Polyphosphokinase mutant and application thereof in synthesis of beta-nicotinamide mononucleotide

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a polyphosphate kinase mutant and application thereof in synthesis of beta-nicotinamide mononucleotide, and the polyphosphate kinase mutant is obtained by single-point or multi-point mutation of 99th, 186th, 190th and 204th amino acids of polyphosphatase with an amino acid sequence shown as SEQ ID NO.1. The invention also relates to a preparation method of the polyphosphate kinase mutant, and the application of the polyphosphate kinase mutant in synthesis of beta-nicotinamide mononucleotide in synthesis of beta-nicotinamide mononucleotide in synthesis of beta-nicotinamide mononucleotide in synthesis of beta-nicotinamide mononucleotide. Polyphosphokinase derived from Lampropedia Hyalina DSM 16112 is subjected to molecular modification to obtain multiple mutants, the enzyme activity of the mutants is improved by 1.5-14 times compared with that of wild type polyphosphokinase, the preference of the mutants to AMP is improved by 1.08-4.88 times compared with that of the wild type polyphosphokinase, and an ATP regeneration system constructed by the mutants can remarkably reduce the use amount of enzyme and reduce the fermentation capacity and cost; the reaction time can be greatly shortened, the influence of AMP on the enzyme activity is reduced, the requirements of large-scale industrial production of NMN prepared by adopting a biological enzyme method can be met, and the method has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and particularly relates to a polyphosphate kinase mutant and its application in the synthesis of β-nicotinamide mononucleotide. Background Art

[0002] In the production of the functional product NMN (β-nicotinamide mononucleotide), ATP is a crucial cofactor. NMN is a precursor molecule of nicotinamide adenine dinucleotide (NAD+), and has important physiological functions such as anti-aging and metabolic regulation, and the market demand is growing rapidly. The synthesis of NMN by biocatalysis is favored due to its environmental friendliness and high efficiency. The core step involves the catalytic reaction of nicotinamide phosphoribosyltransferase (NAMPT), which requires a large amount of ATP support. In this pathway, the consumption of ATP usually generates a large amount of AMP and a small amount of ADP. This accumulation not only reduces the overall reaction efficiency but also increases the subsequent processing cost. Therefore, developing an ATP regeneration system that can efficiently utilize AMP is the key to solving such problems.

[0003] Polyphosphate kinase (PPK) uses polyphosphate (PolyP) to generate high-energy phosphate compounds, and is divided into two major categories: PPK1 and PPK2. PPK1 has a bidirectional catalytic function and can convert polyphosphate and nucleoside triphosphates to each other, and is commonly used in classical ATP regeneration systems. The function of PPK2 is more diverse and is divided into three subtypes according to substrate preference: PPK2-I prefers AMP and generates ATP; PPK2-II prefers ADP and generates ATP; PPK2-III has a wide substrate range and catalyzes the generation of ATP from AMP, ADP, etc. It provides an important technical basis for developing ATP regeneration systems that meet various biocatalytic requirements.

[0004] Applying the optimized PPK mutant to the ATP regeneration system and working in cooperation with NMN biosynthetic enzymes, the constructed engineering bacteria can efficiently regenerate ATP and realize the recycling of AMP. This system has significant advantages in both economy and efficiency. It not only improves the yield and purity of NMN, but also significantly reduces the addition amount of exogenous ATP and lowers the overall production cost. In short, by developing highly efficient polyphosphate kinase mutants and using them to construct an ATP regeneration system, the problem of high cofactor cost in industrial production can be effectively solved. Especially in the biosynthesis of NMN, this system shows significant advantages, not only improving economic benefits but also promoting the progress of green and sustainable production technologies. This research direction provides important support for the large-scale production and application of functional molecules and has broad application prospects. Summary of the Invention

[0005] In view of the need for developing highly efficient polyphosphate kinase mutants in the prior art, the present invention provides a polyphosphate kinase mutant and its application in the synthesis of β-nicotinamide mononucleotide. The specific technical solutions are as follows:

[0006] In the first aspect, the present invention provides a polyphosphate kinase mutant, which is obtained by single-point or multi-point mutation of the 99th, 186th, 190th, and 204th amino acids of the polyphosphatase with the amino acid sequence shown in SEQ ID NO.1.

