Detection reagent and kit for detecting male infertility caused by SPOCD1 function inactivation mutation

Abstract

The invention discloses a separated nucleic acid and a marker as well as a detection reagent and a kit for detecting the marker. The separated nucleic acid and the marker comprise an SPOCD1 mutant gene; wherein the mutation site of the SPOCD1 mutant gene is c.31433144C compared with the SPOCD1 gene as shown in the nucleotide sequence of SEQ ID NO: 1, and the mutation site of the SPOCD1 mutant gene is c.31433144C compared with the SPOCD1 gene as shown in the SEQ ID NO: 1. The separated nucleic acid can be used as the marker for diagnosing the non-obstructive azoospermia, and the reagent, the kit and the biological preparation for detecting the marker developed by the invention can quickly and effectively diagnose the non-obstructive azoospermia.

Description

Technical Field

[0001] The present invention belongs to the technical field of reproductive medicine, and particularly relates to detection reagents and kits for detecting male infertility caused by SPOCD1 functional inactivation mutations. More specifically, the present invention relates to an isolated nucleic acid, an expression vector, a recombinant cell, a biomarker, a detection reagent and a kit, and their uses. Background Art

[0002] Germ cells are the only cells in an organism that can transmit parental genetic material to offspring, playing a key role in the intergenerational inheritance of species. Spermatogenesis, that is, the process of male germ cell development, is crucial for male fertility and sperm production. This process mainly includes three steps: mitosis of spermatogonia, meiosis of spermatocytes, and spermiogenesis. The process of spermatogenesis is regulated by complex and precise mechanisms, and any blockage or abnormality in any link may lead to the failure of spermatogenesis, and then cause azoospermia, oligospermia, asthenospermia or teratospermia, ultimately resulting in infertility. Azoospermia is the most severe clinical manifestation of male infertility, which is defined as the absence of sperm under the microscope in more than 2 semen analyses (after centrifuging and precipitating the semen), and can be divided into obstructive azoospermia and non-obstructive azoospermia.

[0003] SPOCD1 (SPOC domain containing 1) encodes a protein containing a TFIIS-M (transcription elongation factor TFIIS-like motif) domain and a SPOC domain. The SPOCD1 gene is mainly expressed during the de novo methylation of the germ cell genome and is crucial for the development of male germ cells. SPOCD1 gene knockout mice (Spocd1 - / - ) exhibit male-specific infertility, and sperm are completely absent in the epididymis. The identification of the function of SPOCD1 during spermatogenesis is of great significance for studying related male infertility. Therefore, there is an urgent need to develop a detection reagent and related kit related to male infertility caused by impaired SPOCD1 function. Summary of the Invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art to some extent. To this end, the present invention provides an isolated nucleic acid, a biomarker, a detection reagent and a kit for detecting male infertility caused by impaired SPOCD1 function. The isolated nucleic acid of the present invention can be used as a biomarker for detecting male infertility caused by impaired SPOCD1 function. By detecting this biomarker, it is possible to effectively diagnose whether a patient has male infertility caused by impaired SPOCD1 function. Moreover, the detection reagent and kit for detecting the above biomarker have the advantages of high diagnostic specificity and high accuracy.

[0005] The present invention is accomplished based on the following findings of the inventors:

[0006] Chinese patent document CN114395621A discloses the use of the ADAD2 gene in the preparation of a diagnostic kit for detecting non-obstructive azoospermia, wherein the allele mutation of the ADAD2 is one or more of c.C981G and c.1283 1G>A.

[0007] Furthermore, the inventors found that SPOCD1 is a gene related to male reproductive function, and its mutation may lead to spermatogenesis obstruction, thereby causing non-obstructive azoospermia. However, there are currently no reports on the mutation site of the SPOCD1 gene and its use in genetic diagnosis of patients with non-obstructive azoospermia.

[0008] Based on this, in the first aspect of the present invention, the present invention provides an isolated nucleic acid. According to an embodiment of the present invention, the isolated nucleic acid includes a SPOCD1 mutant gene; wherein, compared with the SPOCD1 gene shown in the nucleotide sequence of SEQ ID NO: 1, the mutation site of the SPOCD1 mutant gene is c.3143_3144C. The isolated nucleic acid according to an embodiment of the present invention can be used as a marker for diagnosing male infertility caused by non-obstructive azoospermia, and by detecting the marker, it can be effectively diagnosed whether the patient suffers from male infertility caused by non-obstructive azoospermia.

