Application of TaJAZ1 gene in wheat starch synthesis

Abstract

The invention relates to application of a TaJAZ1 gene in wheat starch synthesis, and belongs to the field of gene engineering application. The nucleotide sequence of the TaJAZ1 gene is shown as SEQ ID NO.1, the TaJAZ1 gene has an improvement effect on the wheat starch quality, the thousand seed weight and the total starch content of wheat grains are increased, and the grains are full and full; the expansion potential, the solubility and the gelatinization temperature of the wheat grain starch are improved; on the molecular level, the TaJAZ1 gene participates in the synthesis of the wheat grain starch by controlling the expression of the TaAGPS1 gene and the TaAGPL1 gene.

Description

Technical Field

[0001] The present invention belongs to the field of application of genetic engineering, and particularly relates to the application of TaJAZ1 gene in participating in wheat starch synthesis. Background Art

[0002] Wheat, as a major source of carbohydrates, is a widely cultivated food crop. Starch is the main component of wheat grains, accounting for about 60%-75% of the grain dry weight, and mainly includes amylose and amylopectin. Amylose is composed of α-D-glucose monomers linked together by α-1,4-glucosidic bonds, which will affect the starch properties in foods, while amylopectin is composed of α-1,4-glucosidic bonds or α-1,6-glucosidic bonds, mainly affecting the crystal structure, gelatinization properties and digestibility of starch, etc., and thus affecting the quality of pasta products. The biosynthesis of starch is a complex process involving the catalytic action of multiple functional enzymes. Among them, ADP-glucose pyrophosphorylase (AGPase) acts on total starch, granule-bound starch synthase (GBSS) acts on amylose, but soluble starch synthase (SSS) and starch branching enzyme (SBE) act on amylopectin. Genes encoding these starch synthases have been identified in wheat. It has been reported that some transcription factors may affect starch synthesis by interacting, cooperating, antagonizing, etc. with proteins. In addition, in our previous study, the jasmonate-ZIM domain transcription factor TaJAZ1 is a family of inhibitory proteins involved in the jasmonic acid (JA) signaling pathway and is significantly induced during grain development, and it is speculated that it plays a role in the wheat grain filling process. JAZs play important roles in plant defense, growth and development, and their functions have been widely studied in rice and wheat. At present, the participation of JAZ proteins in crop starch synthesis has not been reported, especially in wheat. Summary of the Invention

[0003] Based on the above problems, the object of the present invention is to provide the application of TaJAZ1 gene in participating in wheat starch synthesis, which improves the 1000-grain weight and total starch content of wheat grains, making the grains plump and full; improves the swelling power, solubility and gelatinization temperature of wheat grain starch; at the molecular level, the TaJAZ1 gene participates in wheat grain starch synthesis by controlling the expression of TaAGPS1 gene and TaAGPL1 gene.

[0004] To achieve the above object, the technical solution adopted by the present invention is:

[0005] The application of TaJAZ1 gene in participating in wheat starch synthesis, the nucleotide sequence of the TaJAZ1 gene is as shown in SEQ ID NO.1, which has an improving effect on wheat starch quality.

[0006] Further, the application is to increase the thousand-kernel weight and total starch content of wheat grains, making the grains plump and full.

[0007] Further, the application is to increase the swelling power, solubility, and gelatinization temperature of wheat grain starch.

[0008] Further, at the molecular level, the TaJAZ1 gene participates in the synthesis of wheat grain starch by controlling the expression of TaAGPS1 gene and TaAGPL1 gene.

[0009] Furthermore, the gelatinization temperature includes the initial gelatinization temperature, peak gelatinization temperature, and final gelatinization temperature.

[0010] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0011] The application of the TaJAZ1 gene of the present invention in participating in wheat starch synthesis increases the thousand-kernel weight and total starch content of wheat grains, making the grains plump and full; increases the swelling power, solubility, and gelatinization temperature of wheat grain starch; and at the molecular level, the TaJAZ1 gene participates in the synthesis of wheat grain starch by controlling the expression of TaAGPS1 gene and TaAGPL1 gene. Brief Description of the Drawings

[0012] Figure 1 It is the sequencing alignment result of CRISPR-TaJAZ1 three copies.