[0007] Further, the mutation form of the polyphosphatase mutant is one of the following:

[0008] (1) The 99th alanine is mutated to aspartic acid, glutamine, or serine;

[0009] (2) The 186th glutamic acid is mutated to alanine or glutamine;

[0010] (3) The 190th aspartic acid is mutated to alanine, valine, arginine, or threonine;

[0011] (4) The 204th aspartic acid is mutated to alanine, cysteine, histidine, or lysine;

[0012] (5) The 186th glutamic acid is mutated to alanine, and the 204th aspartic acid is mutated to alanine;

[0013] (6) The 99th alanine is mutated to aspartic acid, the 186th glutamic acid is mutated to alanine, and the 204th aspartic acid is mutated to alanine;

[0014] (7) The 99th alanine is mutated to aspartic acid, the 186th glutamic acid is mutated to alanine, the 190th aspartic acid is mutated to arginine, and the 204th aspartic acid is mutated to alanine.

[0015] The present invention aims at the polyphosphate kinase (LhPPK) derived from Lampropedia Hyalina DSM 16112. The three-dimensional structure of LhPPK is simulated by macromolecular modeling technology, and one or more sites related to catalysis are predicted by molecular docking technology. After selecting the site for site-directed mutagenesis and the type of mutated amino acid, the corresponding primers are synthesized by Hangzhou Qingke Biotechnology Co., Ltd. Using the pET 28a(+) vector plasmid as a template, the mutated DNA fragment is amplified by PCR (Polymerase Chain Reaction), separated and purified, and then the obtained fragment is amplified into a full-length mutated gene by PCR. By cloning the full-length mutated gene onto the pET-28a(+) vector and transferring it into the DH5α host bacterium, positive clones with the mutated gene vector are screened out through cultivation. Finally, plasmid DNA is extracted from the positive clones for DNA sequence determination and analysis to determine the introduced mutations. The screened positive plasmids are transferred into the BL21(DE3) host bacterium for induced expression, and mutants with significantly improved activity are screened out from them. Using pET-28a(+)-LhPPK as a template, it is modified by site-directed saturation mutagenesis and the beneficial mutations screened are combined together. Through enzyme activity determination, an LhPPK mutant with strong AMP preference is finally obtained, and the catalytic efficiency of this mutant for AMP is also improved.

[0016] In a second aspect, the present invention provides a gene encoding the above polyphosphate kinase mutant.

[0017] In a third aspect, the present invention provides a recombinant vector containing the above gene.

[0018] In a fourth aspect, the present invention provides a genetically engineered bacterium containing the above gene.

[0019] In a fifth aspect, the present invention provides an ATP regeneration system, including an enzyme and a substrate;

[0020] The enzyme includes the above polyphosphate kinase mutant;

[0021] The substrate includes polyphosphate and an adenosine phosphate substrate.

[0022] Furthermore, the reaction temperature of the ATP regeneration system is 35 - 45 °C.

[0023] Furthermore, the ATP regeneration system further includes a buffer solution.

[0024] Even further, the buffer solution is one of phosphate buffer solution, potassium phosphate buffer solution, citric acid - sodium citrate buffer solution, and borax - boric acid buffer solution.

[0025] Further, the pH of the buffer solution is 6.0 to 8.5.

[0026] In a sixth aspect, the present invention provides the use of the above-mentioned polyphosphate kinase mutant or the above-mentioned ATP regeneration system in the production of β-nicotinamide mononucleotide.

[0027] In a seventh aspect, the present invention provides a method for enzymatically preparing β-nicotinamide mononucleotide, using ribose, adenosine triphosphate, and nicotinamide as substrates, and using ribokinase, phosphoribosyl pyrophosphate synthetase, nicotinamide ribosyltransferase, and the above-mentioned polyphosphate kinase mutant as catalysts to form a reaction system for catalytic preparation of β-nicotinamide mononucleotide.

[0028] Further, in the reaction system, the pH is 6.5 to 8.5, and the temperature is 35 to 45 °C.

[0029] More specifically, in the reaction system, the pH is 7.5 and the temperature is 37 °C.

[0030] Further, the reaction system further includes a buffer solution.

[0031] More specifically, the buffer solution is one of phosphate buffer solution, potassium phosphate buffer solution, citric acid-sodium citrate buffer solution, and borax-boric acid buffer solution.

[0032] Further, the ribokinase (RK) is derived from Escherichia coli, and the GenBank accession number is EFH2707387.1; the phosphoribosyl pyrophosphate synthetase (PRS) is derived from Bacillus amyloliquefaciens, and the GenBank accession number is ADU02858.1; the nicotinamide ribosyltransferase (Nampt) is derived from Chitinophaga pinensis, and the GenBank accession number is WP_012788281.1.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] The present invention performs molecular modification on the polyphosphate kinase derived from Lampropedia Hyalina DSM 16112 to obtain a variety of mutants. The enzyme activities of these mutants are increased by 1.5 to 14 times compared with the wild-type polyphosphate kinase, and the preference for AMP is increased by 1.08 - 4.88 times compared with the wild-type polyphosphate kinase. The ATP regeneration system constructed thereby can significantly reduce the enzyme usage amount, reduce the fermentation volume and cost; and can greatly shorten the reaction time, reduce the influence of AMP on the enzyme activity, and can meet the requirements of large-scale industrial production of NMN by using bioenzymatic method, and has broad application prospects. Description of the Drawings

[0035] Figure 1Statistical chart of the relative enzyme activity of the polyphosphate kinase mutant A99S / E186A / D190R / D204A in catalyzing the formation of ATP from AMP at different temperatures.