[0009] According to an embodiment of the present invention, the isolated nucleic acid can be used as a marker for diagnosing male infertility caused by fertilization disorders.

[0010] In a second aspect of the present invention, the present invention provides an expression vector. According to an embodiment of the present invention, the expression vector carries the isolated nucleic acid described in the first aspect.

[0011] In a third aspect of the present invention, the present invention provides a recombinant cell. According to an embodiment of the present invention, the recombinant cell carries the isolated nucleic acid described in the first aspect of the invention or the expression vector described in the second aspect of the invention.

[0012] According to an embodiment of the present invention, the recombinant cell is obtained by introducing the expression vector into a host cell.

[0013] In a fourth aspect of the present invention, the present invention provides use of the isolated nucleic acid described in the first aspect of the present invention as a marker for diagnosing male infertility caused by non-obstructive azoospermia.

[0014] In the fifth aspect of the present invention, the present invention provides a biomarker. According to an embodiment of the present invention, the biomarker includes at least one of the following mutant genes: the SPOCD1 mutant gene, and compared with the SPOCD1 gene shown in the nucleotide sequence of SEQ ID NO:1, the mutation site of the SPOCD1 mutant gene is c.3143_3144C. The biomarker of the embodiment of the present invention can effectively diagnose whether a patient has male infertility caused by non-obstructive azoospermia, and the detection reagent and kit for detecting the above biomarker have the advantages of high diagnostic specificity, high accuracy, etc.

[0015] In the sixth aspect of the present invention, the present invention provides a detection reagent. According to an embodiment of the present invention, the detection reagent includes the isolated nucleic acid described in the first aspect of the invention or the reagent for the biomarker described in the fifth aspect of the invention. The detection reagent according to the embodiment of the present invention can effectively diagnose male infertility caused by non-obstructive azoospermia, and has the advantages of high diagnostic specificity, high accuracy, etc.

[0016] According to an embodiment of the present invention, the reagent is a primer set for detecting the SPOCD1 mutant gene.

[0017] According to an embodiment of the present invention, the primer set includes the following primer pairs:

[0018] The upstream primer GTCTGTTGCTGGCTGTGCTG and the downstream primer AGGAGTCCCTGTGGAAGTGC.

[0019] In the seventh aspect of the present invention, the present invention provides a kit. According to an embodiment of the present invention, the kit includes the detection reagent described in the sixth aspect of the invention. The detection reagent according to the embodiment of the present invention can effectively diagnose male infertility caused by non-obstructive azoospermia, and has the advantages of high diagnostic specificity, high accuracy, etc.

[0020] According to an embodiment of the present invention, the kit further includes at least one of the following reagents:

[0021] dNTP, Taq enzyme and PCR reaction buffer.

[0022] In the eighth aspect of the present invention, the present invention provides the use of the detection reagent described in the sixth aspect or the kit described in the seventh aspect in the preparation of a diagnostic product for diagnosing non-obstructive azoospermia. The detection reagent and kit according to the embodiment of the present invention can effectively diagnose male infertility caused by non-obstructive azoospermia, and have the advantages of high diagnostic specificity, high accuracy, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1It is a Sanger sequencing screenshot of the c.3143_3144C homozygous mutation and non-mutation of the SPOCD1 gene in Example 3 of the present invention. Detailed implementation manners

[0024] The embodiments of the present invention will be described in detail below. The embodiments described below are exemplary and are only used to explain the present invention and should not be construed as a limitation to the present invention.

[0025] It should be noted that the terms "first" and "second" are only used for descriptive purposes and should not be construed as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features. Thus, the features defined with "first" and "second" may explicitly or implicitly include one or more of such features. Further, in the description of the present invention, unless otherwise specified, the meaning of "a plurality" is two or more.

[0026] In this article, the term "comprising", "including" or "containing" is an open expression, that is, it includes the content specified by the present invention, but does not exclude other aspects of the content.

