bacteria using isolation methods known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 20060228380, 20060228381, 20070184071, 20070184072, 20070231340, and 20080102498 or WO2008118752). Additionally, they can be produced using synthetic schemes.

[0041] Serotype 15B Streptococcus pneumoniae strains can be obtained from established culture collections (such as, for example, the ATCC deposit strain No ATCC10354 or strains available from the Streptococcal Reference Laboratory of the Center for Disease Control and Prevention, Atlanta, GA) or clinical samples.

[0042] Bacterial cells are preferably grown in a soy-based medium. After fermentation of the bacterial cells producing Streptococcus pneumoniae serotype 15B, the bacterial cells are lysed to produce a cell lysate. The bacterial cells can be lysed using any lysis agent. A "lysis agent" is a reagent that aids in the rupture of the cell wall and the release of autolysins that cause cell lysis, including, for example, detergents. As used herein, the term "detergent" refers to any anionic or cationic detergent capable of inducing lysis of bacterial cells. Representative examples of such detergents for use in the methods of the present invention include sodium deoxycholate (DOC), N-lauroylsarcosine, sodium chenodeoxycholate, and saponins.

[0043] In one embodiment of the present invention, the lysis agent used to lyse the bacterial cells is DOC. DOC is the sodium salt of the bile acid deoxycholic acid, which is typically derived from biological sources such as cows or bulls. DOC activates the LytA protein, which is an autolysin involved in the growth and division of the Streptococcus pneumoniae cell wall. The LytA protein has a choline-binding domain in its C-terminal portion, and mutations in the lytA gene are known to produce LytA mutants that are resistant to DOC lysis.

[0044] In one embodiment of the present invention, the lysis agent for lysing bacterial cells is a lysis agent of non-animal origin. The lysis agents of non-animal origin for use in the methods of the present invention include reagents of non-animal origin having a mode of action similar to that of DOC (i.e., the mode of action is to affect LytA function and cause lysis of Streptococcus pneumoniae cells). Such lysis agents of non-animal origin include, but are not limited to, analogs of DOC, surfactants, detergents, and choline structure analogs. In one embodiment, the lysis agent of non-animal origin is selected from decanesulfonic acid, tert-octylphenoxypoly(oxyethylene)ethanol (e.g., CA-630, CAS#: 9002-93-1, available from Sigma Aldrich, St. Louis, MO), octylphenol ethoxylate condensate (e.g., Triton X-100, available from Sigma Aldrich, St. Louis, MO), N-lauroylsarcosine, sodium N-lauroylsarcosine, lauryldiiminodipropionic acid, sodium dodecyl sulfate, chenodeoxycholate, hyodeoxycholate, glycodeoxycholate, taurodeoxycholate, taurochenodeoxycholate, and cholate. In another embodiment, the lysis agent of non-animal origin is N-lauroylsarcosine. In another embodiment, the lysis agent is sodium N-lauroylsarcosine.

[0045] The serotype 15B polysaccharide can then be isolated from the cell lysate using purification techniques known in the art, including centrifugation, depth filtration, precipitation, ultrafiltration, activated carbon treatment, diafiltration, and / or column chromatography (see, for example, U.S. Patent Application Publication Nos. 20060228380, 20060228381, 20070184071, 20070184072, 20070231340, and 20080102498 or WO2008118752). The purified serotype 15B capsular polysaccharide can then be used for the preparation of immunogenic conjugates.

[0046] Preferably, in order to generate conjugates with favorable filtration characteristics and / or yields, the polysaccharide is trimmed to a low molecular weight (MW) range prior to conjugation to a carrier protein. Advantageously, the size of the purified serotype 15B polysaccharide is reduced while retaining key features of the polysaccharide structure, such as the presence of O-acetyl groups, for example. Preferably, the size of the purified serotype 15B polysaccharide is reduced by mechanical homogenization.

[0047] In a preferred embodiment, the size of the purified serotype 15B polysaccharide is reduced by high-pressure homogenization. High-pressure homogenization achieves high shear rates by pumping the process stream through a flow path of a sufficiently small size. The shear rate is increased by using a greater applied homogenization pressure and the exposure time can be increased by recycling the feed stream through the homogenizer.

[0048] The high-pressure homogenization method is particularly suitable for reducing the size of purified serotype 15B polysaccharide while retaining the structural features of the polysaccharide, such as the presence of O-acetyl groups.

[0049] The isolated serotype 15B capsular polysaccharide obtained by purifying serotype 15B polysaccharide from pneumococcal lysates and optionally tailoring the purified polysaccharide can be characterized by different parameters, including for example molecular weight, mM of glycerol per mM of said serotype 15B capsular polysaccharide, mM of acetate per mM of said serotype 15B capsular polysaccharide.

[0050] The degree of O-acetylation of the polysaccharide can be determined by any method known in the art, for example by proton NMR (see for example Lemercinier and Jones (1996) Carbohydrate Research 296; 83-96, Jones and Lemercinier (2002) J. Pharmaceutical and Biomedical Analysis 30; 1233-1247, WO 05 / 033148 or WO00 / 56357). Another commonly used method is described in Hestrin (1949) J. Biol. Chem. 180; 249-261. Preferably, the presence of O-acetyl groups is determined by ion HPLC analysis.

[0051] The presence of O-acetyl groups in the purified, isolated or activated serotype 15B capsular polysaccharide or in the serotype 15B polysaccharide-carrier protein conjugate is expressed as the mM number of acetate per mM of said polysaccharide or as the number of O-acetyl groups per polysaccharide repeating unit.

[0052] The presence of glycerophosphate side chains can be determined by measuring glycerol using high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) after releasing it by treating the polysaccharide with hydrofluoric acid (HF). The presence of glycerol in the purified, isolated or activated serotype 15B capsular polysaccharide or in the serotype 15B polysaccharide-carrier protein conjugate is expressed as the mM number of glycerol per mM of serotype 15B polysaccharide.

[0053] The isolated serotype 15B capsular polysaccharide can also be synthetically produced using methods known to those skilled in the art.

[0054] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 5-500 kDa, 50-500 kDa, 50-450 kDa, 100-400 kDa, 100-350 kDa. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100-350 kDa. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100-300 kDa. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150-300 kDa.

[0055] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM acetate per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.5, 0.6, or 0.7 mM acetate per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.7 mM acetate per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0056] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.5, 0.6, or 0.7 mM glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.7 mM glycerol per mM of the serotype 15B capsular polysaccharide.

[0057] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100-350 kDa, preferably 150-350 kDa, and contains at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide.

[0058] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100-350 kDa, preferably 150-350 kDa, and contains at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide.

[0059] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide.

[0060] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 - 350 kDa, preferably 150 - 350 kDa, and comprises at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide.

[0061] Serotype 15B capsular polysaccharide - carrier protein conjugate

[0062] The isolated serotype 15B capsular polysaccharide can be conjugated to a carrier protein to obtain an immunogenic conjugate. The isolated polysaccharide can be conjugated to a carrier protein by methods known to those skilled in the art (see, for example, U.S. Patent Application Publication Nos. 20060228380, 20070184071, 20070184072, 20070231340 or WO2011 / 100151).

[0063] In one embodiment, the polysaccharide can be activated with 1 - cyano - 4 - dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be directly coupled to the amino group on the carrier protein or coupled through a spacer (linker) group. For example, the spacer can be cystamine or cysteamine to provide a thiolated polysaccharide, which can be coupled to the carrier through a thioether bond obtained after reaction with a maleimide - activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide or N - succinimidyl bromoacetate or SIAB, or SIA, or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemical reaction) is coupled to hexamethylenediamine or adipic dihydrazide (ADH), and the amino - derivatized sugar is coupled to the carrier protein through the carboxyl group on the protein carrier using a carbodiimide (e.g., EDAC or EDC) chemical reaction. Such conjugates are described, for example, in WO93 / 15760, WO 95 / 08348 and WO 96129094.

[0064] Other suitable techniques use carbodiimide, hydrazide, active ester, norbornane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO98 / 42721. The conjugation may involve a carbonyl linker which can be formed by reacting the free hydroxyl groups of the sugar with CDI (see Bethell et al., 1979, 1. Biol. Chem. 254:2572-4; Hearn et al., 1981, J. Chromatogr. 218:509-18), and then reacting with the protein to form a carbamate bond. This may involve reducing the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate with the protein amino group.

[0065] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide is conjugated to a carrier protein by reductive amination. Reductive amination involves conjugating the oxidized activated polysaccharide and the activated polysaccharide to the protein carrier by reduction.

[0066] Activation of serotype 15B capsular polysaccharide

[0067] The activated serotype 15B capsular polysaccharide is obtained by reacting the isolated serotype 15B capsular polysaccharide with an oxidizing agent. For example, the activated serotype 15B capsular polysaccharide can be obtained by a method comprising the following steps:

[0068] (a) Preparing a fermentation culture of Streptococcus pneumoniae bacteria of serotype 15B;

[0069] (b) Lysing the bacterial cells in the fermentation culture;

[0070] (c) Purifying the serotype 15B polysaccharide from the fermentation culture;

[0071] (d) Tailoring the purified serotype 15B polysaccharide by high pressure homogenization.

[0072] (e) Reacting the tailored serotype 15B polysaccharide with an oxidizing agent.

[0073] In a preferred embodiment, the concentration of the isolated serotype 15B capsular polysaccharide reacting with the oxidizing agent is 0.1-10 mg / mL, 0.5-5 mg / mL, 1-3 mg / mL, or about 2 mg / mL.

[0074] In a preferred embodiment, the oxidizing agent is periodate. Periodate oxidizes vicinal hydroxyl groups to form carbonyl or aldehyde groups and causes cleavage of the C-C bond. The term 'periodate' includes both periodate and periodic acid. The term also includes metaperiodate (IO 4- ) also includes metaperiodate (IO 6 5- ). The term 'periodate' also includes various salts of periodate, including sodium periodate and potassium periodate. In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate used for oxidizing serotype 15B capsular polysaccharide is metaperiodate. In a preferred embodiment, the periodate used for oxidizing serotype 15B capsular polysaccharide is sodium metaperiodate.

[0075] In a preferred embodiment, the polysaccharide reacts with 0.01 - 10, 0.05 - 5, 0.1 - 1, 0.5 - 1, 0.7 - 0.8, 0.05 - 0.5, 0.1 - 0.3 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide reacts with about 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide reacts with about 0.15 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide reacts with about 0.25 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide reacts with about 0.5 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide reacts with about 0.6 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide reacts with about 0.7 molar equivalents of the oxidizing agent.

[0076] In a preferred embodiment, the duration of the reaction is 1 - 50, 10 - 30, 15 - 20, 15 - 17 hours or about 16 hours.

[0077] In a preferred embodiment, the temperature of the reaction is maintained at 15 - 45°C, 15 - 30°C, 20 - 25°C. In a preferred embodiment, the temperature of the reaction is maintained at about 23°C.

[0078] In a preferred embodiment, the oxidation reaction is carried out in a buffer selected from sodium phosphate, potassium phosphate, 2-(N-morpholino)ethanesulfonic acid (MES) or Bis-Tris. In a preferred embodiment, the buffer is potassium phosphate.

[0079] In a preferred embodiment, the buffer has a concentration of 1 - 500 mM, 1 - 300 mM, 50 - 200 mM. In a preferred embodiment, the buffer has a concentration of about 100 mM. In a preferred embodiment, the oxidation reaction is carried out at a pH of 4 - 8, 5 - 7, 5.5 and 6.5. In a preferred embodiment, the pH is about 6.

[0080] In a preferred embodiment, the activated serotype 15B capsular polysaccharide is obtained by reacting 0.5 - 5 mg / mL of the isolated serotype 15B capsular polysaccharide with 0.2 - 0.3 molar equivalents of periodate at a temperature of 20 - 25 °C.

[0081] In a preferred embodiment, the activated serotype 15B capsular polysaccharide is purified. The activated serotype 15B capsular polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / diafiltration. For example, the activated capsular polysaccharide is concentrated and diafiltered using an ultrafiltration device.

[0082] In a preferred embodiment, the present invention relates to an activated serotype 15B capsular polysaccharide obtainable or obtained by the methods disclosed above.

[0083] In a preferred embodiment, the degree of oxidation of the activated serotype 15B capsular polysaccharide is 2 - 20, 2 - 15, 2 - 10, 2 - 5, 5 - 20, 5 - 15, 5 - 10, 10 - 20, 10 - 15, 15 - 20. In a preferred embodiment, the degree of oxidation of the activated serotype 15B capsular polysaccharide is 2 - 10, 4 - 8, 4 - 6, 6 - 8, 6 - 12, 8 - 12, 9 - 11, 10 - 16, 12 - 16, 14 - 18, 16 - 20, 16 - 18 or 18 - 20.

[0084] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 5 - 500 kDa, 50 - 500 kDa, 50 - 450 kDa, 100 - 400 kDa, 100 - 350 kDa. In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 - 350 kDa. In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 - 300 kDa. In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 150 - 300 kDa. In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 - 250 kDa.

[0085] In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.5, 0.6, or 0.7 mM acetate per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.7 mM acetate per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0086] In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.5, 0.6, or 0.7 mM glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.7 mM glycerol per mM of the serotype 15B capsular polysaccharide.