[0036] Figure 2 Statistical chart of the relative enzyme activity of the polyphosphate kinase mutant A99S / E186A / D190R / D204A in catalyzing the formation of ATP from AMP at different pH values.

[0037] Figure 3 Schematic diagram of the reaction process for producing NMN using a reaction system containing the polyphosphate kinase mutant A99S / E186A / D190R / D204A. Detailed implementation mode

[0038] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed description is exemplary and only a part of the embodiments of the present invention, rather than all of the embodiments.

[0039] All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0040] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs. The experimental materials used in the embodiments of the present invention are all conventional experimental materials in the art and can be obtained through commercial channels. The experimental methods without detailed conditions are carried out according to conventional experimental methods or according to the operation manuals recommended by the suppliers.

[0041] Composition of LB plate: 10 g / L tryptone, 10 g / L sodium chloride, 5 g / L yeast extract, 15 g / L agar, with water as the solvent and natural pH.

[0042] Composition of LB liquid medium: 10 g / L tryptone, 10 g / L sodium chloride, 5 g / L yeast extract, with water as the solvent and natural pH.

[0043] In the following embodiments, during the production of NMN, the types of enzymes used are as follows:

[0044] PPK: Derived from Lampropedia Hyalina DSM 16112, GenBank number: SHF67157.1, with the nucleotide sequence shown in SEQ ID NO.1 and the amino acid sequence shown in SEQ ID NO.2;

[0045] RK: Derived from Escherichia coli, GenBank accession number: EFH2707387.1;

[0046] PRS: Derived from Bacillus amyloliquefaciens, GenBank accession number: ADU02858.1;

[0047] Nampt: Derived from Chitino phagapinensis, GenBank accession number: WP_012788281.1.

[0048] SEQ ID NO.1:

[0049] ATGACTCGTAAAGAAAGTCCGCCGATGGAAGCATTCAAGAAATACCGCATCAGTCCGAAGAACACTCTGAAAGACATCGATCCAAGCGACAAACCGTTCAGCTTCGGCACCAAGAAAGACGAACTGCAACGTCTGGATGAACTGGCTGTTGAACTGGACGATCTGCAAAACACTCTGTACGCGGGTAAACGTCGTAAAGTTCTGCTGATTCTGCAAGGTCTGGACACCTCTGGTAAAGACGGTACTATCCGTTGGGTGTTCAGCCGTACCTCTCCGCTGGGTGTTCACGTTGCTGCATTCAAAGCACCAAGCGAACGTGAACGTGCGCACGACTTCTTGTGGCGTTGCCACGCGGTTGTACCGGCAAACGGTGAACTGACCGTTTGGAACCGTTCTCACTACGAAGATGTTCTGGTTCCGCCAGTGGAAGGTTGGATCGATAAAGCGGAAACTCAGCGTCGTTACGGTCACATCAACGACTTCGAACGTCTGCTGTCCGAAACCGGCACTACCATCGTTAAATGCATGCTGCACATCTCCAACGAAGAACAGCGTGAACGTCTGCAAGACCGTCTGAAAGATCCGGGCAAAAACTGGAAATTCGCAGCAGATGACCTGTCTACTCGTGCGAAATGGAACGACTACCAGCGTGCATACGAACAGGCACTGCAAGCAACTTCTACTCCGCACGCTCCGTGGTACGTTATTCCGGCGAACAGCAAACGTCACCGTAACCTGATGGTTGCTCAGCTGCTGGTTCAGACTCTGCGTGATATGAAACTGCGTCTGCCACCGCCAAACCTGGCATTCAAAGACCTGGTTGTTAAC

[0050] SEQ ID NO.2:

[0051] MTRKESPPMEAFKKYRISPKNTLKDIDPSDKPFSFGTKKDELQRLDELAVELDDLQNTLYAGKRRKVLLILQGLDTSGKDGTIRWVFSRTSPLGVHVAAFKAPSERERAHDFLWRCHAVVPANGELTVWNRSHYEDVLVPPVEGWIDKAETQRRYGHINDFERLLSETGTTIVKCMLHISNEEQRERLQDRLKDPGKNWKFAADDLSTRAKWNDYQRAYEQALQATSTPHAPWYVIPANSKRHRNLMVAQLLVQTLRDMKLRLPPPNLAFKDLVVN。