[0013] Figure 2 It is the influence of TaJAZ1 on wheat grains.

[0014] Figure 3 It is the regulation of the TaJAZ1 gene on the key enzyme genes involved in wheat starch synthesis. Detailed Embodiments

[0015] The technical solutions and effects of the present invention will be further described below in conjunction with the drawings and specific embodiments, but the protection scope of the present invention is not limited thereto.

[0016] The present invention provides the application of the TaJAZ1 gene in participating in wheat starch synthesis. The nucleotide sequence of the TaJAZ1 gene is shown in SEQ ID NO.1, specifically:

[0017]

[0018] The present invention has no strict requirements on the source of the TaJAZ1 gene, and it can be obtained by artificial synthesis or amplification.

[0019] The application of the TaJAZ1 gene of the present invention in participating in wheat starch synthesis improves the thousand-grain weight and total starch content of wheat grains, making the grains plump and full; it improves the swelling power, solubility and gelatinization temperature of wheat grain starch; at the molecular level, the TaJAZ1 gene participates in wheat grain starch synthesis by controlling the expression of the TaAGPS1 gene and the TaAGPL1 gene.

[0020] Example 1

[0021] 1. Obtaining and identification of CRISPR-TaJAZ1 wheat mutant plants

[0022] The winter wheat variety Zhengmai 7698 was used as the test material for gene editing.

[0023] According to the homology of the three copies (5A, 5B, 5D) of TaJAZ1, and in order to distinguish other homologous genes, a TaJAZ1-specific sgRNA (CCATGTTCAGGGTTCAGAGTTCG) was designed, the double-stranded sgRNA nucleotide was synthesized, and inserted into the pWMBX110-SpCas9 vector to construct a TaJAZ1 gene editing vector. The nucleotide sequences of the three copies (5A, 5B, 5D) of TaJAZ1 are as follows.

[0024] The nucleotide sequence of TaJAZ1-5A is shown in SEQ ID NO.2, specifically:

[0025]

[0026] The nucleotide sequence of TaJAZ1-5B is shown in SEQ ID NO.3, specifically:

[0027]

[0028] The nucleotide sequence of TaJAZ1-5D is shown in SEQ ID NO.4, specifically:

[0029]

[0030] The TaJAZ1 gene editing vector was transferred into immature embryos of Zheng 7698 wheat by Agrobacterium-mediated infection, and seedlings were induced to differentiate. Genomic DNA of the wheat plants to be detected was extracted, and the coding region fragments of TaJAZ1-5A / B / D genes were amplified using specific detection primers for the three copies of TaJAZ1 (5A, 5B, 5D) (Table 1), and TA cloning and sequencing were performed. Through sequence alignment, lines in which all three copies of TaJAZ1-5A / B / D were edited were screened out. It was found through identification that base mutations could all lead to premature termination of protein translation, and PCR amplification and sequencing detection were carried out in the T 0 generation ( Figure 1 ). Lines with three mutant types of tajaz1-abd, tajaz1-bd, and tajaz1-ab detected were propagated and multiplied for subsequent functional studies on the physicochemical properties of wheat starch.

[0031] Table 1 Specific detection primers for three copies of TaJAZ1 (5A, 5B, 5D)

[0032] CRISPR-TaJAZ1 detection primer Sequence (5′-3′) 5A-F GTCTGCCTGCCAGTTTTG 5A-R GGCGTGTCCCTTTATTAC 5B-F GTCTGTGTCTGTATCTGC 5B-R CCATTCGGGAGGTTAGCGC 5D-F CGTGCCTGTCTCGCCTCA 5D-R AGCAAACCCAAAATGTCA

[0033] 2. Role of CRISPR-TaJAZ1 gene in the physicochemical properties involved in wheat starch synthesis