[0087] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100-250 kDa and contains at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide.

[0088] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100-250 kDa and contains at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide.

[0089] In a preferred embodiment, the activated serotype 15B capsular polysaccharide contains at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide.

[0090] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100-250 kDa and contains at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide.

[0091] In an embodiment, the activated serotype 15B capsular polysaccharide is lyophilized, optionally in the presence of a cryoprotectant / lyoprotectant. In an embodiment, the cryoprotectant / lyoprotectant is a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinose. In a preferred embodiment, the sugar is sucrose. The lyophilized activated capsular polysaccharide can then be mixed with a solution containing a carrier protein.

[0092] In another embodiment, the activated serotype 15B capsular polysaccharide is mixed with a carrier protein and lyophilized, optionally in the presence of a cryoprotectant / lyoprotectant. In an embodiment, the cryoprotectant / lyoprotectant is a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinose. In a preferred embodiment, the sugar is sucrose. The co-lyophilized polysaccharide and carrier protein can then be resuspended in a solution and reacted with a reducing agent.

[0093] In an embodiment, the invention relates to a lyophilized activated serotype 15B capsular polysaccharide.

[0094] In an embodiment, the invention relates to a co-lyophilized activated serotype 15B capsular polysaccharide and a protein carrier. In a preferred embodiment, the protein carrier is CRM 197 。

[0095] Conjugation of activated serotype 15B capsular polysaccharide and carrier protein

[0096] The activated serotype 15B capsular polysaccharide can be conjugated to a carrier protein by a method comprising the following steps:

[0097] (a) Mixing the activated serotype 15B capsular polysaccharide and the carrier protein, and,

[0098] (b) Reacting the mixed activated serotype 15B capsular polysaccharide and carrier protein with a reducing agent to form a serotype 15B capsular polysaccharide-carrier protein conjugate.

[0099] Conjugation of the activated serotype 15B capsular polysaccharide and the protein carrier by reductive amination in dimethyl sulfoxide (DMSO) is suitable for maintaining the O-acetyl content of the polysaccharide as compared to, for example, reductive amination in an aqueous solution where the O-acetylation level of the polysaccharide is significantly reduced. In a preferred embodiment, steps (a) and (b) are carried out in DMSO.

[0100] In a preferred embodiment, step (a) comprises dissolving the lyophilized serotype 15B capsular polysaccharide in a solution comprising a carrier protein and DMSO. In a preferred embodiment, step (a) comprises dissolving the co-lyophilized serotype 15B capsular polysaccharide and carrier protein in DMSO.

[0101] When steps (a) and (b) are carried out in an aqueous solution, steps (a) and (b) are carried out in a buffer at a pH of 6.0 - 8.5, 7 - 8 or 7 - 7.5, and the buffer is preferably selected from PBS, MES, HEPES, Bis-Tris, ADA, PIPES, MOPSO, BES, MOPS, DIPSO, MOBS, HEPPSO, POPSO, TEA, EPPS, Bicine or HEPB. In a preferred embodiment, the buffer is PBS. In a preferred embodiment, the pH is about 7.3.

[0102] In a preferred embodiment, the concentration of the activated serotype 15B capsular polysaccharide in step (b) is 0.1 - 10 mg / mL, 0.5 - 5 mg / mL, 0.5 - 2 mg / mL. In a preferred embodiment, the concentration of the activated serotype 15B capsular polysaccharide in step (b) is 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 or 3 mg / mL.

[0103] In a preferred embodiment, the initial input ratio (weight ratio) of the activated serotype 15B capsular polysaccharide to the carrier protein is 5:1 - 0.1:1, 2:1 - 0.1:1, 2:1 - 1:1, 1.5:1 - 1:1, 0.1:1 - 1:1, 0.3:1 - 1:1, 0.6:1 - 1:1.

[0104] In a preferred embodiment, the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is about 0.6:1 - 1.5:1, preferably 0.6:1 - 1:1. Such an initial input ratio is particularly suitable for obtaining a low level of free polysaccharide in the immunogenic conjugate.

[0105] In a preferred embodiment, the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1 or 2:1.

[0106] In an embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride or zinc borohydride in the presence of a Bronsted or Lewis acid, an amine borane (such as pyridine borane, 2-methylpyridine borane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMe i PrN-BH 3 , benzylamine-BH 3 or 5-ethyl-2-methylpyridine borane (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride. In a preferred embodiment, the reducing agent is sodium 2-methylpyridine borane.

[0107] In a preferred embodiment, the amount of reducing agent used in step (b) is about 0.1-10 molar equivalents, 0.5-5 molar equivalents, 1-2 molar equivalents. In a preferred embodiment, the amount of reducing agent used in step (b) is about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 molar equivalents.

[0108] In a preferred embodiment, the duration of step (b) is 1-60 hours, 10-50 hours, 40-50 hours, 42-46 hours. In a preferred embodiment, the duration of step (b) is about 44 hours.

[0109] In a preferred embodiment, the temperature of the reaction in step (b) is maintained at 10-40 °C, 15-30 °C or 20-26 °C. In a preferred embodiment, the temperature of the reaction in step (b) is maintained at about 23 °C.

[0110] In a preferred embodiment, the method for preparing an immunogenic conjugate comprising a Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein further comprises a step of capping (quenching) unreacted aldehydes by adding NaBH 4 (step (c)).

[0111] In a preferred embodiment, the amount of NaBH 4 used in step (c) is about 0.1-10 molar equivalents, 0.5-5 molar equivalents, 1-3 molar equivalents. In a preferred embodiment, the amount of NaBH 4 used in step (c) is about 2 molar equivalents.

[0112] In a preferred embodiment, the duration of step (c) is 0.1-10 hours, 0.5-5 hours, 2-4 hours. In a preferred embodiment, the duration of step (c) is about 3 hours.

[0113] In a preferred embodiment, the temperature of the reaction in step (c) is maintained at 15 - 45 °C, 15 - 30 °C, or 20 - 26 °C. In a preferred embodiment, the temperature of the reaction in step (c) is maintained at about 23 °C.

[0114] In a preferred embodiment, the yield of the conjugation step (step b) is greater than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%. In a preferred embodiment, the yield of the conjugation step (step b) is greater than 60%. In a preferred embodiment, the yield of the conjugation step (step b) is greater than 70%. The yield is the amount of serotype 15B polysaccharide in the conjugate × 100 / the amount of activated polysaccharide used in the conjugation step.

[0115] In a preferred embodiment, a method for preparing an immunogenic conjugate comprising Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein comprises the following steps:

[0116] (a) Preparing a fermentation culture of Streptococcus pneumoniae serotype 15B bacterial cells;

[0117] (b) Lysing the bacterial cells in the fermentation culture;

[0118] (c) Purifying serotype 15B polysaccharide from the fermentation culture;

[0119] (d) Tailoring the purified serotype 15B polysaccharide by high-pressure homogenization;

[0120] (e) Reacting the tailored serotype 15B polysaccharide with an oxidizing agent;

[0121] (f) Mixing the activated serotype 15B polysaccharide and a carrier protein, and,

[0122] (g) Reacting the mixed activated serotype 15B polysaccharide and carrier protein with a reducing agent to form a serotype 15B polysaccharide - carrier protein conjugate; and,

[0123] (h) Capping (quenching) unreacted aldehydes by adding NaBH 4

[0124] In a preferred embodiment, the yield of the conjugation step (step g) of the above method is greater than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%. In a preferred embodiment, the yield of the conjugation step (step g) is greater than 60%. In a preferred embodiment, the yield of the conjugation step (step g) is greater than 70%. The yield is (the amount of serotype 15B polysaccharide in the conjugate × 100) / the amount of activated polysaccharide used in the conjugation step.

[0125] ​After the serotype 15B capsular polysaccharide is conjugated to a carrier protein, the polysaccharide-protein conjugate can be purified (to enrich the amount of the polysaccharide-protein conjugate) by various techniques known to those skilled in the art. These techniques include dialysis, concentration / diafiltration operations, tangential flow filtration, precipitation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.

[0126] In a preferred embodiment, the carrier protein is non-toxic and non-reactive and can be obtained in sufficient quantity and purity. The carrier protein should be suitable for standard conjugation procedures.

[0127] In a preferred embodiment, the activated serotype 15B capsular polysaccharide is conjugated to a carrier protein selected from the following: DT (diphtheria toxin); TT (tetanus toxoid) or fragment C of TT; CRM 197(Non-toxic but antigenically identical variants of diphtheria toxin); other DT point mutants such as CRM176, CRM228, CRM45 (Uchida et al. J. Biol. Chem. 218; 3838-3844, 1973), CRM 9, CRM102, CRM 103 and CRM107 and other mutations described by Nicholls and Youle in Genetically Engineered Toxins, Ed: Frankel, Maecel Dekker Inc, 1992, Glu-148 deletion or to Asp, Gln or Ser and / or Ala 158 to Gly mutations and other mutations described in US 4709017 or US 4950740, mutations of at least one or more residues Lys 516, Lys526, Phe 530 and / or Lys 534 and other mutations disclosed in US 5917017 or US6455673, or fragments disclosed in US 5843711; pneumolysin of Streptococcus pneumoniae (Kuo et al. (1995) Infect Immun 63; 2706-13) including ply detoxified in some way such as dPLY-GMBS (WO04081515, PCT / EP2005 / 010258) or dPLY-formol, PhtX, including PhtA, PhtB, PhtD or PhtE (sequences of PhtA, PhtB, PhtD or PhtE are disclosed in WO 00 / 37105 or WO 00 / 39299) and fusion proteins of Pht proteins such as PhtDE fusion protein, PhtBE fusion protein, Pht A-E (WO 01 / 98334, WO 03 / 54007, W02009 / 000826); OMPC (meningococcal outer membrane protein - usually extracted from Neisseria meningitidis serogroup B - EP0372501); PorB (from Neisseria meningitidis); PD (Haemophilus influenzae protein D - see for example, EP 0 594 610 B), or immunofunctional equivalents thereof; synthetic peptides (EP0378881, EP0427347); heat shock proteins (WO93 / 17712, WO 94 / 03208); pertussis proteins (WO98 / 58668, EP0471 177); cytokines; lymphokines; growth factors or hormones (WO10 91 / 01146); artificial proteins containing multiple human CD4+ T cell epitopes from various pathogen sources (Falugi et al. (2001) Eur J Immunol 31; 3816-3824), such as N19 protein (Baraldoi et al. (2004) Infect Immun 72; 4884-7);Pneumococcal surface protein PspA (WO 02 / 091998); iron uptake protein (WO 01 / 72337); toxin A or B of Clostridium difficile (WO 00 / 61761). In an embodiment, the activated serotype 15B capsular polysaccharide is conjugated to DT (diphtheria toxoid). In another embodiment, the activated serotype 15B capsular polysaccharide is conjugated to TT (tetanus toxoid). In another embodiment, the activated serotype 15B capsular polysaccharide is conjugated to fragment C of TT. In another embodiment, the activated serotype 15B capsular polysaccharide is conjugated to PD (Haemophilus influenzae protein D - see for example EP 0 594 610 B).;

[0128] In a preferred embodiment, the activated serotype 15B capsular polysaccharide of the present invention is conjugated to CRM 197 protein. CRM 197 protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. CRM 197 is produced by non-toxic phage β197 tox- infected Corynebacterium diphtheriae, which is mutagenized by nitrosoguanidine of the toxigenic Corynephage beta (Uchida, T. et al 1971, Nature New Biology 233:8-11). CRM 197 is purified by ultrafiltration, ammonium sulfate precipitation and ion exchange chromatography. CRM 197 protein has the same molecular weight as diphtheria toxin but differs from it by a single base change (guanine to adenine) in the structural gene. This single base change results in an amino acid substitution in the mature protein (glycine is replaced by glutamic acid) and eliminates the toxicity of diphtheria toxin. CRM 197 protein is a safe and effective T cell-dependent carrier for sugars. Further details regarding CRM 197 and its production can be found in for example US 5,614,382.

[0129] In an embodiment, the present invention relates to an immunogenic conjugate comprising a Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein. In an embodiment, the present invention relates to an immunogenic conjugate comprising a Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein by reductive amination. In an embodiment, the present invention relates to an immunogenic conjugate comprising a Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein by reductive amination in DMSO. In a preferred embodiment, the carrier protein is CRM 197. In a preferred embodiment, the polysaccharide is an isolated serotype 15B capsular polysaccharide as defined herein. In a preferred embodiment, the polysaccharide is an isolated serotype 15B capsular polysaccharide as defined herein, which has been tailored by high pressure homogenization.

[0130] In a preferred embodiment, the immunogenic conjugate comprises less than about 50, 45, 40, 35, 30, 25, 20 or 15% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide. In a preferred embodiment, the immunogenic conjugate comprises less than about 25% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide. In a preferred embodiment, the immunogenic conjugate comprises less than about 20% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide. In a preferred embodiment, the immunogenic conjugate comprises less than about 15% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide.

[0131] In a preferred embodiment, the immunogenic conjugate has a molecular weight of 3000 - 20000 kDa, 5000 - 10000 kDa, 5000 - 20000 kDa, 8000 - 20000 kDa, 8000 - 16000 kDa or 10000 - 16000 kDa. The molecular weight of the immunogenic conjugate is measured by SEC - MALLS.