[0052] Example 1 Construction of wild-type E. coli BL21(DE3)-LhPPK

[0053] According to the PPK protein sequence (LhPPK, GenBank No.: SHF67157.1) from Lampropedia Hyalina DSM 16112 in GenBank, it was optimized for E. coli codon preference and a 6His tag was fused at the C-terminus of the sequence. A recombinant gene LhPPK sequence with a length of 828 bp was synthesized by Hangzhou Qingke Biotechnology Co., Ltd. Its nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0054] The recombinant gene LhPPK was inserted between the NcoI and XhoI restriction sites of pET-28a(+) to obtain the expression plasmid pET28-LhPPK. This expression plasmid was transformed into E. coli BL21(DE3), and spread on an LB plate containing 50 μg / mL kanamycin resistance. It was cultured at 37 °C for 8 - 12 h, and positive clones were picked, which is the wild-type E. coli BL21(DE3)-LhPPK, used for expressing recombinant LhPPK.

[0055] Example 2 Induced expression of wild-type E. coli BL21(DE3)-LhPPK and extraction of wild-type polyphosphate kinase

[0056] (1) Preparation of wet bacterial cells: The wild-type E. coli BL21(DE3)-LhPPK obtained in Example 1 was inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance, cultured at 37 °C and 180 rpm for 12 h, and then inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin resistance at an inoculation amount of 2% (v / v), cultured at 37 °C and 180 rpm until the OD600 of the bacterial cells reached 0.6, IPTG with a final concentration of 0.1 mM was added, and after inducing culture at 28 °C for 12 h, centrifuged at 4 °C and 8000 rpm for 10 min, the supernatant was discarded, and the precipitate was collected to obtain wet bacterial cells containing recombinant LhPPK expressed.

[0057] (2) Preparation of crude enzyme solution: The wet bacterial cells collected in step (1) were resuspended in a bacterial suspension at a ratio of 50 g / L with 50 mM potassium phosphate buffer (PBS) at pH 7.5, and broken using an ultrasonic cell disruptor with a breaking power of 150 W, working for 1 s and intermittent for 2 s, and broken for a total of 5 min. The cell lysate was collected, centrifuged at 8000 rpm for 10 min, and the supernatant was taken as the crude enzyme solution. The dosage of the subsequent crude enzyme solution was calculated based on the amount of bacterial cells in the bacterial suspension before breaking.

[0058] (3) Preparation of pure enzyme solution: Rinse the nickel column (Ni-NTA) with distilled water, load the crude enzyme solution collected in step (2) with a loading volume of 5 column volumes. After incubation with Ni affinity chromatography resin, rinse with washing buffer (50 mM, pH 8.0 PBS buffer, containing 300 mM NaCl, 50 mM imidazole) until there was basically no impurity protein, and then elute and collect the target protein with elution buffer (50 mM, pH 8.0 PBS buffer, containing 300 mM NaCl, 500 mM imidazole). Then pass the protein through a desalting column (Sephadex G-25) and elute with buffer (pH 8.0, PBS buffer). The collected protein is the pure enzyme solution. Use the BCA protein concentration kit of Beyotime to measure the concentration of the purified enzyme. The purified enzymes used in the subsequent examples were prepared according to the method of this example, and the dosage of the pure enzyme was calculated based on the protein content.

[0059] Determination of enzyme activity in Example 3

[0060] Enzyme activity determination conditions, the total reaction system is 1 mL: final concentration 10 mM AMP / ADP, 20 mM MgCl 2, 20 mM PloyP, 50 μL of pure enzyme solution (protein concentration 0.02 mg / mL), pH 7.5 Tris-HCl buffer. React at 37 °C and 800 rpm for 5 min. Take 100 μL of the supernatant of the reaction solution and add 10 μL of 0.2 M phosphoric acid aqueous solution to terminate the reaction. Centrifuge at 12,000 rpm for 5 min. Take the supernatant and detect the product concentration by high-performance liquid chromatography. The ATP content in the final solution is determined by HPLC method.

[0061] Use a Thermo U3000 high-performance liquid chromatograph to quantitatively detect the concentration of the product ATP through a C18 column (5 μm, 4.6 mm × 250 mm). The mobile phase uses 20 mM potassium phosphate buffer: Weigh 3.48 g of anhydrous K 2 HPO 4 dissolve in 900 mL of ultrapure water, adjust the pH to 7.0 with KH 2 PO 4 and make up the volume to 1 L, filter with a hydrophilic microporous membrane and remove bubbles through an ultrasonic cleaner. The ultraviolet detection wavelength of the sample is 254 nm, the injection volume is 10 μL, the flow rate is 0.8 mL / min, and the column oven is set at 40 °C. Using the peak area data obtained by injecting ATP at different concentrations (0.05 mM, 0.1 mM, 0.5 mM, 1.0 mM, 2.0 mM, 5.0 mM, and 10.0 mM), obtain the standard curve of ATP concentration and peak area. The curve equation is y = y = 118.55x + 12.596 (R 2 = 0.9993), where y is the ATP concentration (mM) and x is the peak area of ATP obtained by liquid phase.