[0027] In this article, the term "optionally", "optional" or "option" generally means that the subsequent event or condition may or may not occur, and this description includes the case where the event or condition occurs and the case where the event or condition does not occur.

[0028] In this article, the term "expression vector" generally refers to a nucleic acid molecule that can self-replicate after being inserted into a suitable host, and transfers the inserted nucleic acid molecule into a cell or host and / or between cells or hosts. The expression vector may include an expression vector mainly used for inserting DNA or RNA into a cell, an expression vector mainly used for replicating DNA or RNA, and an expression vector mainly used for transcription and / or translation of DNA or RNA. The expression vector also includes vectors having multiple above-mentioned functions. The vector may be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable cell or host. Generally, by culturing a suitable cell or host containing the vector, the vector can produce a desired expression product.

[0029] As used herein, the term "recombinant cell" generally refers to a cell obtained by modifying or recombining the genetic material of a host cell using genetic engineering techniques or cell fusion techniques, and having unique traits with stable inheritance. Among them, the term "host cell" refers to a prokaryotic cell or a eukaryotic cell into which a recombinant vector can be introduced. The term "transformed" or "transfected" as used herein refers to the introduction of nucleic acid (such as a vector) into a cell by various techniques known in the art. Suitable host cells can be transformed or transfected with the DNA sequences of the present invention and can be used for the expression and / or secretion of target proteins. Examples of suitable host cells that can be used in the present invention include immortalized hybridoma cells, NS / 0 myeloma cells, 293 cells, Chinese hamster ovary (CHO) cells, HeLa cells, Cap cells (cells derived from human amniotic fluid), and CoS cells.

[0030] In this article, the term "Sanger sequencing" refers to the dideoxy chain termination method. The reaction system includes target DNA fragments, deoxynucleoside triphosphates (dNTPs), dideoxynucleoside triphosphates (ddNTPs), sequencing primers, DNA polymerase, etc. The core of the sequencing reaction is the ddNTPs used: lacking a 3'-OH group and thus unable to form a phosphodiester bond with another dNTP, these ddNTPs can be used to terminate the extension of the DNA strand. In addition, these ddNTPs are linked with radioactive isotopes or fluorescent labeling groups, so they can be detected by automated instruments or gel imaging systems. In the early Sanger-based sequencing, four parallel sequencing reactions were set up. Each reaction included target fragments, DNA polymerase, sequencing primers, four dNTPs, and one specific type of fluorescent (or radioactive isotope)-labeled ddNTP (i.e., ddATP, ddGTP, ddCTP, and ddTTP in different reactions respectively). With such a configuration, in different reactions, the DNA strand will be terminated at positions A, G, C, and T respectively, and DNA fragments of different lengths will be formed. These fragments can then be separated and shown by gel electrophoresis. The denaturing acrylamide electrophoresis has four lanes, each corresponding to one base. After electrophoresis, autoradiography or ultraviolet imaging can be used to read the X-ray film or gel image. Each dark band in the image represents the result of a DNA fragment terminated after the incorporation of a dideoxynucleotide (ddATP, ddGTP, ddCTP, ddTTP). The relative positions of the different dark bands between the four lanes can be used to read (from the bottom to the top) the DNA sequence, thus obtaining the base sequence of the target fragment. With the development of Sanger sequencing technology, the labeling technology of ddNTPs has been greatly improved. Different types of ddNTPs can be labeled with different fluorescent groups, and these fluorescent groups have the same excitation wavelength and different emission wavelengths, so they appear as different colors optically. Therefore, the sequencing reaction can be carried out in one system, meeting the industry's increasing requirements for sequencing speed, automation, and throughput. Sanger is easy to operate, so it is widely used. Sanger sequencing can now be carried out in highly automated sequencers. Commercial products include the 3130xL, 3730xL, 3500Dx, and 3500Dx xL sequencers of Life Technologies and the GeXP genetic analysis system of Beckman, etc. Such systems can measure DNA fragments up to 600 - 1000 bp at most, and have good handling of repetitive sequences and poly sequences, with high sequence accuracy.

[0031] The present invention provides an isolated nucleic acid, expression vector, recombinant cell, marker, detection reagent, kit, and their uses in the preparation of diagnostic products, which will be described in detail below respectively.