[0132] In a preferred embodiment, the ratio (weight ratio) of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.5 - 3. In a preferred embodiment, the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.4 - 2, 0.5 - 2, 0.5 - 1.5, 0.5 - 1, 1 - 1.5, 1 - 2. In a preferred embodiment, the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.7 - 0.9.

[0133] Size - exclusion chromatography media (CL - 4B) can be used to determine the relative molecular size distribution of the conjugate. Size - exclusion chromatography (SEC) is used in a gravity - fed column to analyze the molecular size distribution of the conjugate. Larger molecules excluded by the pores in the media are eluted more rapidly than smaller molecules. A fraction collector is used to collect the column eluate. The fractions are subjected to a colorimetric test by carbohydrate assay. For the determination of the Kd value, the column is calibrated to establish the fraction (V 0 ), (Kd = 0), in which molecules are completely excluded, and this fraction represents the maximum retention (V i ), (Kd = 1). The fraction (V e ) reached by a particular sample property is given by the expression Kd=(V e - V 0 ) / (Vi -V 0 ) is related to Kd.

[0134] In a preferred embodiment, at least 20% of the immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, at least 30% of the immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, at least 40% of the immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85% of the immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, at least 60% of the immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, at least 70% of the immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column.

[0135] In a preferred embodiment, 40%-90% of the serotype 15B immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, 50%-90% of the serotype 15B immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, 65%-80% of the serotype 15B immunogenic conjugates have a Kd less than or equal to 0.3 in a CL-4B column.

[0136] In a preferred embodiment, the immunogenic conjugate contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM of acetate per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the immunogenic conjugate contains at least 0.5, 0.6 or 0.7 mM of acetate per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the immunogenic conjugate contains at least 0.6 mM of acetate per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the immunogenic conjugate contains at least 0.7 mM of acetate per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0137] In a preferred embodiment, the ratio of millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the immunogenic conjugate to millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred embodiment, the ratio of millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the immunogenic conjugate to millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the immunogenic conjugate to millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0138] In a preferred embodiment, the ratio of millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the immunogenic conjugate to millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred embodiment, the ratio of millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the immunogenic conjugate to millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the immunogenic conjugate to millimoles of acetate per millimole of serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0139] In a preferred embodiment, the immunogenic conjugate contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM glycerol per millimole of serotype 15B capsular polysaccharide. In a preferred embodiment, the immunogenic conjugate contains at least 0.5, 0.6, or 0.7 mM glycerol per millimole of serotype 15B capsular polysaccharide. In a preferred embodiment, the immunogenic conjugate contains at least 0.6 mM glycerol per millimole of serotype 15B capsular polysaccharide. In a preferred embodiment, the immunogenic conjugate contains at least 0.7 mM glycerol per millimole of serotype 15B capsular polysaccharide.

[0140] The degree of conjugation is the number of lysine residues in the carrier protein conjugated to the serotype 15B capsular polysaccharide. Evidence of lysine modification of the carrier protein due to covalent attachment to the polysaccharide is obtained by amino acid analysis using conventional methods known to those skilled in the art. Compared to CRM used to produce the conjugate material 197Protein raw materials, conjugation results in a decrease in the number of lysine residues recovered.

[0141] In a preferred embodiment, the degree of conjugation of the immunogenic conjugate is 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15 or 10-12. In a preferred embodiment, the degree of conjugation of the immunogenic conjugate is 2-5.

[0142] Immunogenic composition

[0143] The term "immunogenic composition" refers to any pharmaceutical composition containing an antigen (such as a microorganism or a component thereof), which can be used to elicit an immune response in a subject.

[0144] As used herein, "immunogenicity" refers to the ability of an antigen (or an epitope of the antigen) (such as a bacterial capsular polysaccharide) or an immunogenic conjugate or an immunogenic composition to elicit a humoral immune response or a cell-mediated immune response or both in a host (such as a mammal).

[0145] In an embodiment, the present disclosure relates to an immunogenic composition comprising the immunogenic serotype 15B capsular polysaccharide-carrier protein conjugate disclosed herein.

[0146] In an embodiment, the immunogenic composition disclosed herein, when administered to a subject, induces the formation of antibodies capable of binding to Streptococcus pneumoniae serotype 15B. In an embodiment, as measured by a standard ELISA assay, the immunogenic composition disclosed herein, when administered to a subject, induces the formation of antibodies capable of binding to Streptococcus pneumoniae serotype 15B.

[0147] In an embodiment, the immunogenic composition disclosed herein, when administered to a subject, induces the formation of antibodies capable of binding to Streptococcus pneumoniae serotypes 15B and 15A and / or 15C. In an embodiment, as measured by a standard ELISA assay, the immunogenic composition disclosed herein, when administered to a subject, induces the formation of antibodies capable of binding to Streptococcus pneumoniae serotypes 15B and 15A and / or 15C.

[0148] In an embodiment, the immunogenic composition disclosed herein, when administered to a subject, induces the formation of antibodies capable of binding to Streptococcus pneumoniae serotypes 15B and 15C. In an embodiment, as measured by a standard ELISA assay, the immunogenic composition disclosed herein, when administered to a subject, induces the formation of antibodies capable of binding to Streptococcus pneumoniae serotypes 15B and 15C.

[0149] In an ELISA (enzyme-linked immunosorbent assay) method, antibodies from the serum of an inoculated subject are incubated with a polysaccharide that has been adsorbed to a solid support. The bound antibodies are detected with an enzyme-conjugated secondary detection antibody.

[0150] In an embodiment, the ELISA assay is a standardized (WHO) ELISA assay as defined by the WHO in 'Training manual for Enzyme linked immunosorbent assay for the quantitation of Streptococcus pneumoniae serotype specific IgG (Pn PS ELISA).' (accessible at http: / / www.vaccine.uab.edu / ELISA%20protocol.pdf; accessed March 31, 2014).

[0151] ELISA measures type-specific IgG anti-Streptococcus pneumoniae capsular polysaccharide (PS) antibodies present in human serum. When a dilution of human serum is added to a microtiter plate coated with type-specific capsular PS, antibodies specific for that capsular PS bind to the microtiter plate. The antibodies bound to the plate are detected using a goat anti-human IgG antibody labeled with alkaline phosphatase, followed by a p-nitrophenyl phosphate substrate. The optical density of the colored end product is proportional to the amount of anti-capsular PS antibody present in the serum.

[0152] In an embodiment, as determined by ELISA assay, the immunogenic composition of the present invention is capable of eliciting IgG antibodies in humans that are capable of binding Streptococcus pneumoniae serotype 15B polysaccharide at the following concentrations: at least 0.05, 0.1, 0.2, 0.3, 0.35, 0.4, or 0.5 μg / ml.

[0153] In an embodiment, as determined by ELISA assay, the immunogenic composition of the present invention is capable of eliciting IgG antibodies in humans that are capable of binding Streptococcus pneumoniae serotype 15C polysaccharide at the following concentrations: at least 0.05, 0.1, 0.2, 0.3, 0.35, 0.4, or 0.5 μg / ml.

[0154] In an embodiment, as determined by ELISA assay, the immunogenic composition of the present invention is capable of eliciting IgG antibodies in humans that are capable of binding Streptococcus pneumoniae serotype 15B and 15C polysaccharides at the following concentrations: at least 0.05, 0.1, 0.2, 0.3, 0.35, 0.4, or 0.5 μg / ml.

[0155] In an embodiment, the immunogenic composition disclosed herein, when administered to a subject, induces the formation of antibodies capable of killing Streptococcus pneumoniae serotype 15B in an opsonophagocytosis assay (OPA) as disclosed herein. In an embodiment, the immunogenic composition disclosed herein, when tested in the OPA assay as disclosed herein, has an OPA titer higher than the OPA titer obtained with unconjugated native Streptococcus pneumoniae serotype 15B capsular polysaccharide.

[0156] In an embodiment, the immunogenic composition disclosed herein, when administered to a subject, induces the formation of antibodies capable of killing Streptococcus pneumoniae serotype 15C in an opsonophagocytosis assay as disclosed herein. In an embodiment, the immunogenic composition disclosed herein, when tested in the OPA assay as disclosed herein, has an OPA titer higher than the OPA titer obtained with unconjugated native Streptococcus pneumoniae serotype 15C capsular polysaccharide.

[0157] In an embodiment, the immunogenic composition disclosed herein, when administered to a subject, induces the formation of antibodies capable of killing Streptococcus pneumoniae serotypes 15B and 15C and / or 15A in an opsonophagocytosis assay as disclosed herein.

[0158] In an embodiment, the immunogenic composition disclosed herein, when administered to a subject, induces the formation of antibodies capable of killing serotypes 15B and 15C.

[0159] The pneumococcal opsonophagocytosis assay (OPA), which measures the killing of Streptococcus pneumoniae cells by phagocytic effector cells in the presence of functional antibodies and complement, is considered an important surrogate for assessing the effectiveness of pneumococcal vaccines.

[0160] The opsonophagocytosis assay (OPA) can be performed by incubating a mixture of Streptococcus pneumoniae cells, heat-inactivated human serum to be tested, differentiated HL-60 cells (phagocytes), and an exogenous complement source (e.g., baby rabbit complement). Opsonophagocytosis occurs during incubation, and bacterial cells covered with antibodies and complement are killed by opsonophagocytosis. The colony-forming units (cfu) of surviving bacteria that escape opsonophagocytosis are determined by plating the assay mixture. The OPA titer is defined as the reciprocal of the dilution that results in a 50% reduction in the number of bacteria in the control wells relative to the wells without the test serum. The OPA titer is an interpolation from two dilutions that bracket this 50% killing cut-off.

[0161] An endpoint titer of 1:8 or higher is considered a positive result in these killing-type OPAs.

[0162] In embodiments, as determined by opsonophagocytic killing assay (OPA), the immunogenic compositions of the invention are capable of eliciting a titer of at least 1:8 against Streptococcus pneumoniae serotype 15B in at least 50% of the subjects. In embodiments, as determined by opsonophagocytic killing assay (OPA), the immunogenic compositions of the invention are capable of eliciting a titer of at least 1:8 against Streptococcus pneumoniae serotype 15B in at least 60%, 70%, 80%, 90% or at least 93% of the subjects.

[0163] In embodiments, as determined by opsonophagocytic killing assay (OPA), the immunogenic compositions of the invention are capable of eliciting a titer of at least 1:8 against Streptococcus pneumoniae serotype 15C in at least 50% of the subjects. In embodiments, as determined by opsonophagocytic killing assay (OPA), the immunogenic compositions of the invention are capable of eliciting a titer of at least 1:8 against Streptococcus pneumoniae serotype 15C in at least 60%, 70%, 80%, 90% or at least 95% of the subjects.

[0164] The immunogenic compositions of the invention can be formulated using methods recognized in the art. For example, physiologically acceptable vehicles can be used to formulate the immunogenic conjugates of the invention to prepare the compositions. Examples of such vehicles include, but are not limited to, water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and dextrose solutions.

[0165] In a preferred embodiment, the immunogenic composition may comprise at least one additional antigen. In a preferred embodiment, the immunogenic composition may comprise at least one additional Streptococcus pneumoniae capsular polysaccharide.

[0166] In a preferred embodiment, the immunogenic composition may comprise at least one additional Streptococcus pneumoniae capsular polysaccharide conjugated to a carrier protein. In a preferred embodiment, the carrier protein is CRM 197 .

[0167] In certain embodiments, the immunogenic composition comprises one or more adjuvants. As defined herein, "adjuvant" refers to a substance used to enhance the immunogenicity of the immunogenic compositions of the invention. Thus, adjuvants are often administered to boost the immune response and are well known to those skilled in the art. Suitable adjuvants for enhancing the effectiveness of the composition include, but are not limited to:

[0168] (1) Aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc.;

[0169] (2) Oil-in-water emulsion formulations (with or without other specific immunostimulants such as muramyl peptides (defined below) or bacterial cell wall components), such as, for example

[0170] (a) MF59 (PCT Publication No. WO 90 / 14837), containing 5% squalene, 0.5% Tween 80, and 0.5% Span 85 (optionally containing varying amounts of MTP-PE (see below, although not required)), formulated into submicron particles using a microfluidizer such as the Model 11OY Microfluidizer (Microfluidics, Newton, MA).