[0062] Definition of enzyme activity: One unit of enzyme activity is defined as the amount of enzyme required to produce 1 μmol of ATP per minute under the above conditions (the first 5 minutes).

[0063] Example 4 Construction, screening and enzyme activity detection of mutants

[0064] Using macromolecular modeling technology, potential beneficial mutation sites were predicted. The primer design is shown in Table 1. Using the vector pET28a(+)-E.coli-LhPPK in E.coli BL21(DE3) / pET28a(+)-E.coli-LhPPK as a template, the Quick-change mutagenesis method was adopted, and the amino acids at each site were mutated using the primers listed in Table 1. Recombinant plasmids pET28a-A99Q, pET28a-E186A, pET28a-D190A, and pET28a-D204H containing single mutants A99Q, E186A, D190A, and D204H were obtained respectively. After completion, the bands were compared by gel electrophoresis, and 1.5 μL of Dpn1 was added to the correct PCR product and digested in a shaker at 37°C for more than 2 h.

[0065] Table 1 Mutation Sites and Primers

[0066]

[0067]

[0068] PCR reaction system (total reaction system is 50 μL): 25 μL of 1×Phanta max Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 0.5 μL of Phanta Max Super-Fidelity DNA Polymerase, 2 μL each of upstream and downstream primers with a concentration of 50 μM, 1 μL of recombinant vector pET28a(+)-E.coli-LhPPK, ddH 2 O 18.5 μL.

[0069] PCR reaction conditions are: pre-denaturation at 95°C for 3 min; then denaturation at 98°C for 10 s, annealing at 58°C for 5 s, and extension at 72°C for 3 min 30 s for one cycle, for a total of 32 cycles.

[0070] 2. Mutant Engineering Bacteria and Crude Enzyme Solution

[0071] The plasmid mutated in step 1 was transformed into the host bacterium E. coli BL21(DE3), and the crude enzyme solution was prepared by the method of Example 2, and the enzyme activity was measured by the method of Example 3. The results are shown in Table 2. When AMP was used as the substrate, the enzyme activities of the D190A and A99Q mutants were increased by about 1-fold and 1.5-fold compared with the wild type. After the E186A mutation, the enzyme activity was significantly increased, about 3 times that of the wild type. Moreover, on the basis of the increased enzyme activity, the E186A mutant significantly changed the preference for the substrate AMP, and the relative enzyme activity of AMP / ADP increased from 0.87 of the wild type to 1.5, proving that these sites had a great influence on the activity and substrate preference of LhPPK. Therefore, saturation mutagenesis studies were carried out on these sites in Example 5.

[0072] Table 2 Specific enzyme activities of LhPPK and its mutants

[0073]

[0074]

[0075] Example 5 Saturation mutagenesis to improve the activity of LhPPK

[0076] 1. Site-directed saturation mutagenesis

[0077] Using the Quick-change mutagenesis method, the pET28-LhPPK plasmid constructed by the method of Example 1 was used as a template, and the primers in Table 3 were used to select sites A99, E186, D190, and D204 for saturation mutagenesis.

[0078] Table 3 Mutation sites and primers

[0079] Primer Primer sequence (5'-3') 99-F TCACGTTGCTNNKTTCAAAGCACCA 99-R TTGAAMNNAGCAACGTGAACACC 186-F GAACAGCGTNNKCGTCTGCAAGAC 186-R AGACGMNNACGCTGTTCTTCGTTG 190-F ACGTCTGCAANNKCGTCTGAAAGAT 190-R AGACGNNKTTGCAGACGTTCACG 204-F CGCAGCAGNNKACCTGTCTACTCGTG 204-R AGGTCMNNTGCTGCGAATTTCCAGTTT

[0080] In the above table, N = A, T, G, C; K = G, T; M = A, C.

[0081] 2. Mutant engineering bacteria and crude enzyme solution

[0082] The plasmid mutated in step 1 was transformed into the host bacterium E. coli BL21(DE3), and the pure enzyme was prepared by the method of Example 2, and the enzyme activity was measured by the method of Example 3.