[0034] (1) Effects of CRISPR-TaJAZ1 gene on 1000-grain weight and starch content of wheat grains

[0035] After maturity, mature grains of different Zhengmai 7698 mutant lines were harvested, and then qualitative observation and quantitative detection were carried out on the grain length, grain width, grain weight, and starch content of the grains. The results are shown in Table 2 and Figure 2 as follows: For the three mutant lines of CRISPR-TaJAZ1, the grain length (increases were 7.1%, 4.3%, and 3.3% respectively), grain width (increases were 9.3%, 10.5%, and 9.3% respectively), 1000-grain weight (increases were 14.4%, 12.6%, and 9.4% respectively), and total starch content (increases were 17.7%, 11.9%, and 6.8% respectively) of wheat grains were all significantly higher than those of wild-type plants.

[0036] It shows that TaJAZ1 mainly affects the change of total starch content, thereby making the grains plump and full.

[0037] Table 2 Comparison of grain traits of different Zhengmai mutants

[0038] WT Tajaz1-abd Tajaz1-bd Tajaz1-ab Grain length (cm) 6.13±0.06b 6.57±0.06a 6.40±0.10a 6.33±0.06a Grain width (cm) 2.87±0.06b 3.13±0.06a 3.17±0.06a 3.13±0.06a Grain weight (g) 35.90±0.26c 41.07±0.67a 40.43±0.55a 39.27±0.15b Total starch content (%) 47.41±2.22c 55.80±3.39a 53.04±1.44a 50.65±1.41b

[0039] Note: Tajaz1-abd, Tajaz1-bd, and Tajaz1-ab represent three mutant lines; WT represents Zhengmai 7698, which is the wild type.

[0040] (2) Effects of the CRISPR-TaJAZ1 gene on the physicochemical properties of wheat grain starch

[0041] Previous studies have shown that the quality of wheat starch is closely related to its swelling properties and gelatinization temperature. Therefore, to further investigate the effect of the TaJAZ1 gene on wheat starch quality in this invention, the swelling potential, solubility, and thermal properties (such as onset gelatinization temperature, peak gelatinization temperature, endset gelatinization temperature, and enthalpy value) of grain starch were measured, as shown in Table 3.

[0042] Table 3 Comparison of the physicochemical properties of starches from different Zhengmai mutants

[0043] WT Tajaz1-abd Tajaz1-bd Tajaz1-ab Swelling power (g / g) 12.39±0.95c 21.2±1.38a 18.03±1.02b 13.99±0.88c Solubility (%) 5.66±1.08c 11.53±2.03a 8.22±3.11b 7.66±0.77b Initial gelatinization temperature (℃) 58.27±0.12b 59.63±0.09a 59.30±0.06a 59.33±0.20a Peak gelatinization temperature (℃) 61.33±0.07b 62.47±0.09a 62.70±0.00a 62.97±0.15a Final gelatinization temperature (℃) 65.07±0.07c 65.67±0.18b 65.53±0.33b 66.43±0.24a Enthalpy value (J / g) 2.53±0.04a 2.16±0.00b 1.53±0.02d 1.94±0.01c

[0044] Note: Tajaz1-abd, Tajaz1-bd, and Tajaz1-ab represent three mutant lines; WT represents Zhengmai 7698, which is the wild type.

[0045] The swelling potential (with increases of 71.1%, 45.5%, and 12.9% respectively), solubility (with increases of 103.7%, 45.2%, and 35.3% respectively), onset gelatinization temperature (with increases of 2.3%, 1.8%, and 1.8% respectively), peak gelatinization temperature (with increases of 1.9%, 2.2%, and 2.7% respectively), and endset gelatinization temperature (with increases of 0.9%, 0.7%, and 2.1% respectively) of the three CRISPR-TaJAZ1 mutant lines were all significantly higher than those of the wild type; while the gelatinization enthalpy was significantly lower than that of the wild type, with decreases of 14.6%, 39.5%, and 23.3% respectively.