[0171] (b) SAF, containing 10% squalene, 0.4% Tween 80, 5% Pluronic block polymer L121, and thr-MDP (see below), microfluidized into a submicron emulsion or vortexed to produce an emulsion of larger particle size, and

[0172] (c) RiBi TM The adjuvant system (RAS) (Corixa, Hamilton, MT) contains 2% squalene, 0.2% Tween 80, and one or more bacterial cell wall components selected from 3-O-deacylated monophosphoryl lipid A (MPL TM )(described in U.S. Patent No. 4,912,094) (Corixa), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (Detox TM );

[0173] (3) Saponin adjuvants such as Quil A or STIMULON TM QS-21 (Antigenics, Framingham, MA) (U.S. Patent No. 5,057,540) or particles generated therefrom such as ISCOM (immunostimulating complexes);

[0174] (4) Bacterial lipopolysaccharides, synthetic lipid A analogs such as aminoalkyl glucosamine phosphate compounds (AGP), or derivatives or analogs thereof, which are available from Corixa and described in U.S. Patent No. 6,113,918; one such AGP is 2-[(R)-3-tetradecanoyloxytetradecanamido]ethyl 2-deoxy-4-O-phosphono-3-O-[(R)-3-tetradecanoyloxytetradecanoyl]-2-[(R)-3-tetradecanoyloxytetradecanamido]-β-D-glucopyranoside, which is also known as 529 (formerly known as RC529), which is formulated in an aqueous form or as a stable emulsion, synthetic polynucleotides such as oligonucleotides containing CpG motifs (U.S. Patent No. 6,207,646);

[0175] (5) Cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, IL-15, IL-18, etc.), interferons (e.g., γ-interferon), granulocyte macrophage colony-stimulating factor (GM-CSF), macrophage colony-stimulating factor (M-CSF), tumor necrosis factor (TNF), costimulatory molecules 87-1 and 87-2, etc.;

[0176] (6) Detoxified mutants of bacterial ADP-ribosylating toxins, such as wild-type or mutant forms of cholera toxin (CT), said mutant forms such as where glutamate at amino acid position 29 is replaced by another amino acid (preferably histidine) (according to published international patent application number WO00 / 18434 (see also WO02 / 098368 and WO02 / 098369)); pertussis toxin (PT); or Escherichia coli heat-labile toxin (LT), especially LT-K63, LT-R72, CT-S109, PT-K9 / G129 (see, e.g., WO 93 / 13302 and WO 92 / 19265); and

[0177] (7) Other substances that act as immunostimulants to enhance the potency of the composition.

[0178] Muramyl peptides include, but are not limited to, N-acetyl-muramyl-L-thr-D-isoglutamine (thr-MDP), N-acetyl-normuramyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryl)-ethylamine (MTP-PE), etc.

[0179] In an embodiment of the present invention, an immunogenic composition as disclosed herein comprises a CpG oligonucleotide as an adjuvant. As used herein, CpG oligonucleotide refers to an immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and thus these terms may be used interchangeably unless otherwise specified. The immunostimulatory agent CpG oligodeoxynucleotide contains one or more immunostimulatory CpG motifs, which are unmethylated cytosine-guanine dinucleotides, optionally within certain preferred base contexts. The methylation state of the CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide. An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide containing a 5' unmethylated cytosine linked to a 3' guanine by a phosphodiester bond, and which activates the immune system by binding to Toll-like receptor 9 (TLR-9). In another embodiment, the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides, which will activate the immune system through TLR9 less strongly than if the CpG motif were unmethylated. CpG immunostimulatory oligonucleotides may contain one or more palindromic sequences, which in turn may include CpG dinucleotides. CpG oligonucleotides have been described in many issued patents, published patent applications and other publications, including U.S. Patent Nos. 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116 and 6,339,068.

[0180] In an embodiment of the present invention, the immunogenic composition as disclosed herein includes any CpG oligonucleotide described on page 3, line 22 to page 12, line 36 of WO2010 / 125480.

[0181] Different classes of CpG immunostimulatory oligonucleotides have been identified. These are designated as classes A, B, C and P, and are described in more detail on page 3, line 22 to page 12, line 36 of WO2010 / 125480. The methods of the present invention encompass the use of these different classes of CpG immunostimulatory oligonucleotides.

[0182] In an embodiment of the present invention, the immunogenic composition as disclosed herein comprises a class A CpG oligonucleotide. Preferably, the "class A" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5' GGGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO:1). Some non-limiting examples of class A oligonucleotides include: 5' G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G*G 3' (SEQ ID NO:2); wherein, * refers to a phosphorothioate bond and _ refers to a phosphodiester bond.

[0183] In an embodiment of the invention, the immunogenic composition as disclosed herein comprises a class B CpG oligonucleotide. In one embodiment, the CpG oligonucleotide for use in the invention is a class B CpG oligonucleotide, which is represented by at least the following formula:

[0184] 5'X 1 X 2 CGX 3 X 4 3’, where X1, X2, X3 and X4 are nucleotides. In one embodiment, X 2 is adenine, guanine or thymine. In another embodiment, X 3 is cytosine, adenine or thymine.

[0185] The class B CpG oligonucleotide sequences of the invention are those sequences that are widely described in the following patents: U.S. Patent Nos. 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116 and 6,339,068. Exemplary sequences include but are not limited to those sequences disclosed in these later applications and patents.

[0186] In an embodiment, the "class B" CpG oligonucleotide of the invention has the following nucleic acid sequences:

[0187] 5’TCGTCGTTTTTCGGTGCTTTT 3’ (SEQ ID NO:3), or

[0188] 5’TCGTCGTTTTTCGGTCGTTTT 3’ (SEQ ID NO:4), or

[0189] 5’TCGTCGTTTTGTCGTTTTGTCGTT 3’ (SEQ ID NO:5), or

[0190] 5’TCGTCGTTTCGTCGTTTTGTCGTT 3’ (SEQ ID NO:6), or

[0191] 5’TCGTCGTTTTGTCGTTTTTTTCGA 3’ (SEQ ID NO:7).

[0192] In any of these sequences, all the bonds can be phosphorothioate bonds. In another embodiment, in any of these sequences, one or more bonds can be phosphodiester, preferably between the "C" and "G" of the CpG motif, forming a semi-flexible CpG oligonucleotide. In any of these sequences, ethyl-uridine or a halogen can replace 5'T; examples of halogen substitution include but are not limited to bromouridine or iodouridine substitution.

[0193] Some non-limiting examples of Class B oligonucleotides include:

[0194] 5’T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3’ (SEQ ID NO:8), or

[0195] 5’T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3’ (SEQ ID NO:9), or

[0196] 5’T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3’ (SEQ ID NO:10), or

[0197] 5’T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3’ (SEQ ID NO:11), or

[0198] 5’T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A 3’ (SEQ ID NO:12).

[0199] Where * refers to a phosphorothioate bond.

[0200] In an embodiment of the present invention, the immunogenic composition as disclosed herein comprises a Class C CpG oligonucleotide. In an embodiment, the “Class C” CpG oligonucleotide of the present invention has the following nucleic acid sequence:

[0201] 5’TCGCGTCGTTCGGCGCGCGCCG 3’ (SEQ ID NO:13), or

[0202] 5’TCGTCGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO:14), or

[0203] 5’TCGGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO:15), or

[0204] 5’TCGGACGTTCGGCGCGCCG 3’ (SEQ ID NO:16), or

[0205] 5’TCGCGTCGTTCGGCGCGCCG 3’ (SEQ ID NO:17), or

[0206] 5’TCGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO:18), or

[0207] 5’TCGACGTTCGGCGCGCCG 3’ (SEQ ID NO:19), or

[0208] 5’TCGCGTCGTTCGGCGCCG 3’ (SEQ ID NO:20), or

[0209] 5’TCGCGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO:21), or

[0210] 5’TCGTCGTTTTCGGCGCGCGCCG 3’ (SEQ ID NO:22), or

[0211] 5’TCGTCGTTTTCGGCGGCCGCCG 3’ (SEQ ID NO:23), or

[0212] 5’TCGTCGTTTTACGGCGCCGTGCCG 3’ (SEQ ID NO:24), or

[0213] 5’TCGTCGTTTTCGGCGCGCGCCGT 3’ (SEQ ID NO:25).

[0214] In any of these sequences, all the bonds can be phosphorothioate bonds. In another embodiment, in any of these sequences, one or more bonds can be phosphodiester, preferably between the "C" and "G" of the CpG motif, to form a semi-flexible CpG oligonucleotide.

[0215] Some non-limiting examples of Class C oligonucleotides include:

[0216] 5’T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3’ (SEQ ID NO:26), or

[0217] 5’T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3’ (SEQ ID NO:27), or

[0218] 5’T*C_G*G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3’ (SEQ ID NO:28), or

[0219] 5’T*C_G*G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3’(SEQ ID NO:29), or

[0220] 5’T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3’(SEQ ID NO:30), or

[0221] 5’T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3’(SEQ ID NO:31), or

[0222] 5’T*C_G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3’(SEQ ID NO:32), or

[0223] 5’T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*C*G 3’(SEQ ID NO:33), or

[0224] 5’T*C_G*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3’(SEQ ID NO:34), or

[0225] 5’T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G 3’(SEQ ID NO:35), or

[0226] 5’T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G 3’(SEQ ID NO:36), or

[0227] 5’T*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G3’(SEQ ID NO:37), or

[0228] 5’T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3’(SEQ ID NO:38)

[0229] where * refers to a phosphorothioate bond and _ refers to a phosphodiester bond.

[0230] In any of these sequences, ethyl-uridine or a halogen may replace 5’T; examples of halogen substitution include, but are not limited to, bromouridine or iodouridine substitution.

[0231] In embodiments of the present invention, the immunogenic compositions as disclosed herein comprise class P CpG oligonucleotides. In an embodiment, the CpG oligonucleotides for use in the present invention are class P CpG oligonucleotides which comprise a 5' TLR activating domain and at least two palindromic regions, one palindromic region being a 5' palindromic region of at least 6 nucleotides in length and directly or via a spacer linked to a 3' palindromic region of at least 8 nucleotides in length, wherein the oligonucleotide comprises at least one YpR dinucleotide. In an embodiment, the oligonucleotide is not T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G (SEQ ID NO:27). In one embodiment, the class P CpG oligonucleotide comprises at least one unmethylated CpG dinucleotide. In another embodiment, the TLR activating domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT or TTTT. In yet another embodiment, the TLR activating domain is within the 5' palindromic region. In another embodiment, the TLR activating domain is immediately 5' of the 5' palindromic region.

[0232] In an embodiment, the "class P" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5’ TCGTCGACGATCGGCGCGCGCCG 3’ (SEQ ID NO:39).

[0233] In said sequence, all the linkages may be phosphorothioate linkages. In another embodiment, one or more linkages may be phosphodiester, preferably between the "C" and "G" of the CpG motif, forming a semi-flexible CpG oligonucleotide. In any of these sequences, ethyl-uridine or a halogen may replace the 5' T: examples of halogen substitution include, but are not limited to, bromouridine or iodouridine substitution.

[0234] Non-limiting examples of class P oligonucleotides include:

[0235] 5’T*C_G*T*C_G*A*C_G*A*T*C_G*G*C*G*C_G*C*G*C*C*G 3’ (SEQ ID NO:40)

[0236] wherein * refers to a phosphorothioate linkage and _ refers to a phosphodiester linkage.

[0237] In one embodiment, the oligonucleotide comprises at least one phosphorothioate bond. In another embodiment, all internucleotide linkages of the oligonucleotide are phosphorothioate bonds. In another embodiment, the oligonucleotide comprises at least one phosphodiester-like bond. In another embodiment, the phosphodiester-like bond is a phosphodiester bond. In another embodiment, a lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.

[0238] In an embodiment, the internucleotide bonds of all CpG oligonucleotides disclosed herein are phosphodiester bonds ("flexible" oligonucleotides, as described in PCT application WO2007 / 026190). In another embodiment, the CpG oligonucleotides of the present invention are resistant to degradation (e.g., are stabilized). A "stabilized oligonucleotide" refers to an oligonucleotide that is relatively resistant to in vivo degradation (e.g., via exonucleases or endonucleases). Nucleic acid stabilization can be achieved by backbone modification. Oligonucleotides having phosphorothioate bonds provide maximum activity and protect the oligonucleotide from exo- and endonuclease degradation both inside and outside the cell. Immunostimulatory oligonucleotides can have a chimeric backbone that has a combination of phosphodiester bonds and phosphorothioate bonds. For the purposes of the present invention, a chimeric backbone refers to a partially stabilized backbone in which at least one internucleotide bond is a phosphodiester bond or a phosphodiester-like bond, and in which at least one other internucleotide bond is a stabilized internucleotide bond, wherein the at least one phosphodiester bond or phosphodiester-like bond and the at least one stabilized bond are different. As described in PCT application WO2007 / 026190, when the phosphodiester bond is preferably located within the CpG motif, such a molecule is referred to as "semi-flexible".

[0239] The size of the CpG oligonucleotide (i.e., the number of nucleotide residues along the length of the oligonucleotide) can also contribute to the stimulatory activity of the oligonucleotide. To facilitate uptake into cells, the CpG oligonucleotides of the present invention preferably have a minimum length of 6 nucleotide residues. Any oligonucleotide of a size greater than 6 nucleotides (even up to many kb) can induce an immune response if there are sufficient immunostimulatory motifs, since larger oligonucleotides are degraded intracellularly. In certain embodiments, the CpG oligonucleotide is 6-100 nucleotides in length, preferably 8-30 nucleotides in length. In important embodiments, the nucleic acids and oligonucleotides of the present invention are not plasmids or expression vectors.

[0240] In an embodiment, the CpG oligonucleotides disclosed herein contain substitutions or modifications, such as on the bases and / or sugars, as described in paragraphs 134-147 of WO2007 / 026190.

[0241] In embodiments, the CpG oligonucleotides of the invention are chemically modified. Examples of chemical modifications are known to those skilled in the art and are described, for example, in Uhlmann E. et al. (1990), Chem. Rev. 90:543, S. Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke, S.T. et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36:107-129; and Hunziker J. et al., (1995), Mod. Synth. Methods 7:331-417. The oligonucleotides according to the invention may have one or more modifications, each modification being located at a specific internucleoside phosphodiester bridge and / or at a specific β-D-ribose unit and / or at a specific natural nucleobase position, as compared to an oligonucleotide of the same sequence consisting of natural DNA or RNA.