[0032] Isolated nucleic acid, expression vector, recombinant cell

[0033] In one aspect of the present invention, the present invention provides an isolated nucleic acid. According to an embodiment of the present invention, the isolated nucleic acid comprises a SPOCD1 mutant gene; wherein, compared with the SPOCD1 gene shown by the nucleotide sequence of SEQ ID NO:1, the mutation site of the SPOCD1 mutant gene is c.3143_3144C. The isolated nucleic acid according to the embodiment of the present invention can be used as a biomarker for diagnosing male infertility caused by non-obstructive azoospermia, and by detecting this biomarker, it can effectively diagnose whether a patient has male infertility caused by non-obstructive azoospermia.

[0034] According to an embodiment of the present invention, the isolated nucleic acid can be used as a biomarker for diagnosing male infertility caused by fertilization disorder.

[0035] As used herein, the term "c.3143_3144C" refers to the deletion of cytosine (C) at position 32,256,673 on chromosome 1 of the human GRCh37 version genome (located in the SPOCD1 gene). The specific information of this site mutation is NM_001281987, c.3143_3144C, which is a frameshift mutation that causes a change in the SPOCD1 reading frame and thus inactivates the gene function.

[0036] As used herein, the nucleotide sequence of the SPOCD1 gene is shown as SEQ ID NO:1.

[0037]

[0038] In this text, the term "Frameshift Mutation" refers to an insertion or deletion event that occurs in a DNA sequence. When the number of inserted or deleted bases is not a multiple of 3, it causes a change in the reading frame of the nucleotide sequence. Frameshift mutations usually lead to serious errors in protein synthesis, generating a completely different and usually non-functional protein, and may even cause premature termination of translation. Such mutations often have a significant impact on organisms, as they can result in the production of truncated proteins or complete loss of protein expression. Therefore, when detecting patients with monogenic genetic diseases, paying attention to frameshift mutations is very important for understanding the pathogenesis of the disease and making accurate genetic diagnoses.

[0039] In an alternative embodiment of the present invention, the isolated nucleic acid can be used as a biomarker for diagnosing male infertility caused by non-obstructive azoospermia.

[0040] According to an embodiment of the present invention, the nucleic acid molecule includes DNA or RNA. For an expression vector used to construct a recombinant cell, it is preferred that the nucleic acid is DNA because DNA is more stable and easier to operate compared to RNA. It should be noted that for the nucleic acid molecules mentioned in this text, those skilled in the art should understand that it actually includes either any one of the complementary double strands or both. For convenience, in this text, although only one strand is given in most cases, the other complementary strand is actually also disclosed. Additionally, in the present invention, the molecular sequence is in the form of DNA or RNA. Disclosing one means that the other is also disclosed.

[0041] In the second aspect of the present invention, the present invention provides an expression vector. According to an embodiment of the present invention, the expression vector carries the isolated nucleic acid described in the first aspect. When connecting the above nucleic acid molecule to the expression vector, the nucleic acid molecule can be directly or indirectly connected to the control elements on the expression vector, as long as these control elements can control the translation and expression of the nucleic acid molecule, etc. Of course, these control elements can directly come from the expression vector itself or be exogenous, that is, not from the expression vector itself. Of course, the nucleic acid molecule only needs to be operably linked to the control elements. Here, "operably linked" means connecting a foreign gene to an expression vector such that the control elements in the expression vector, such as transcriptional control sequences and translational control sequences, etc., can perform their intended functions of regulating the transcription and translation of the foreign gene. Commonly used expression vectors can be, for example, plasmids, phages, etc.

[0042] In some specific embodiments of the present invention, the expression vector is a eukaryotic expression vector, a prokaryotic expression vector, a virus, or a phage.

[0043] In an alternative embodiment of the present invention, the expression vector is a plasmid expression vector.

[0044] In a third aspect of the present invention, the present invention provides a recombinant cell. According to an embodiment of the present invention, the recombinant cell carries the isolated nucleic acid described in the first aspect of the invention or the expression vector described in the second aspect. According to an embodiment of the present invention, the recombinant cell is obtained by introducing the expression vector described in the second aspect into a host cell.