[0083] The results are shown in Table 4. The enzyme activities of the single-residue mutants containing A99D, A99S, D190A, D190T, D204A, D204C, and E186Q were significantly improved, 1.5-3.6 times that of the wild-type pure enzyme, and the D190R mutant and the D190T mutant significantly changed the preference for the substrate AMP.

[0084] Table 4 Specific enzyme activities of LhPPK and its mutants

[0085]

[0086]

[0087] Example 6 Combinatorial Mutations Based on LhPPK

[0088] On the basis of the mutations in Example 5, some beneficial mutation sites were combined, and specific primers for each site were designed and used respectively (the primer sequences are shown in Tables 1 and 5). The step - by - step overlap PCR technique was used to gradually introduce the mutation sites. First, the double - site mutant strains E186A / D190V (using E186A - F / R and D190A - F / R) and A99G / D190V (using A99Q - F / R and D190A - F / R) were constructed; subsequently, by further introducing the D204A site, the double - site mutant strain E186A / D204A (using E186A - F / R and D204A - F / R) and the triple - site mutant strain E186A / D190V / D204A (using E186A - F / R, D190A - F / R and D204A - F / R) were constructed. On this basis, combined with A99S - F / R in Table 5, the A99 site was introduced, and four multi - site mutant strains A99D / E186A / D204A, A99S / E186A / D204A, A99S / E186A / D190A / D204A and A99S / E186A / D190R / D204A were successfully constructed. Mutants with significantly increased activities towards AMP or ADP were obtained, and the mutation sites of these mutants and their enzyme activities towards AMP and ADP are shown in Table 6.

[0089] Among them, the mutant A99S / E186A / D190R / D204A significantly improved the enzyme activity towards the substrate AMP and substrate preference. Its nucleotide sequence is as shown in SEQ ID NO.3, and the amino acid sequence is as shown in SEQ ID NO.4.

[0090] Table 5 Mutation Sites and Primers

[0091] Primer Primer sequence (5'-3') D204A-F CGCAGCAGCAGACCTGTCTACTCGTG D204A-R AGGTCTGCTGCTGCGAATTTCCAGTTT A99S-F GGTGTTCACGTTGCTAGCTTCAAAGCA A99S-R AGCAACGTGAACACCCAGCGGAGA D190R-F TTGCAGACGTGCACGCTGTTCTTCGTT D190R-R CGTCTGCAACGTCGTCTGAAAGATC

[0092] Table 6 Specific Enzyme Activities of LhPPK and Its Combinatorial Mutants

[0093]

[0094]

[0095] Example 7 Characterization of Mutant LhPPK / A99S / E186A / D190R / D204A

[0096] 1. Temperature

[0097] The engineered strains E. coli BL21(DE3)-LhPPK and E. coli BL21(DE3)-LhPPK / A99S / E186A / D190R / D204A constructed in Examples 1 and 6 were used to prepare pure enzymes by the method of Example 2, and the enzyme activities were measured by the method of Example 3. The temperatures for measuring enzyme activities were changed to 25°C, 30°C, 35°C, 37°C, 40°C, 45°C, 50°C, 55°C, and 60°C, respectively.

[0098] The results are as Figure 1 shown. Although 37°C is the optimal reaction temperature for wild-type LhPPK and mutant LhPPK / A99S / E186A / D190R / D204, the mutant LhPPK / A99S / E186A / D190R / D204A exhibits significantly higher relative activities towards the substrate AMP at temperatures of 40 - 60°C. For example, the mutant LhPPK / A99S / E186A / D190R / D204A still retains more than 85% of its activity when catalyzing the substrate AMP at 45°C, while the wild-type LhPPK loses 35% of its activity under such conditions.

[0099] 2. pH

[0100] The engineered strains E. coli BL21(DE3)-LhPPK and E. coli BL21(DE3)-LhPPK / A99S / E186A / D190R / D204A constructed by the methods of Examples 1 and 6 were used to prepare pure enzymes by the method of Example 2. The enzyme activities were measured by the method of Example 3, and the pH values of the buffer solutions were changed to 5.0 - 6.0 (50 mM citric acid - sodium citrate buffer), 6.0 - 8.0 (50 mM potassium phosphate buffer), 8.0 - 9.0 (50 mM borax - boric acid buffer), or 9.0 - 10.0 (50 mM glycine - NaOH buffer), respectively.

[0101] The results are as Figure 2 shown. The relative activities of wild-type LhPPK and mutant LhPPK / A99S / E186A / D190R / D204A towards AMP reach the maximum at a pH value of 7.5. However, the mutant LhPPK / A99S / E186A / D190R / D204A has a relatively high activity towards the substrate AMP under alkaline conditions.