[0242] In some embodiments of the invention, the CpG-containing nucleic acid can simply be mixed with an immunogenic carrier according to methods known to those skilled in the art (see, for example, WO03 / 024480).

[0243] In specific embodiments of the invention, any of the immunogenic compositions disclosed herein contain from 2 μg to 100 mg of CpG oligonucleotide, preferably from 0.1 mg to 50 mg of CpG oligonucleotide, preferably from 0.2 mg to 10 mg of CpG oligonucleotide, preferably from 0.3 mg to 5 mg of CpG oligonucleotide, even preferably from 0.5 - 2 mg of CpG oligonucleotide, even preferably from 0.75 - 1.5 mg of CpG oligonucleotide. In a preferred embodiment, the immunogenic compositions disclosed herein contain about 1 mg of CpG oligonucleotide.

[0244] In a preferred embodiment, the adjuvant is an aluminum-based adjuvant selected from aluminum phosphate, aluminum sulfate, and aluminum hydroxide. In one embodiment, the immunogenic composition described herein contains the adjuvant aluminum phosphate.

[0245] In a preferred embodiment, the immunogenic composition of the invention further comprises at least one of a buffer, a cryoprotectant, a salt, a divalent cation, a nonionic detergent, a radical oxidation inhibitor, a diluent, or a carrier.

[0246] The immunogenic composition may optionally comprise one or more physiologically acceptable buffers selected from, but not limited to, Tris (trimethamine), phosphate, acetate, borate, citrate, glycine, histidine, and succinate. In certain embodiments, the formulation is buffered to a pH range of from about 5.0 to about 7.0, preferably from about 5.5 to about 6.5.

[0247] The immunogenic composition may optionally comprise one or more nonionic surfactants including, but not limited to, polyoxyethylene sorbitan fatty acid esters, polysorbate 80 (Tween 80), polysorbate 60 (Tween 60), polysorbate 40 (Tween 40), and polysorbate-20 (Tween 20), polyoxyethylene alkyl ethers including, but not limited to, Brij58, Brij35, and others such as Triton X-100, Triton X-114, NP40, span 85, and Pluronic series nonionic surfactants (e.g., Pluronic 121). In a preferred embodiment, the immunogenic composition comprises polysorbate 80 or polysorbate 40, preferably polysorbate 80. In a preferred embodiment, the immunogenic composition comprises polysorbate 80 at a concentration of from about 0.001% to about 2% (preferably at most about 0.25%) or polysorbate 40 at a concentration of from about 0.001% to 1% (preferably at most about 0.5%).

[0248] The present invention also relates to a vaccine comprising the immunogenic composition of the present invention.

[0249] Methods for inducing an immune response and protecting against infection

[0250] The present disclosure also includes methods of using the immunogenic compositions described herein. For example, one embodiment of the present disclosure provides a method of inducing an immune response against Streptococcus pneumoniae, which comprises administering to a subject an immunogenic amount of any of the immunogenic compositions described herein.

[0251] One embodiment of the present disclosure provides a method of protecting a subject from infection with Streptococcus pneumoniae, or preventing infection with Streptococcus pneumoniae, or reducing the severity of an infection caused by Streptococcus pneumoniae or delaying the onset of at least one symptom associated with an infection caused by Streptococcus pneumoniae, the method comprising administering to a subject an immunogenic amount of any of the immunogenic compositions described herein.

[0252] One embodiment of the present disclosure provides a method of protecting a subject from infection with Streptococcus pneumoniae serotype 15B, or preventing infection with Streptococcus pneumoniae serotype 15B, or reducing the severity of an infection caused by Streptococcus pneumoniae serotype 15B or delaying the onset of at least one symptom associated with an infection caused by Streptococcus pneumoniae serotype 15B, the method comprising administering to the subject an immunogenic amount of any of the immunogenic compositions described herein.

[0253] One embodiment of the present disclosure provides a method of protecting a subject from infection with Streptococcus pneumoniae serotype 15C, or preventing infection with Streptococcus pneumoniae serotype 15C, or reducing the severity of an infection caused by Streptococcus pneumoniae serotype 15C or delaying the onset of at least one symptom associated with an infection caused by Streptococcus pneumoniae serotype 15C, the method comprising administering to the subject an immunogenic amount of any of the immunogenic compositions described herein.

[0254] One embodiment of the present disclosure provides a method of protecting a subject from infection with Streptococcus pneumoniae serotype 15A, or preventing infection with Streptococcus pneumoniae serotype 15A, or reducing the severity of an infection caused by Streptococcus pneumoniae serotype 15A or delaying the onset of at least one symptom associated with an infection caused by Streptococcus pneumoniae serotype 15A, the method comprising administering to the subject an immunogenic amount of any of the immunogenic compositions described herein.

[0255] One embodiment of the present disclosure provides a method of treating or preventing pneumococcal infections, diseases or conditions in a subject associated with Streptococcus pneumoniae serotype 15A, 15B and / or 15C (preferably 15B and / or 15C, more preferably 15B), the method comprising the step of administering to the subject a therapeutically or prophylactically effective amount of an immunogenic composition described herein. Another embodiment provides a method of treating or preventing pneumococcal infections, diseases or conditions in a subject associated with Streptococcus pneumoniae serotype 15A, 15B and / or 15C (preferably 15B and / or 15C, more preferably 15B), the method comprising generating a polyclonal or monoclonal antibody preparation from an immunogenic composition described herein and using the antibody preparation to confer passive immunity to the subject.

[0256] In one embodiment, the present disclosure relates to the use of an immunogenic conjugate or immunogenic composition disclosed herein for the preparation of a medicament for protecting a subject from Streptococcus pneumoniae infection, and / or preventing Streptococcus pneumoniae infection, and / or reducing the severity of an infection caused by Streptococcus pneumoniae or delaying the onset of at least one symptom associated with an infection caused by Streptococcus pneumoniae, and / or protecting a subject from Streptococcus pneumoniae serotype 15A, 15B, and / or 15C (preferably 15B and / or 15C, more preferably 15B) infection and / or preventing Streptococcus pneumoniae serotype 15A, 15B, and / or 15C (preferably 15B and / or 15C, more preferably 15B), and / or reducing the severity of an infection caused by Streptococcus pneumoniae serotype 15A, 15B, and / or 15C (preferably 15B and / or 15C, more preferably 15B) or delaying the onset of at least one symptom associated with an infection caused by Streptococcus pneumoniae serotype 15A, 15B, and / or 15C (preferably 15B and / or 15C, more preferably 15B).

[0257] In one embodiment, the present disclosure relates to the use of an immunogenic conjugate or immunogenic composition disclosed herein for the preparation of a medicament for protecting a subject from Streptococcus pneumoniae infection, and / or preventing Streptococcus pneumoniae infection, and / or reducing the severity of an infection caused by Streptococcus pneumoniae or delaying the onset of at least one symptom associated with an infection caused by Streptococcus pneumoniae, and / or protecting a subject from Streptococcus pneumoniae serotype 15A, 15B, and / or 15C (preferably 15B and / or 15C, more preferably 15B) infection and / or preventing Streptococcus pneumoniae serotype 15A, 15B, and / or 15C (preferably 15B and / or 15C, more preferably 15B), and / or reducing the severity of an infection caused by Streptococcus pneumoniae serotype 15A, 15B, and / or 15C (preferably 15B and / or 15C, more preferably 15B) or delaying the onset of at least one symptom associated with an infection caused by Streptococcus pneumoniae serotype 15A, 15B, and / or 15C (preferably 15B and / or 15C, more preferably 15B).

[0258] An "immune response" to an immunogenic composition is the development of a humoral immune response and / or a cell-mediated immune response in a subject that is directed against a molecule present in the immunogenic composition or vaccine composition of interest. For the purposes of the present disclosure, a "humoral immune response" is an antibody-mediated immune response and involves the induction and generation of antibodies that recognize and bind with some affinity to an antigen in the immunogenic composition or vaccine of the present disclosure, while a "cell-mediated immune response" is an immune response mediated by T cells and / or other white blood cells. A "cell-mediated immune response" is initiated by the presentation of an epitope bound to a class I or class II major histocompatibility complex molecule (MHC), CD1, or other non-classical MHC-like molecule. This activates antigen-specific CD4+ T helper cells or CD8+ cytotoxic T lymphocytes ("CTLs"). CTLs are specific for peptide antigens presented by proteins encoded by classical or non-classical MHCs and expressed on the cell surface. CTLs help to induce and promote the intracellular destruction of intracellular microbes, or the lysis of cells infected with such microbes. Another aspect of cellular immunity involves the antigen-specific responses of helper T cells. Helper T cells function to help stimulate functions and focus the activities of non-specific effector cells against cells that display peptides or other antigens bound to classical or non-classical MHC molecules on their surface. A "cell-mediated immune response" also refers to the production of cytokines, chemokines, and other such molecules produced by activated T cells and / or other white blood cells (including those derived from CD4+ and CD8+ T cells). The ability of a particular antigen or composition to stimulate a cell-mediated immune response can be determined by a number of assays, such as by lymphocyte proliferation (lymphocyte activation) assays, CTL cytotoxicity assays, by assaying for T lymphocytes specific for an antigen in a sensitized subject, or by measuring cytokines produced by T cells in response to antigen restimulation. Such assays are well known in the art. See, for example, Erickson et al. (1993) J. Immunol. 151:4189-4199; and Doe et al. (1994) Eur. J. Immunol. 24:2369-2376.

[0259] As used herein, "treatment" (including its variations, e.g., "treat" or "treated") refers to any one or more of the following: (i) prevention of infection or reinfection, as in traditional vaccines, (ii) reduction in the severity of symptoms, or elimination of symptoms, and (iii) substantial or complete elimination of the pathogen or condition under discussion. Thus, treatment can be achieved prophylactically (before infection) or therapeutically (after infection). In the present disclosure, prophylactic treatment is the preferred mode. According to specific embodiments of the present disclosure, there are provided compositions and methods for treating (including prophylactic and / or therapeutic immunization) a host animal against Streptococcus pneumoniae serotypes 15A, 15B, and / or 15C (preferably 15B and / or 15C, more preferably 15B) infection. The methods of the present disclosure are for conferring prophylactic and / or therapeutic immunity to a subject. The methods of the present disclosure can also be practiced on subjects for biomedical research applications.

[0260] Both "immunogenic amount" and "immunologically effective amount" are used interchangeably herein and refer to the amount of an antigen or immunogenic composition that is sufficient to elicit an immune response, i.e., a cellular (T cell) or humoral (B cell or antibody) response, or both, as measured by standard assays known to those of skill in the art.

[0261] In a preferred embodiment, the subject is a human. In a most preferred embodiment, the subject is a neonate (i.e., less than three months of age), an infant (three months to one year of age), or a toddler (i.e., one year to four years of age).

[0262] In an embodiment, the immunogenic compositions disclosed herein are used as vaccines.

[0263] In such an embodiment, the subject to be vaccinated can be less than 1 year of age. For example, the subject to be vaccinated can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months of age. In an embodiment, the subject to be vaccinated is about 2, 4, or 6 months of age. In another embodiment, the subject to be vaccinated is less than 2 years of age. For example, the subject to be vaccinated can be about 12 - 15 months of age. In some cases, as few as one dose of the immunogenic composition according to the invention is required, but in certain cases, a second, third, or fourth dose can be administered (see the protocol section).

[0264] In an embodiment of the present invention, the subject to be vaccinated is an adult 50 years of age or older, more preferably 55 years of age or older. In an embodiment, the subject to be vaccinated is an adult 65 years of age or older, 70 years of age or older, 75 years of age or older, or 80 years of age or older.

[0265] In an embodiment, the subject to be vaccinated is an immunocompromised individual, particularly a human. Immunocompromised individuals are generally defined as those who exhibit an impaired or reduced ability to mount normal humoral or cellular defenses against an infectious agent challenge.

[0266] In an embodiment of the invention, the immunocompromised subject to be vaccinated has a disease or condition that disrupts the human immune system and results in an antibody response insufficient to prevent or treat pneumococcal disease.

[0267] In an embodiment, the disease is a primary immunodeficiency disorder. Preferably, the primary immunodeficiency disorder is selected from: combined T and B cell immunodeficiencies, antibody deficiencies, well-defined syndromes, immunodysregulation diseases, phagocytic disorders, congenital immunodeficiencies, autoinflammatory disorders, and complement deficiencies. In an embodiment, the primary immunodeficiency disorder is selected from the disorders disclosed on page 24, line 11 - page 25, line 19 of PCT application WO2010 / 125480.

[0268] In a specific embodiment of the invention, the immunocompromised subject to be vaccinated has a disease selected from the following: HIV infection, acquired immunodeficiency syndrome (AIDS), cancer, chronic cardiac or pulmonary conditions, congestive heart failure, diabetes, chronic liver disease, alcoholism, cirrhosis, cerebrospinal fluid leakage, cardiomyopathy, chronic bronchitis, emphysema, chronic obstructive pulmonary disease (COPD), splenic dysfunction (such as sickle cell disease), asplenia, hematologic malignancies, leukemia, multiple myeloma, Hodgkin's disease, lymphoma, renal failure, nephrotic syndrome, and asthma.