[0045] It should be noted that the cells of the present invention are not particularly limited and can be prokaryotic cells, eukaryotic cells or phages. The prokaryotic cells can be Escherichia coli, Bacillus subtilis, Streptomyces or Proteus mirabilis, etc. The eukaryotic cells include fungi such as Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Trichoderma, etc., insect cells such as Spodoptera frugiperda, plant cells such as tobacco, and mammalian cells such as BHK cells, CHO cells, COS cells, myeloma cells, etc.

[0046] In an alternative embodiment of the present invention, the type of the cell is not particularly limited. For example, it can be an Escherichia coli cell or a mammalian cell. The mammalian cells include BHK cells, CHO cells, NSO cells or COS cells, and do not include animal germ cells, fertilized eggs or embryonic stem cells. Preferably, the cells are derived from non-human mammals.

[0047] Marker, detection reagent, kit and their uses

[0048] In a fourth aspect of the present invention, the present invention provides the use of the isolated nucleic acid described in the first aspect of the present invention as a marker for diagnosing male infertility caused by non-obstructive azoospermia.

[0049] In a fifth aspect of the present invention, the present invention provides a marker. According to an embodiment of the present invention, the marker includes at least one of the following mutant genes: the SPOCD1 mutant gene. Compared with the SPOCD1 gene shown in the nucleotide sequence of SEQ ID NO:1, the mutation site of the SPOCD1 mutant gene is c.3143_3144C. The marker of the embodiment of the present invention can effectively diagnose whether a patient has male infertility caused by non-obstructive azoospermia, and the detection reagent and kit for detecting the above marker have the advantages of high diagnostic specificity and high accuracy.

[0050] In a sixth aspect of the present invention, the present invention provides a detection reagent. According to an embodiment of the present invention, the detection reagent includes the reagent of the isolated nucleic acid described in the first aspect of the invention or the marker described in the fifth aspect of the invention. The detection reagent according to the embodiment of the present invention can effectively diagnose male infertility caused by non-obstructive azoospermia and has the advantages of high diagnostic specificity and high accuracy.

[0051] In an alternative embodiment of the present invention, the reagent is a primer set for detecting the SPOCD1 mutant gene.

[0052] In an alternative embodiment of the present invention, the primer set includes at least one of the following primer pairs:

[0053] Forward primer GTCTGTTGCTGGCTGTGCTG and reverse primer AGGAGTCCCTGTGGAAGTGC.

[0054] In a seventh aspect of the present invention, the present invention provides a kit. According to an embodiment of the present invention, the kit includes the detection reagent described in the sixth aspect of the present invention. The detection reagent according to the embodiment of the present invention can effectively diagnose male infertility caused by non-obstructive azoospermia, and has the advantages of high diagnostic specificity, high accuracy, etc.

[0055] In an alternative embodiment of the present invention, the kit further includes:

[0056] (1) Genomic DNA extraction reagent;

[0057] (2) Polymerase chain reaction solution;

[0058] (3) Sequencing system reagent;

[0059] (4) Positive control sample and negative control sample.

[0060] Among them, the genomic DNA extraction reagent can be purchased from commercial reagents such as TIANGEN and QIAGEN.

[0061] The polymerase chain reaction system of the detection system includes: the reaction mixture can be purchased from commercial reagents such as QIAGEN, and a polymerase chain reaction solution with 10 μM each of the forward and reverse primers for detecting the c.3143_3144C mutation of the SPOCD1 gene.

[0062] In an eighth aspect of the present invention, the present invention provides the use of the detection reagent described in the sixth aspect or the kit described in the seventh aspect in the preparation of a diagnostic product for diagnosing male infertility caused by non-obstructive azoospermia. The detection reagent and kit according to the embodiment of the present invention can effectively diagnose male infertility caused by non-obstructive azoospermia, and have the advantages of high diagnostic specificity, high accuracy, etc.

[0063] The solution of the present invention will be explained below in conjunction with embodiments. Those skilled in the art will understand that the following embodiments are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. For those embodiments where specific technologies or conditions are not indicated, the technologies or conditions described in the literature in this field or according to the product instructions are followed. For reagents or instruments whose manufacturers are not indicated, they are all conventional products that can be obtained through commercial purchase.