[0046] The above results indicate that the CRISPR-TaJAZ1 mutants can affect the properties of grain starch and increase the swelling potential, solubility, and gelatinization temperature (such as onset gelatinization temperature, peak gelatinization temperature, and endset gelatinization temperature) of grain starch.

[0047] 3. Regulatory role of the CRISPR-TaJAZ1 gene in genes involved in key enzymes of wheat starch synthesis

[0048] To verify the expression of the TaJAZ1 gene in different Zhengmai 7698 mutants, the single grains of wheat lines of the above three mutant types (tajaz1-abd, tajaz1-bd, tajaz1-ab) were planted. In the middle stage of grain filling, immature grains in the middle of the wheat ears were selected to extract RNA, and reverse transcription was performed to ssDNA for RT-RCR detection. As Figure 3As shown in A, compared with Zhengmai 7698 (WT), the expression level of TaJAZ1 was significantly decreased in the Tajaz1-abd, Tajaz1-bd, and Tajaz1-ab mutant lines (the decreases were 77.5%, 64.4%, and 72.0% respectively), indicating that the TaJAZ1 gene was inhibited in these mutant wheat lines.

[0049] Wheat starch is synthesized by four major types of enzymes, namely AGPase, GBSS, SSS, and SBE. AGPase acts on the first step of starch synthesis and plays a key role in total starch synthesis. Then, the enzyme activity of AGPase ( Figure 3 B) was measured, and it was significantly increased in the tajaz1-abd, tajaz1-bd, and tajaz1-ab mutant lines (the increases were 6.5, 2.3, and 0.2 times respectively). At the physiological level, it indicates that TaJAZ1 participates in wheat grain starch synthesis by changing the enzyme activity of AGPase.

[0050] In higher plants, according to the location in the cell, AGPase is divided into two types: cytosolic and plastidial, and it is composed of two larger regulatory subunits (AGPL) and two smaller catalytic subunits (AGPS). However, in the endosperm of most gramineous crops such as rice, wheat, and corn, cytosolic AGPase accounts for the vast majority (more than 85%), and the subunits AGPS1 and AGPL1 are mainly expressed. The expressions of TaAGPS1 and TaAGPL1 were further measured. As Figure 3 shown in C-D, the genes of TaAGPS1 (the increases were 1.9 times, 1.0 times, and 36.0% respectively) and TaAGPL1 (the increases were 1.1 times, 66.9%, and 61.2% respectively) were significantly up-regulated in the tajaz1-abd, tajaz1-bd, and tajaz1-ab mutant lines.

[0051] At the molecular level, it indicates that TaJAZ1 participates in wheat grain starch synthesis by controlling the expressions of TaAGPS1 and TaAGPL1 genes.

[0052] In summary, these results indicate that the mutants obtained in this study have a potential improvement effect on wheat starch quality.

[0053] Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, it can be understood that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirits of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. The application of TaJAZ1 gene in wheat starch synthesis, characterized in that: The nucleotide sequence of the TaJAZ1 gene is shown in SEQ ID NO.1, which has an improving effect on the quality of wheat starch.

2. The use of the TaJAZ1 gene according to claim 1 in participating in wheat starch synthesis, characterized in that: The application is to increase the thousand-grain weight and total starch content of wheat grains, and make the grains full and substantial.

3. The use of the TaJAZ1 gene according to claim 1 in participating in wheat starch synthesis, characterized in that: The application is to increase the swelling potential, solubility and gelatinization temperature of wheat grain starch.

4. The use of the TaJAZ1 gene according to claim 1 in participating in wheat starch synthesis, characterized in that: The application is: at the molecular level, the TaJAZ1 gene participates in the synthesis of wheat grain starch by controlling the expression of the TaAGPS1 gene and the TaAGPL1 gene.

5. The use of the TaJAZ1 gene according to claim 3 in participating in wheat starch synthesis, characterized in that: The gelatinization temperature includes the initial gelatinization temperature, the peak gelatinization temperature, and the final gelatinization temperature.

Images