[0269] In an embodiment of the invention, the immunocompromised subject to be vaccinated has malnutrition.

[0270] In a specific embodiment of the invention, the immunocompromised subject to be vaccinated is receiving a drug or treatment that reduces the body's resistance to infection. In an embodiment, such drugs are selected from the drugs disclosed on page 26, line 33 - page 26, line 40 of PCT application WO2010 / 125480.

[0271] In a specific embodiment of the invention, the immunocompromised subject to be vaccinated is a smoker.

[0272] In a specific embodiment of the invention, the immunocompromised subject to be vaccinated has a white blood cell count of less than 5 × 10 9 cells / L, or less than 4 × 10 9 cells / L, or less than 3 × 10 9 cells / L, or less than 2 × 109 cells / L, or less than 1×10 9 cells / L, or less than 0.5×10 9 cells / L, or less than 0.3×10 9 cells / L, or less than 0.1×10 9 cells / L.

[0273] White blood cell count (leukocyte count): The number of white blood cells (WBCs) in the blood. WBCs are usually measured as part of a CBC (complete blood count). White blood cells are anti-infection cells in the blood and are different from the red (oxygen-carrying) blood cells called red blood cells. There are different types of white blood cells, including neutrophils (polymorphonuclear leukocytes; PMNs), band cells (slightly immature neutrophils), T lymphocytes (T cells), B lymphocytes (B cells), monocytes, eosinophils, and basophils. All types of white blood cells are reflected in the white blood cell count. The normal range of white blood cell count is usually 4,300 - 10,800 cells per cubic millimeter of blood. This can also be called the leukocyte count and can be expressed in international units as 4.3 - 10.8×10 9 cells / L.

[0274] In a specific embodiment of the present invention, the immunocompromised subject to be inoculated has neutropenia. In a specific embodiment of the present invention, the immunocompromised subject to be inoculated has a neutrophil count less than 2×10 9 cells / L, or less than 1×10 9 cells / L, or less than 0.5×10 9 cells / L, or less than 0.1×10 9 cells / L, or less than 0.05×10 9 cells / L.

[0275] Low white blood cell count or "neutropenia" is a condition characterized by an abnormally low level of neutrophils in the circulating blood. Neutrophils are a specific type of white blood cell that helps prevent and fight infections. The most common cause for cancer patients to experience neutropenia is as a side effect of chemotherapy. Chemotherapy-induced neutropenia increases the patient's risk of infection and disrupts cancer treatment.

[0276] In a specific embodiment of the present invention, the immunocompromised subject to be inoculated has a CD4+ cell count less than 500 / mm 3 , or a CD4+ cell count less than 300 / mm 3 , or a CD4+ cell count less than 200 / mm 3, the CD4+ cell count is less than 100 / mm 3 , the CD4+ cell count is less than 75 / mm 3 , or the CD4+ cell count is less than 50 / mm 3 .

[0277] CD4 cell tests are usually reported as the number of cells in mm 3 . The normal CD4 count is 500 - 1600, and the CD8 count is 375 - 1100. The CD4 count drops sharply in people with HIV.

[0278] In embodiments of the present invention, any immunocompromised subject disclosed herein is a human male or a human female.

[0279] The amount of conjugate in the composition is generally calculated based on the total polysaccharide conjugated and unconjugated for the conjugate. For example, a conjugate with 20% free polysaccharide will have approximately 80 μg of conjugated polysaccharide and approximately 20 μg of unconjugated polysaccharide in a 100 μg polysaccharide dose. When calculating the dose of the conjugate, the contribution of the protein to the conjugate is usually not considered. Generally, each dose contains 0.1 - 100 μg of polysaccharide, particularly 0.1 - 10 μg, more particularly 1 - 10 μg, more particularly 1 - 5 μg. Preferably, each dose will contain approximately 1.1, 2, 2.2, 3, 3.3, 4, 4.4 μg of polysaccharide.

[0280] The optimal amount of components for a particular immunogenic composition or vaccine can be determined by standard studies involving the observation of an appropriate immune response in subjects. After the initial inoculation, the subject can receive one or several booster immunizations at sufficient intervals.

[0281] The effectiveness of an antigen as an immunogen can be measured by, for example, a proliferation assay, or by a cytotoxicity assay (such as a chromium release assay that measures the ability of T cells to lyse their specific target cells), or by measuring the level of circulating antibodies specific for the antigen in serum to measure B cell activity levels. As described herein, an immune response can also be detected by measuring the serum level of antigen-specific antibodies induced after administration of the antigen, and more specifically, by measuring the ability of such induced antibodies to enhance the opsonophagocytic capacity of specific white blood cells. The protective level of an immune response can be measured by challenging an immunized host with the administered antigen. For example, if the antigen to which an immune response is desired is a bacterium, the level of protection induced by an immunogenic amount of the antigen is measured by detecting the percentage survival or percentage death of an animal challenged with bacterial cells. In one embodiment, the amount of protection can be measured by measuring at least one symptom associated with the bacterial infection (such as fever associated with the infection). The amount of each antigen in a multi-antigen or multi-component vaccine or immunogenic composition will vary with respect to each other component and can be determined by methods known to those of skill in the art. Such methods will include methods for measuring immunogenicity and / or in vivo efficacy.

[0282] The present disclosure further provides antibodies and antibody compositions that specifically and selectively bind to the capsular polysaccharides or immunogenic conjugates of the present disclosure. In some embodiments, the antibodies are generated after administration of the capsular polysaccharides or immunogenic conjugates of the present disclosure to a subject. In some embodiments, the present disclosure provides purified or isolated antibodies against one or more of the capsular polysaccharides or immunogenic conjugates of the present disclosure. In some embodiments, the antibodies of the present disclosure are functional as measured by, for example, killing bacteria in an animal efficacy model or via an opsonophagocytic killing assay. In some embodiments, the antibodies of the present disclosure confer passive immunity to a subject. The present disclosure also provides polynucleotide molecules encoding the antibodies or antibody fragments of the present disclosure, and cells, cell lines (such as hybridoma cells or other engineered cell lines for recombinant production of antibodies), or transgenic animals that produce the antibodies or antibody compositions of the present disclosure using techniques well known to those of skill in the art.

[0283] Example

[0284] Example 1: Preparation of Isolated Streptococcus pneumoniae Serotype 15B Capsular Polysaccharide

[0285] 1.1 Fermentation and Purification

[0286] Serotype 15B capsular polysaccharide can be obtained directly from bacteria using isolation methods known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 20060228380, 20060228381, 20070184071, 20070184072, 20070231340, and 20080102498 or WO2008118752). Streptococcus pneumoniae serotype 15B is grown in a seed flask and then transferred to a seed fermenter. Once the target optical density is reached, the cells are transferred to a production fermenter. The fermentation broth is inactivated by adding N-lauroyl sarcosine and purified by ultrafiltration and diafiltration.

[0287] Then, the purified Streptococcus pneumoniae serotype 15B polysaccharide is sized by high pressure homogenization using a PANDA 2K (GEA Niro Soavi) to produce an isolated Streptococcus pneumoniae serotype 15B polysaccharide.

[0288] Preferably, the isolated Streptococcus pneumoniae serotype 15B capsular polysaccharide obtained by the above method contains at least 0.6 mM acetate per mM of serotype 15B capsular polysaccharide and has a molecular weight of 50 kDa - 500 kDa, preferably 150 - 350 kDa.

[0289] 1.2 Oxidation of the isolated Streptococcus pneumoniae serotype 15B capsular polysaccharide

[0290] Polysaccharide oxidation is carried out in 100 mM potassium phosphate buffer (pH 6.0 ± 0.2) by sequentially adding a calculated amount of 500 mM potassium phosphate buffer (pH 6.0) and WFI to obtain a final polysaccharide concentration of 2.0 g / L. If necessary, the reaction pH is adjusted to about pH 6.0. After pH adjustment, the reaction temperature is adjusted to 23 ± 2 °C. The oxidation reaction is initiated by adding approximately 0.25 molar equivalents of sodium periodate. The oxidation reaction process is carried out at 23 ± 2 °C for approximately 16 hours.

[0291] Concentration and diafiltration of the activated polysaccharide are carried out using a 10K MWCO ultrafiltration cassette. Diafiltration is carried out against 20-fold diafiltration volume of WFI. Then, the purified activated polysaccharide is stored at 5 ± 3 °C. The purified activated sugar is characterized in particular by: (i) sugar concentration by colorimetry; (ii) aldehyde concentration by colorimetry; (iii) degree of oxidation; (iv) molecular weight by SEC-MALLS; and (v) presence of O-acetyl and glycerol.

[0292] SEC-MALLS is used to determine the molecular weights of polysaccharides and polysaccharide-protein conjugates. Polysaccharides are separated by SEC based on hydrodynamic volume. The refractive index (RI) and multi-angle laser light scattering (MALLS) detectors are used to determine the molecular weight. When light interacts with a substance, it scatters and the amount of scattered light is related to the concentration of the substance, the square of dn / dc (specific refractive index increment), and the molar mass. The molecular weight measurement is calculated based on the readings of the light signal scattered from the MALLS detector and the concentration signal from the RI detector.

[0293] The degree of oxidation (DO = moles of sugar repeat unit / moles of aldehyde) of the activated polysaccharide is determined as follows:

[0294] The moles of sugar repeat unit are determined by various colorimetric methods, such as by using the anthrone method. By the anthrone method, the polysaccharide is first decomposed into monosaccharides by the action of sulfuric acid and heat. The anthrone reagent reacts with hexoses to form a yellow-green colored complex, the absorbance of which is read spectrophotometrically at 625 nm. In the range of the determination, the absorbance is proportional to the amount of hexose present.

[0295] The moles of aldehyde are also determined simultaneously using the MBTH colorimetric method. The MBTH assay involves the formation of an azine compound by reacting the aldehyde group (from a given sample) with 3-methyl-2-benzothiazolinone hydrazone (MBTH assay reagent). The excess 3-methyl-2-benzothiazolinone hydrazone is oxidized to form a reactive cation. The reactive cation and the azine react to form a blue chromophore. Then the formed chromophore is spectrally read at 650 nm.

[0296] Preferably, the activated Streptococcus pneumoniae serotype 15B capsular polysaccharide obtained by the above method contains at least 0.6 mM acetate per mM of serotype 15B capsular polysaccharide and has a molecular weight of 50 kDa - 500 kDa, preferably 100 - 250 kDa.

[0297] 1.3 Conjugation of activated Streptococcus pneumoniae serotype 15B capsular polysaccharide with CRM 197 of

[0298] The conjugation method consists of the following steps:

[0299] a) Mix with a sucrose excipient and lyophilize

[0300] b) Reconstitute the lyophilized activated polysaccharide and CRM 197

[0301] c) Conjugate the activated polysaccharide to CRM 197 and cap

[0302] d) Purify the conjugate

[0303] a) Mix with a sucrose excipient and lyophilize

[0304] The activated polysaccharide is mixed with sucrose to a ratio of 25 grams of sucrose per gram of activated polysaccharide. Then, the bottles of the mixed mixture are freeze-dried. After freeze-drying, the bottles containing the freeze-dried activated polysaccharide are stored at -20 ± 5 °C. The calculated amount of CRM 197 The protein is separately shell-frozen and freeze-dried. The freeze-dried CRM 197 is stored at -20 ± 5 °C.

[0305] b) Reconstitution of the freeze-dried activated polysaccharide and CRM 197 protein

[0306] The freeze-dried activated polysaccharide is reconstituted in anhydrous dimethyl sulfoxide (DMSO). Once the polysaccharide is completely dissolved, an equal volume of anhydrous DMSO is added to the freeze-dried CRM 197 for reconstitution.

[0307] c) Conjugation and capping

[0308] The reconstituted activated polysaccharide and the reconstituted CRM 197 are combined in a reaction vessel (input ratio 0.8:1), followed by thorough mixing to obtain a clear solution, and then conjugation is initiated with sodium cyanoborohydride. The final polysaccharide concentration in the reaction solution is approximately 1 g / L. Conjugation is initiated by adding 1.0–1.5 MEq of sodium cyanoborohydride to the reaction mixture and incubating at 23 ± 2 °C for 40 - 48 hours. The conjugation reaction is terminated by adding 2 MEq of sodium borohydride (NaBH 4 ) to cap the unreacted aldehyde groups. This capping reaction continues at 23 ± 2 °C for 3 ± 1 hours.

[0309] d) Purification of the conjugate

[0310] The conjugate solution is diluted 1:10 with cooled 5 mM succinate - 0.9% saline (pH 6.0) to prepare for purification by tangential flow filtration using a 100 - 300K MWCO filter membrane. The diluted conjugate solution is filtered through a 5 μm filter and diafiltered using 5 mM succinate - 0.9% saline (pH 6.0) as the medium. After diafiltration is complete, the conjugate retentate is transferred through a 0.22 μm filter.

[0311] The conjugate is further diluted with 5 mM succinate / 0.9% saline (pH 6) to achieve a target sugar concentration of approximately 0.5 mg / mL. The final 0.22 μm filtration step is completed to obtain the immunogenic conjugate.

[0312] Preferably, the conjugate obtained by the above method contains at least 0.6 mM acetate per mM of serotype 15B capsular polysaccharide, has a molecular weight of 3000 - 20000 kDa, and has a degree of conjugation of 2 - 6.