[0064] Example 1: Screening for the c.3143_3144C Mutation in the SPOCD1 Gene

[0065] 1. On the basis of conforming to relevant national policies and obtaining the informed consent of the sampling subjects, whole-exome sequencing was performed on the peripheral blood genomic DNA of two male infertility patients caused by non-obstructive azoospermia. A homozygous mutation of c.3143_3144C in the SPOCD1 gene was found in both patients, and this mutation was not detected in the 1000 Genomes Database.

[0066] 2. Further, the inventors designed a set of primer pairs for the mutation site of the above SPOCD1 gene, including primers for detecting the c.3143_3144C mutation in the SPOCD1 gene. The sequence of the upstream primer is GTCTGTTGCTGGCTGTGCTG (SEQ ID NO: 2), and the sequence of the downstream primer is AGGAGTCCCTGTGGAAGTGC (SEQ ID NO: 3).

[0067] 3. Further, the present invention designed a set of kits for detecting SPOCD1 gene mutations, including genomic DNA extraction reagents (TIANGEN or QIAGEN), polymerase chain reaction solutions (QIAGEN, which are used in combination with the upstream and downstream primers for detecting the c.3143_3144C mutation in the SPOCD1 gene, and 10 μM of polymerase chain reaction solution is added for each pair of primers), and sequencing system reagents (sequencing templates, BigDye (2.5X) (Applied Biosystems, 4337458), sequencing primers (the upstream or downstream primer for detecting the c.3143_3144C mutation in the SPOCD1 gene designed in step 2 of this example, 3.2 pmol)).

[0068] The above kit was used to detect the mutant genes in the peripheral blood genomic DNA of the male infertility patients in step 1. The specific steps are as follows:

[0069] 3.1 Steps for extracting genomic DNA from blood:

[0070] (1) Use an EDTA K anticoagulation tube (BD, 367525) to draw 300 μL of blood. After thorough mixing, add 750 μL of FG1 red blood cell lysis solution (FlexiGene DNA Kit, FQIAGEN, 51206), invert and mix 5 times, centrifuge at 10,000 g for 20 s, discard the supernatant, and leave the white blood cell pellet (red blood cells have no nucleus, and red blood cells need to be removed before extracting genomic DNA). (2) Add 200 μL of protease K / FG2 buffer (FlexiGene DNA Kit, FQIAGEN, 51206) (1:100), vortex until thoroughly mixed, incubate at 65 °C for 5 min, and the solution turns olive green (this color indicates that the reaction of protease K to digest the proteins in the cells in (1) is complete). (3) Add 200 μL of isopropanol, invert dozens of times until flocculent precipitates appear, centrifuge at 10,000 g for 3 min, and discard the supernatant. (4) Add 75% ethanol, gently vortex and wash the precipitate for 5 s, centrifuge at 10,000 g for 3 min, and discard the supernatant. (5) Air dry for 15 min, add TE buffer to resuspend the precipitate, incubate at 65 °C for 1 hr, and incubate overnight at room temperature. (6) Use a Qubit 4.0 instrument (Invitrogen) to measure the DNA concentration to determine whether the genomic DNA extraction is successful. If the measured concentration is greater than 5 ng / μL, the next reaction can be carried out.

[0071] 3.2 The preparation method of the polymerase chain reaction solution is as follows:

[0072]

[0073] The reaction conditions are as follows:

[0074]

[0075] 3.3 The preparation method of the Sanger sequencing reaction solution is as follows:

[0076]

[0077] The reaction conditions are as follows:

[0078] 3.4 Judgment of Sanger sequencing results

[0079] Compare the sequencing results with the SPOCD1 standard reference sequence (NM_001281987, as shown in SEQ ID NO:1) downloaded from the GenBank database of NCBI respectively, and report the results according to the mutation situation. The results show that the whole exome sequencing results are correct, and both patients are homozygous carriers of pathogenic mutation sites.