[0102] 3. Half-life

[0103] Half-life (t 1 / 2) refers to the time required for the enzyme activity to decrease by 50% at a specific temperature, and is an important parameter for characterizing the thermal stability of the enzyme. The purified enzyme of the polyphosphate kinase LhPPK and its mutants prepared by the method of Example 6 was diluted with pH 7.5, 50 mM sodium phosphate buffer to a protein concentration of 1.0 mg / mL, and incubated at 30°C, 37°C and 45°C, respectively. At regular intervals, 50 μL of the incubated enzyme solution was taken out, and the residual enzyme activity for the substrate AMP was determined under the standard conditions of the enzyme activity detection in Example 7. The half-life was calculated according to the thermal inactivation equation (Et = E0e-K d t) calculation, in the thermal inactivation equation, K d is the deactivation kinetic constant, E 0 and E t Represent the initial enzyme activity and the enzyme activity at time t, respectively. t / E 0 ) as the ordinate and the incubation time t as the abscissa, the experimental data were fitted to obtain kd using the formula ln2 / K d Calculate the half-life t 1 / 2 The results are shown in Table 7. Compared with the wild type, the half-life of the mutant LhPPK / A99S / E186A / D190R / D204A was significantly improved.

[0104] Table 7 Half-life of polyphosphate kinase LhPPK and its mutants at 30°C, 37°C and 45°C

[0105]

[0106] 4. Tm

[0107] Tm represents the melting temperature of a protein, which refers to the temperature corresponding to when the protein is 50% unfolded. The thermal denaturation process of a protein is closely related to the change in its spatial conformation. The Tm value can reflect the trend of protein conformation change during the temperature change process and is an important indicator for measuring the thermal stability of a protein. The melting temperature of polyphosphate kinase and its mutants was analyzed using a Chirascan circular dichroism (CD) spectrometer. First, the purified enzyme of polyphosphate kinase LhPPK and its mutants prepared by the method of Example 4 was diluted to a protein concentration of 0.1 mg / mL, and then 200 μL was loaded into a 10 mm quartz cuvette and the Tm of polyphosphate kinase LhPPK and its mutants was measured using a CD circular dichroism spectrometer. The melting curves of polyphosphate kinase LhPPK and its mutants were continuously collected at a wavelength of 180-260 nm and a temperature of 20-80°C. The circular dichroism spectrometer's built-in software Global 3 was used to calculate Tm. The results are shown in Table 8. The Tm value of the mutant A99S / E186A / D190R / D204A was significantly improved, which was 11.6°C higher than that of the wild type.

[0108] Table 8 Melting temperature of polyphosphate kinase LhPPK and its mutants

[0109]

[0110] Example 8 Generation of NMN from ribose using a PPK-based ATP regeneration system

[0111] (1) Preparation of expression plasmids

[0112] The engineered bacteria of ribokinase EcRK gene were codon-optimized with Escherichia coli as the host (the optimized sequence is shown in SEQ ID NO.3) and synthesized by Tsingke Biotechnology Co., Ltd. Then, the cDNA fragment of EcRK was ligated after TATACCAT at the site in pET-28a(+) (after the NcoI restriction site) and before CTCGAG (before the XhoI restriction site) to construct a recombinant expression vector, and this expression vector was transferred into E. coli BL21(DE3) to obtain E. coli BL21(DE3) / pET28a(+)-EcRK. The engineered bacteria of phosphoribosyl pyrophosphate synthetase BaPRS gene were codon-optimized with Escherichia coli as the host (the optimized sequence is shown in SEQ ID NO.5) and synthesized by Tsingke Biotechnology Co., Ltd. Then, the cDNA fragment of BaPRS was ligated after TATACCAT at the site in pET-28a(+) (after the NcoI restriction site) and before CTCGAG (before the XhoI restriction site) to construct a recombinant expression vector, and this expression vector was transferred into E. coli BL21(DE3) to obtain E. coli BL21(DE3) / pET28a(+)-BaPRS. The engineered bacteria of nicotinamide phosphoribosyltransferase CpNampt gene were codon-optimized with Escherichia coli as the host (the optimized sequence is shown in SEQ ID NO.7) and synthesized by Tsingke Biotechnology Co., Ltd. Then, the cDNA fragment of Nampt was ligated after TATACCAT at the site in pET-28a(+) (after the NcoI restriction site) and before CTCGAG (before the XhoI restriction site) to construct a recombinant expression vector, and this expression vector was transferred into E. coli BL21(DE3) to obtain E. coli BL21(DE3) / pET28a(+)-CpNampt. The preparation of the Ecoli.BL21(DE3)-LhPPK expression plasmid was as shown in Example 1.

[0113] (2) Preparation, culture of recombinants and preparation of cell-free extracts

[0114] The wet cells of ribokinase EcRK, phosphoribosyl pyrophosphate synthetase BaPRS, nicotinamide ribosyltransferase CpNampt, and polyphosphate kinase LhPPK were obtained by the method of Example 1, and these four wet cells were subjected to a disruption treatment.