[0313] Example 2: Characterization of an immunogenic conjugate comprising Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to CRM 197 197

[0314] Conjugate 1 was prepared by the method disclosed in Example 1. Conjugates 2 and 3 were prepared by a similar method using different amounts of oxidant. Conjugate 4 was prepared by a similar method except that the purified serotype 15B capsular polysaccharide was not trimmed and was activated to a lower DO (higher oxidation level), and conjugation was carried out in an aqueous medium. Conjugate 5 was prepared by a similar method except that the purified serotype 15B capsular polysaccharide was trimmed by chemical hydrolysis and conjugation was carried out in an aqueous medium. Conjugates 6 and 7 were prepared by a similar method except that the purified serotype 15B capsular polysaccharide was not trimmed. The resulting conjugates were characterized and the results are summarized in Table 1.

[0315] Table 1: Streptococcus pneumoniae serotype 15B capsular polysaccharide - CRM 197 Conjugate

[0316]

[0317]

[0318] The percentage of free polysaccharide was measured by a method that utilizes aluminum hydroxide gel to bind protein and covalently bound sugar for removal by centrifugation. The sample was mixed with phosphate - buffered aluminum hydroxide gel and centrifuged. The bound sugar precipitated with the gel while the free sugar remained in the supernatant. The resulting supernatant and control samples were quantified by an appropriate colorimetric assay to determine the proportion of free sugar and to confirm the adequate removal of protein and the recovery of sugar.

[0319] For amino acid analysis, hydrolysis is first carried out using 6N hydrochloric acid (HCl), heating under vacuum (160 °C, 15 minutes), to hydrolyze the polysaccharide-protein sample into its individual components, hydrolyzing to free amino acids. After hydrolysis, the sample is analyzed using an amino acid analyzer. The individual amino acids are separated by ion exchange chromatography, using a discontinuous gradient of sodium citrate buffer, with changes in temperature and flow rate. After separation, the amount of each amino acid residue is quantitatively determined using a post-column ninhydrin coupling detection system. In this system, ninhydrin is mixed with the column eluate in the post-column reactor system and the mixture enters a photometer. The reaction of ninhydrin with the eluted amino acids yields a purple compound with a maximum absorption at 570 nm. This absorbance is a linear response (function) of the amount of α-amino groups present and the reaction provides a quantitative colorimetric determination for all organic compounds with an α-amino group. In the reaction with sub-amino acids (such as proline and hydroxyproline) that do not have a free amino group, a bright yellow compound is produced and monitored at 440 nm. The peak area of each amino acid is calculated using both the 570 and 440 nm wavelength outputs.

[0320] The yield is calculated as follows: (amount of polysaccharide in the conjugate × 100) / amount of activated polysaccharide.

[0321] Conjugates (4 and 5) produced using an aqueous medium showed a significant loss in the O-acetyl level. Conjugates (6 and 7) produced using native polysaccharides in DMSO solvent without molecular weight tailoring did not show a loss in the O-acetyl level. However, in addition to the poor filterability characteristic, the conjugate yield was also very poor. Conjugates (1, 2, and 3) produced using polysaccharides tailored by high-pressure homogenization in DMSO had a higher yield and better filterability characteristics and significantly preserved the O-acetyl level. These conjugates also had a very low level of free polysaccharide.

[0322] Example 3: Opsonophagocytic activity (OPA) assay

[0323] The immunogenicity of the conjugates of the present invention can be evaluated using the opsonophagocytic assay (OPA) described below.

[0324] A group of 30 female Swiss Webster mice, 6 - 7 weeks old, were immunized via the subcutaneous route at week 0 with 0.001 μg, 0.01 μg, or 0.1 μg of the test conjugate. The mice were boosted with the same dose of the conjugate at week 3 and then bled at week 4. Serum samples at week 4 were subjected to serotype-specific OPA.

[0325] The OPA was used to measure functional antibodies in murine sera specifically directed against Streptococcus pneumoniae serotype 15B. Test sera were set up in an assay reaction that measured the following capabilities of capsular polysaccharide-specific immunoglobulins: opsonizing bacteria, triggering complement deposition, thereby promoting phagocytosis and killing of bacteria by phagocytic cells. The OPA titer was defined as the reciprocal of the dilution that resulted in a 50% reduction in the number of bacteria in the control wells relative to those without test sera. The OPA titer was interpolated from two dilutions that bracketed this 50% killing cut-off.

[0326] The OPA method was based on the method described in Hu et al., Clin Diagn Lab Immunol 2005; 12 (February(2)): 287–95 and was modified as follows. Test sera were serially diluted 2.5-fold and added to microtiter assay plates. Live serotype 15B target bacteria were added to the wells and the plates were shaken at 37 °C for 30 minutes. Differentiated HL-60 cells (phagocytic cells) and rabbit sera (3 - 4 weeks old, at a final concentration of 6.25%) were added to the wells and the plates were shaken at 37 °C for 45 minutes. To terminate the reaction, 80 μL of 0.9% NaCl was added to all wells, mixed, and 10 μL aliquots were transferred to wells of a MultiScreen HTS HV filter plate containing 200 μL of water. The liquid was filtered through the plate under vacuum and 150 μL of HySoy medium was added to each well and filtered through. The filter plate was then incubated overnight at 37 °C, 5% CO 2 and subsequently fixed with Destain solution (Bio-Rad). The plates were then stained with Coomassie blue and decolorized once. Colonies were imaged and counted on a Cellular Technology Limited (CTL) ImmunoSpot Killing curves were plotted using the raw colony counts and the OPA titers were calculated.

[0327] The immunogenicity of conjugates 1 and 2 was tested according to the assay described above. An additional conjugate and unconjugated native Streptococcus pneumoniae serotype 15B capsular polysaccharide (unconjugated PS) were also tested in the same assay:

[0328] Conjugate 9 was prepared by reductive amination in aqueous solution of native (i.e., untruncated) serotype 15B capsular polysaccharide conjugated to CRM 197 .

[0329] The results are shown in Table 2.

[0330] Table 2: OPA Titers from Animal Tests

[0331]

[0332]

[0333] As shown in the table above, conjugates 1 and 2, when administered to mice, generate antibodies that are capable of opsonizing Streptococcus pneumoniae serotype 15B, triggering complement deposition, thereby promoting phagocytosis and killing the bacteria by phagocytes. In addition, despite their lower molecular weight, they also exhibit a similar level of immunogenicity relative to untrimmed conjugate 9.

[0334] Example 4: Cross-functional OPA responses between serotype 15B and serotype 15C

[0335] Pneumococcal serogroup 15 includes four structurally related serotypes: 15A, 15B, 15C, and 15F. Serotypes 15B and 15C cannot be distinguished by genotyping techniques and have similar capsular polysaccharide (PS) compositions, except that 15B-PS is an O-acetylated variant of 15C-PS. To understand whether anti-capsular PS antibodies against serotype 15B are functionally cross-reactive with serotype 15C, 10 rabbits were immunized with PCV16v and PCV20v vaccines (both containing immunogenic conjugates of Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to CRM 197 as part of their formulations). Sera from before and after vaccination were tested against serotype 15B and 15C target pneumococcal strains in an OPA assay.

[0336] After immunization with the serotype 15B conjugate, 100% of the 10 rabbits from each group had an OPA response to serotype 15B. In these same samples, 100% also had an OPA response to serotype 15C (Tables 3 and 4). Low OPA titers were observed in the pre-vaccination sera in the 15C OPA. However, the post-vaccination sera had more than a 10-fold increase in GMT OPA titers compared to pre-vaccination, indicating that the immunogenic conjugates of the present invention induce the formation of antibodies in the OPA that are capable of killing Streptococcus pneumoniae serotypes 15B and 15C.

[0337] PCV16v is a 16-valent conjugate composition that contains saccharide conjugates from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F (16vPnC) (all individually conjugated to CRM 197 ).

[0338] PCV20v is a 20-valent conjugate composition that contains saccharide conjugates from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F (20vPnC) (all individually conjugated to CRM 197 ).

[0339] Table 3. OPA Titers against Serotype 15B and 15C Strains in Rabbit Serum before and after Inoculation with PCV16v

[0340]

[0341] Table 4. OPA Titers against Serotype 15B and 15C Strains in Rabbit Serum before and after Inoculation with PCV20v

[0342]

[0343]

[0344] *Titer could not be determined due to poor kill curve

[0345] In summary, the present application provides the following embodiments:

[0346] 1. An isolated Streptococcus pneumoniae serotype 15B capsular polysaccharide, wherein each mM of the serotype 15B capsular polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate.

[0347] 2. An isolated Streptococcus pneumoniae serotype 15B capsular polysaccharide having a molecular weight of 5 kDa - 500 kDa.

[0348] 3. The polysaccharide according to embodiment 2, having a molecular weight of 100 kDa - 350 kDa.

[0349] 4. An isolated Streptococcus pneumoniae serotype 15B capsular polysaccharide, wherein each mM of the serotype 15B capsular polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM glycerol.

[0350] 5. The polysaccharide according to any one of embodiments 1 - 4, wherein each mM of the serotype 15B capsular polysaccharide contains at least 0.6 mM acetate.

[0351] 6. The polysaccharide according to any one of embodiments 1 - 5, wherein each mM of the serotype 15B capsular polysaccharide contains at least 0.6 mM glycerol.

[0352] 7. An immunogenic conjugate comprising an isolated Streptococcus pneumoniae serotype 15B capsular polysaccharide according to any one of embodiments 1-6 covalently linked to a carrier protein.

[0353] 8. The immunogenic conjugate according to embodiment 7, wherein the carrier protein is CRM 197 .

[0354] 9. The immunogenic conjugate according to embodiment 7 or 8, wherein the immunogenic conjugate comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20% or 15% free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide.

[0355] 10. The immunogenic conjugate according to any one of embodiments 7-9, wherein the immunogenic conjugate comprises less than about 40% free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide.

[0356] 11. The immunogenic conjugate according to any one of embodiments 7-10, wherein the immunogenic conjugate comprises less than about 20% free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide.

[0357] 12. The immunogenic conjugate according to any one of embodiments 7-11, wherein the immunogenic conjugate has a molecular weight of 3000-20000 kDa, 8000-20000 kDa, 8000-16000 kDa or 10000-16000 kDa.

[0358] 13. The immunogenic conjugate according to any one of embodiments 7-12, wherein the immunogenic conjugate has a molecular weight of 10000-16000 kDa.

[0359] 14. The immunogenic conjugate according to any one of embodiments 7-13, wherein the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.4-2.

[0360] 15. The immunogenic conjugate according to any one of embodiments 7-13, wherein the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.7-0.9.

[0361] 16. The immunogenic conjugate according to any one of embodiments 7-15, wherein at least 40% of the immunogenic conjugate has a Kd less than or equal to 0.3 in a CL-4B column.

[0362] 17. The immunogenic conjugate according to any one of embodiments 7-15, wherein at least 50% of the immunogenic conjugate has a Kd less than or equal to 0.3 in a CL-4B column.

[0363] 18. An immunogenic conjugate according to any one of embodiments 7-15, wherein at least 60% of the immunogenic conjugate has a Kd of less than or equal to 0.3 in a CL-4B column.

[0364] 19. An immunogenic conjugate according to any one of embodiments 7-17, wherein the degree of conjugation is 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15 or 10-12.

[0365] 20. An immunogenic conjugate according to any one of embodiments 7-17, wherein the degree of conjugation is 2-6.

[0366] 21. An immunogenic conjugate according to any one of embodiments 7-17, wherein the degree of conjugation is 3-5.

[0367] 22. An immunogenic composition comprising an immunogenic conjugate according to any one of embodiments 7-21 and a physiologically acceptable vehicle.

[0368] 23. The immunogenic composition according to embodiment 22, further comprising at least one additional antigen.

[0369] 24. The immunogenic composition according to embodiment 22 or 23, further comprising an adjuvant.

[0370] 25. The immunogenic composition according to embodiment 24, wherein the adjuvant is aluminum phosphate.

[0371] 26. A vaccine comprising an immunogenic composition according to any one of embodiments 22-25.

[0372] 27. A method for producing a polysaccharide according to any one of embodiments 1-6, the method comprising the following steps:

[0373] (a) Preparing a fermentation culture of Streptococcus pneumoniae serotype 15B bacterial cells;

[0374] (b) Lysing the bacterial cells in the fermentation culture;

[0375] (c) Purifying Streptococcus pneumoniae serotype 15B capsular polysaccharide from the fermentation culture;

[0376] (d) Tailoring the purified Streptococcus pneumoniae serotype 15B capsular polysaccharide by high-pressure homogenization.

[0377] 28. A method for producing an activated capsular polysaccharide of Streptococcus pneumoniae serotype 15B, the method comprising the step of reacting the isolated capsular polysaccharide of Streptococcus pneumoniae serotype 15B of any one of embodiments 1-6 with an oxidizing agent.

[0378] 29. The method according to embodiment 28, wherein the method comprises reacting the isolated capsular polysaccharide of Streptococcus pneumoniae serotype 15B with 0.1-0.3 molar equivalents of sodium periodate at a temperature of 20-25 °C for 15-20 hours.

[0379] 30. An activated capsular polysaccharide of serotype 15B, which is obtained or can be obtained by the method of embodiment 28 or 29.