[0080] 4. Analyze the mutational harmfulness of the gene mutation sites obtained in step 1 of this embodiment:

[0081] The c.3143_3144C frameshift mutation in the SPOCD1 gene will result in a mutant protein p.Thr1062Profs*17 with a changed reading frame. Compared with the normal SPOCD1 protein of 1203 amino acids, 141 amino acids are missing; or it will cause the direct degradation of the SPOCD1 mRNA. Whichever way, the mutation will have a harmful effect on the protein. Combining with the fact that Spocd1 knockout mice are male sterile in the background technology, which is consistent with the phenotype of non-obstructive azoospermia in patients, the SPOCD1 gene is a gene related to male reproductive function, and its mutation may lead to male spermatogenesis arrest, indicating that the c.3143_3144C frameshift mutation in the SPOCD1 gene is the pathogenic mutation causing infertility in the corresponding patients.

[0082] Example 2: Verification of the c.3143_3144C mutation in the SPOCD1 gene in normal male controls

[0083] This study was approved by the Ethics Committee of the First Affiliated Hospital of the University of Science and Technology of China, and informed consent was obtained from the sampling subjects. Peripheral blood samples of 538 male volunteers with normal fertility who had a second-child fertility requirement due to female tubal factors were collected in the Reproductive and Genetic Branch of the First Affiliated Hospital. According to the steps of 3.1 blood genomic DNA extraction in Example 1, the genomic DNA of peripheral blood was extracted and sent to BGI for whole-exome sequencing, so as to obtain the whole-exome sequencing data set of normal males. By screening for the c.3143_3144C mutation in the SPOCD1 gene in this data set, it was found that there was no homozygous carrier of any of the above mutations in normal males.

[0084] Example 3: Diagnostic verification

[0085] On the premise of obtaining the informed consent of the patients and male volunteers with normal fertility, peripheral blood samples of two non-obstructive azoospermia patients and 100 male volunteers with normal fertility were taken, and the genomes of the above peripheral blood samples were extracted and detected respectively according to the method in step 3 of Example 1. After sequencing, it was found that both patients carried the c.3143_3144C mutation in the SPOCD1 gene (for the results, see Figure 1 , Figure 1 the homozygous genotype shown in the box, presenting a single peak diagram), and the peripheral blood samples of 100 male volunteers with normal fertility did not carry the homozygous mutation of c.3143_3144C in the SPOCD1 gene, and the sequencing results of the corresponding sites in the sequencing peak diagram were consistent with the genotypes of male volunteers with normal fertility and the reference genotype.

[0086] In the description of this specification, the description referring to terms such as "one embodiment", "some embodiments", "examples", "specific examples", or "some examples", etc. means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0087] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. An isolated nucleic acid, characterized in that These include the SPOCD1 mutant gene; Compared with the SPOCD1 gene shown in the nucleotide sequence of SEQ ID NO: 1, the mutation site of the SPOCD1 mutant gene is c.3143_3144C.

2. An expression vector, characterized in that: Carrying the isolated nucleic acid of claim 1.

3. A recombinant cell, characterized in that Carrying the isolated nucleic acid of claim 1 or the expression vector of claim 2; Optionally, the recombinant cell is obtained by introducing the expression vector into a host cell.

4. Use of the isolated nucleic acid according to claim 1 as a marker for diagnosing male infertility caused by non-obstructive azoospermia.

5. A marker, characterized in that Including at least one of the following mutant genes: SPOCD1 mutant gene, compared with the SPOCD1 gene shown in the nucleotide sequence of SEQ ID NO:1, the mutation site of the SPOCD1 mutant gene is c.3143_3144C.

6. A detection reagent, characterized in that: include: A reagent for detecting the isolated nucleic acid according to claim 1 or the marker according to claim 5.

7. The detection reagent according to claim 6, characterized in that The reagent is a primer set for detecting SPOCD1 mutant gene; Optionally, the primer set includes the following primer pairs: The upstream primer was GTCTGTTGCTGGCTGTGCTG and the downstream primer was AGGAGTCCCTGTGGAAGTGC.

8. A kit, characterized in that: include: The detection reagent according to claim 6 or 7.

9. The kit according to claim 8, characterized in that Further comprising at least one of the following reagents: dNTPs, Taq enzyme and PCR reaction buffer.

10. Use of the detection reagent according to claim 6 or 7 or the kit according to claim 8 or 9 in the preparation of a diagnostic product for diagnosing non-obstructive azoospermia.

Images