[0115] (3) Synthesis of NMN

[0116] 100 mM ribose, 50 mM NAM, 5 mM ATP, 40 mM magnesium chloride, 45 mM Poly P, 2 g / L of crude RK enzyme solution, 16 g / L of crude PRS enzyme solution, 20 g / L of Nampt crude enzyme solution, and 20 g / L of mutant LhPPK / A99S / E186A / D190R / D204A crude enzyme solution were added to 10 mL of potassium phosphate buffer (50 mM, pH 7.5). In the reaction system for comparison, the 20 g / L of mutant LhPPK / A99S / E186A / D190R / D204A crude enzyme solution was adjusted to 20 g / L of PPK crude enzyme solution. The reaction was carried out for 6 h under a constant temperature magnetic stirrer at 37 °C. Samples were taken at 0.5 h, 1 h, 1.5 h, 2 h, 2.5 h, 3 h, 3.5 h, 4 h, 4.5 h, 5 h, 5.5 h, and 6 h, and the HPLC method in Example 3 was used for detection (the retention time of NMN was 2.9 minutes). Method for obtaining the standard curve of NMN concentration vs. peak area: The peak area data obtained by injecting NMN at different concentrations (0.1 mM, 0.5 mM, 1 mM, 2 mM, 5 mM, and 10 mM) were used to obtain the standard curve of NMN concentration vs. peak area. The curve equation was y = 38.081x + 2.3615 (R 2 = 0.9998), where y is the concentration of NMN (mM) and x is the peak area of NMN.

[0117] (4) Experimental results

[0118] The results were as Figure 3 shown. When the ATP regeneration system containing wild-type LhPPK was introduced into NMN synthesis, the yield of NMN reached 20 mM after 6 h. When the ATP regeneration system containing mutant LhPPK / A99S / E186A / D190R / D204A was introduced into NMN synthesis, the yield of NMN reached 38 mM after 6 h. It shows that in the NMN synthesis reaction containing only 5 mM ATP, introducing the ATP regeneration system composed of mutants can greatly save the input amount of ATP and increase the yield of NMN.

Claims

1. A polyphosphate kinase mutant, characterized in that: The amino acid sequence is obtained by performing single-point or multi-point mutations on the 99th, 186th, 190th and 204th amino acids of the polyphosphatase shown in SEQ ID NO.

1.

2. The polyphosphatase mutant according to claim 1, characterized in that The mutant form of the polyphosphatase mutant is one of the following: (1) Alanine at position 99 is mutated to aspartic acid, glutamine or serine; (2) glutamic acid at position 186 mutated to alanine or glutamine; (3) Aspartic acid at position 190 is mutated to alanine, valine, arginine, or threonine; (4) Aspartic acid at position 204 is mutated to alanine, cysteine, histidine, or lysine; (5) Glutamic acid at position 186 mutated to alanine, and aspartic acid at position 204 mutated to alanine; (6) Alanine at position 99 mutated to aspartic acid, glutamic acid at position 186 mutated to alanine, and aspartic acid at position 204 mutated to alanine; (7) Alanine at position 99 mutated to aspartic acid, glutamic acid at position 186 mutated to alanine, aspartic acid at position 190 mutated to arginine, and aspartic acid at position 204 mutated to alanine.

3. A gene encoding the polyphosphate kinase mutant as claimed in claim 2.

4. A recombinant vector, characterized in that: Contains the gene as claimed in claim 3.

5. A genetically engineered bacterium, characterized in that: Contains the gene as claimed in claim 3.

6. An ATP regeneration system, characterized in that: Including enzymes and substrates; The enzyme comprises the polyphosphate kinase mutant of claim 1; The substrates include polyphosphates and adenosine phosphate substrates.

7. Use of the polyphosphate kinase mutant according to any one of claims 1 or 2, or the ATP regeneration system according to claim 6 in producing β-nicotinamide mononucleotide.

8. A method for preparing β-nicotinamide mononucleotide by enzymatic method, characterized in that: Ribose, adenosine triphosphate and nicotinamide are used as substrates, and ribokinase, phosphoribosyl pyrophosphate synthetase, nicotinamide ribosyltransferase and the polyphosphate kinase mutant according to any one of claims 1 or 2 are used as catalysts to form a reaction system to catalyze the preparation of β-nicotinamide mononucleotide.

9. The method according to claim 8, characterized in that In the reaction system, the pH is 6.5-8.5 and the temperature is 35-45°C.

10. The method according to claim 8, characterized in that The reaction system also includes potassium phosphate buffer.

Images