[0380] 31. An activated capsular polysaccharide of serotype 15B, which has a molecular weight of about 5-500 kDa, about 50-450 kDa, about 100-400 kDa, about 100-350 kDa, about 100-300 kDa.

[0381] 32. The activated polysaccharide according to embodiment 31, wherein each mM of the capsular polysaccharide of serotype 15B contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM of acetate.

[0382] 33. The activated polysaccharide according to embodiment 31, wherein each mM of the capsular polysaccharide of serotype 15B contains at least 0.6 mM of acetate.

[0383] 34. The activated polysaccharide according to any one of embodiments 31-33, wherein each mM of the capsular polysaccharide of serotype 15B contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM of glycerol.

[0384] 35. The activated polysaccharide according to any one of embodiments 31-34, wherein each mM of the capsular polysaccharide of serotype 15B contains at least 0.6 mM of glycerol.

[0385] 36. The activated polysaccharide according to any one of embodiments 31-35, characterized in that the degree of oxidation is 2-20, 2-15, 2-10, 2-5, 5-20, 5-15, 5-10, 10-20, 10-15, or 15-20.

[0386] 37. The activated polysaccharide according to any one of embodiments 31-36, characterized in that the degree of oxidation is 5-15.

[0387] 38. The activated polysaccharide according to any one of embodiments 31-36, characterized in that the degree of oxidation is 10-20.

[0388] 39. An activated polysaccharide according to any one of embodiments 31 - 36, characterized in that the degree of oxidation is 15 - 20.

[0389] 40. An activated polysaccharide according to any one of embodiments 31 - 36, characterized in that the degree of oxidation is 10 - 15.

[0390] 41. A method for preparing an immunogenic conjugate comprising a Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein, the method comprising the steps of:

[0391] (a) Mixing an activated polysaccharide according to any one of embodiments 30 - 40 with a carrier protein;

[0392] and

[0393] (b) Reacting the mixed activated polysaccharide and carrier protein with a reducing agent to form a serotype 15B capsular polysaccharide - carrier protein conjugate.

[0394] 42. The method according to embodiment 41, wherein the carrier protein is CRM 197 .

[0395] 43. The method according to embodiment 41 or 42, wherein steps (a) and (b) are carried out in DMSO.

[0396] 44. The method according to embodiment 41 or 42, wherein steps (a) and (b) are carried out in an aqueous solution.

[0397] 45. The method according to any one of embodiments 41 - 44, wherein the concentration of the activated serotype 15B capsular polysaccharide in step (b) is 0.1 - 10 mg / mL, 0.5 - 5 mg / mL, 0.5 - 2 mg / mL.

[0398] 46. The method according to any one of embodiments 41 - 44, wherein the concentration of the activated serotype 15B capsular polysaccharide in step (b) is 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 or 3 mg / mL.

[0399] 47. The method according to any one of embodiments 41 - 44, wherein the concentration of the activated serotype 15B capsular polysaccharide in step (b) is about 0.5 mg / mL.

[0400] 48. The method according to any one of embodiments 41 - 44, wherein the concentration of the activated serotype 15B capsular polysaccharide in step (b) is about 1 mg / mL.

[0401] 49. The method according to any one of embodiments 41-44, wherein the concentration of the activated serotype 15B capsular polysaccharide in step (b) is about 1.5 mg / mL.

[0402] 50. The method according to any one of embodiments 41-44, wherein the concentration of the activated serotype 15B capsular polysaccharide in step (b) is about 2 mg / mL.

[0403] 51. The method according to any one of embodiments 41-50, wherein the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is 5:1 - 0.1:1, 2:1 - 0.1:1, 2:1 - 1:1, 1.5:1 - 1:1, 0.1:1 - 1:1, 0.3:1 - 1:1, 0.6:1 - 1:1 or 0.6:1 - 1.5:1.

[0404] 52. The method according to any one of embodiments 41-50, wherein the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1 or 2:1.

[0405] 53. The method according to any one of embodiments 41-50, wherein the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is about 0.6:1.

[0406] 54. The method according to any one of embodiments 41-50, wherein the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is about 0.8:1.

[0407] 55. The method according to any one of embodiments 41-50, wherein the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is about 1:1.

[0408] 56. The method according to any one of embodiments 41-50, wherein the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is about 1.5:1.

[0409] 57. The method according to any one of embodiments 41-50, wherein the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is about 2:1.

[0410] 58. The method according to any one of embodiments 41-57, wherein in step (b), the activated polysaccharide reacts with about 1-2 molar equivalents of sodium cyanoborohydride at a temperature of about 20-26 °C for about 40-50 hours.

[0411] 59. A method according to any one of embodiments 41 - 58, wherein the method further comprises the following additional steps:

[0412] (c) Capping unreacted aldehydes by adding NaBH 4 to cap unreacted aldehydes.

[0413] 60. A method according to any one of embodiments 41 - 59, wherein the method further comprises the step of formulating the conjugate in a multivalent vaccine.

[0414] 61. A method according to any one of embodiments 41 - 60, wherein the yield of conjugation step (b) is greater than 50%.

[0415] 62. A method according to any one of embodiments 41 - 60, wherein the yield of conjugation step (b) is greater than 60%.

[0416] 63. An immunogenic conjugate obtainable or obtained by a method according to any one of embodiments 41 - 62.

[0417] 64. The immunogenic conjugate according to embodiment 63, wherein the immunogenic conjugate comprises less than about 40% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide.

[0418] 65. The immunogenic conjugate according to any one of embodiments 63 - 64, wherein the immunogenic conjugate comprises less than about 20% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide.

[0419] 66. The immunogenic conjugate according to any one of embodiments 63 - 65, wherein the immunogenic conjugate has a molecular weight of 3000 - 20000 kDa, 5000 - 10000 kDa, 5000 - 20000 kDa, 8000 - 20000 kDa, 8000 - 16000 kDa or 10000 - 16000 kDa.

[0420] 67. The immunogenic conjugate according to any one of embodiments 61 - 66, wherein the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.4 - 2.

[0421] 68. The immunogenic conjugate according to any one of embodiments 61 - 65, wherein the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.7 - 0.9.

[0422] 69. The immunogenic conjugate according to any one of embodiments 61 - 68, wherein at least 40% of the immunogenic conjugate has a Kd less than or equal to 0.3 in a CL - 4B column.

[0423] 70. An immunogenic conjugate according to any one of embodiments 61 - 68, wherein at least 60% of the immunogenic conjugate has a Kd of less than or equal to 0.3 in a CL - 4B column.

[0424] 71. An immunogenic conjugate according to any one of embodiments 61 - 70, wherein the degree of conjugation is 2 - 15, 2 - 13, 2 - 10, 2 - 8, 2 - 6, 2 - 5, 2 - 4, 3 - 15, 3 - 13, 3 - 10, 3 - 8, 3 - 6, 3 - 5, 3 - 4, 5 - 15, 5 - 10, 8 - 15, 8 - 12, 10 - 15 or 10 - 12.

[0425] 72. An immunogenic conjugate according to any one of embodiments 61 - 70, wherein the degree of conjugation is 2 - 6.

[0426] 73. An immunogenic conjugate according to any one of embodiments 61 - 72, wherein the ratio of the mM of acetate per mM of serotype 15B capsular polysaccharide in the immunogenic conjugate to the mM of acetate per mM of serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9 or 0.95, preferably at least 0.7 or at least 0.9.

[0427] 74. An immunogenic conjugate according to any one of embodiments 61 - 72, wherein the ratio of the mM of acetate per mM of serotype 15B capsular polysaccharide in the immunogenic conjugate to the mM of acetate per mM of serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9 or 0.95, preferably at least 0.7 or at least 0.9.

[0428] 75. An immunogenic composition comprising an immunogenic conjugate according to any one of embodiments 61 - 74 and a physiologically acceptable vehicle.

[0429] 76. A vaccine comprising the immunogenic composition according to embodiment 75.

[0430] 77. A method of protecting a subject from infection with Streptococcus pneumoniae serotype 15B, the method comprising administering to the subject an immunogenic amount of an immunogenic composition according to any one of embodiments 22 - 25 or 75 or a vaccine according to embodiment 26 or 76.

[0431] 78. A method of treating or preventing pneumococcal infections, diseases or conditions in a subject associated with Streptococcus pneumoniae serotype 15A, 15B and / or 15C, the method comprising the step of administering a therapeutically or prophylactically effective amount of an immunogenic composition according to any one of embodiments 22 - 25 or 75 or a vaccine according to embodiment 26 or 76.

[0432] 79. A method for treating or preventing pneumococcal infections, diseases or conditions associated with Streptococcus pneumoniae serotype 15B and / or 15C in a subject, the method comprising the step of administering a therapeutically or prophylactically effective amount of the immunogenic composition of any one of embodiments 22-25 or 75 or the vaccine of embodiment 26 or 76.

[0433] 80. A method for treating or preventing pneumococcal infections, diseases or conditions associated with Streptococcus pneumoniae serotype 15B in a subject, the method comprising the step of administering a therapeutically or prophylactically effective amount of the immunogenic composition of any one of embodiments 22-25 or 75 or the vaccine of embodiment 26 or 76.

Claims

1. A method for preparing an immunogenic conjugate, the conjugate comprising a Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein, the method comprising the steps of: (a) mixing an activated serotype 15B capsular polysaccharide with a carrier protein, wherein the activated polysaccharide is obtained by a method comprising the steps of: reacting an isolated Streptococcus pneumoniae serotype 15B capsular polysaccharide containing at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide with an oxidizing agent, wherein the activated polysaccharide has a molecular weight of about 100 - 300 kDa; and (b) reacting the mixed activated polysaccharide and carrier protein with a reducing agent to form a serotype 15B capsular polysaccharide - carrier protein conjugate; wherein steps (a) and (b) are carried out in DMSO.

2. The method according to claim 1, wherein the carrier protein is CRM 197 .

3. The method according to claim 1, wherein the concentration of the activated serotype 15B capsular polysaccharide in step (b) is 0.1 - 10 mg / mL, 0.5 - 5 mg / mL or 0.5 - 2 mg / mL.

4. The method according to claim 1, wherein the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is 5:1 - 0.1:1, 2:1 - 0.1:1, 2:1 - 1:1, 1.5:1 - 1:1, 0.1:1 - 1:1, 0.3:1 - 1:1, 0.6:1 - 1:1 or 0.6:1 - 1.5:

1.

5. The method according to claim 1, wherein in step (b), the activated polysaccharide is reacted with about 1 - 2 molar equivalents of sodium cyanoborohydride at a temperature of about 20 - 26 °C for about 40 - 50 hours.

6. The method according to claim 1, wherein the method further comprises the following additional steps: (c) By adding NaBH 4 to cap unreacted aldehydes.

7. The method according to claim 1, wherein the oxidizing agent is periodate.

8. The method according to claim 1, wherein the oxidizing agent is sodium periodate.

9. The method according to claim 1, wherein the oxidizing agent is sodium metaperiodate.

10. The method according to claim 1, wherein the yield of the conjugation step (b) is greater than 50%.

11. The method according to claim 1, wherein the method further comprises the step of formulating the conjugate in a multivalent vaccine.

12. An immunogenic conjugate obtained by the method according to any one of claims 1 - 11.

13. The immunogenic conjugate according to claim 12, wherein the immunogenic conjugate comprises less than about 40% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide.

14. The immunogenic conjugate according to claim 12, wherein the immunogenic conjugate has a molecular weight of 3000 - 20000 kDa, 5000 - 10000 kDa, 5000 - 20000 kDa, 8000 - 20000 kDa, 8000 - 16000 kDa or 10000 - 16000 kDa.

15. The immunogenic conjugate according to claim 12, wherein the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.4 - 2.

16. The immunogenic conjugate according to claim 12, wherein at least 40% of the immunogenic conjugate has a Kd of less than or equal to 0.3 in a CL-4B column.

17. The immunogenic conjugate according to claim 12, wherein the degree of conjugation is 2 - 15, 2 - 13, 2 - 10, 2 - 8, 2 - 6, 2 - 5, 2 - 4, 3 - 15, 3 - 13, 3 - 10, 3 - 8, 3 - 6, 3 - 5, 3 - 4, 5 - 15, 5 - 10, 8 - 15, 8 - 12, 10 - 15 or 10 - 12.

18. The immunogenic conjugate according to claim 12, wherein the ratio of the mM of acetate per mM of serotype 15B capsular polysaccharide in the immunogenic conjugate to the mM of acetate per mM of serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9 or 0.95, preferably at least 0.7 or at least 0.

9.

19. An immunogenic composition comprising the immunogenic conjugate according to any one of claims 12 - 18 and a physiologically acceptable vehicle.

20. A vaccine comprising the immunogenic composition according to claim 19.

21. Use of the immunogenic composition according to claim 19 in the preparation of a vaccine for protecting a subject from infection with Streptococcus pneumoniae serotype 15B.

22. Use of the immunogenic composition according to claim 19 in the preparation of a vaccine for treating or preventing a Streptococcus pneumoniae infection, disease or condition associated with Streptococcus pneumoniae serotype 15B in a subject, said treatment or prevention comprising the step of administering a therapeutically or prophylactically effective amount of the immunogenic composition or the vaccine.

Images