Metarhizium ledebusii GZFW2211 and application thereof

Abstract

The invention provides metarhizium ledebusii GZFW2211 and an application of the metarhizium ledebusii GZFW2211. The green muscardine fungus GZFW2211 is preserved in Guangdong Microbial Culture Collection Center on February 13, 2025, and the preservation number is GDMCC No: 65784. The spodoptera frugiperda spore suspension is a strain separated from spodoptera frugiperda larvae, the strain is high in growth speed, short in conidium production time and large in spore production quantity, and the prepared spore emulsion suspension is high and stable in pathogenicity to important pests such as spodoptera frugiperda, prodenia litura and agrotis ypsilon. The insecticidal composition can be widely used for preventing and treating pests such as spodoptera litura, prodenia litura and agrotis ypsilon.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and particularly relates to a Metarhizium rileyi GZFW22_11 and its application. Background Art

[0002] Pests such as Spodoptera frugiperda, Spodoptera litura, and Agrotis ipsilon belong to the order Lepidoptera, family Noctuidae, and are the three major pests that seriously damage crops, posing a serious threat to agriculture and food production worldwide. Traditional control methods mainly rely on chemical pesticides, but there are problems such as environmental pollution and pest resistance. Therefore, studying the biological control of Spodoptera frugiperda, Spodoptera litura, and Agrotis ipsilon to avoid the resistance and agricultural product safety problems caused by the unreasonable use of chemical pesticides has become an important topic for sustainable pest management.

[0003] Entomopathogenic fungi are the largest group among insect pathogenic microorganisms. Entomopathogenic fungi infect and kill insect hosts in nature and cause epidemics, thus being developed as fungal biopesticides and used as environmentally friendly alternatives to chemical pesticides to control the populations of various agricultural, forestry, and sanitary pests. Therefore, screening entomopathogenic fungi with high pathogenicity to Spodoptera frugiperda, Spodoptera litura, and Agrotis ipsilon is of great significance for the sustainable prevention and control of pests. Summary of the Invention

[0004] The purpose of the present invention is to provide a Metarhizium rileyi GZFW22_11 strain with high sporulation, strong pathogenicity, and stability. This strain was deposited at the Guangdong Provincial Culture Collection Center of Microorganisms (GDMCC) on February 13, 2025. Address: 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Postcode: 510070, Deposit Number: GDMCC No: 65784.

[0005] The second purpose of the present invention is to provide a biocontrol agent containing Metarhizium rileyi GZFW22_11 as an active ingredient.

[0006] The third purpose of the present invention is to provide the application of the above-mentioned Metarhizium rileyi GZFW22_11 in agricultural pests.

[0007] The pests are Spodoptera frugiperda, Spodoptera litura, or Agrotis ipsilon.

[0008] The fourth object of the present invention is to provide a method for controlling agricultural pests, which uses Metarhizium rileyi GZFW22_11 for control.

[0009] Preferably, an agent containing Metarhizium rileyi GZFW22_11 is used to infect agricultural pests.

[0010] Preferably, the agent containing Metarhizium rileyi GZFW22_11 is a suspension concentrate containing Metarhizium rileyi GZFW22_11.

[0011] Preferably, the suspension concentrate contains Tween 80, PEG-200, sodium dodecylbenzenesulfonate and conidia of Metarhizium rileyi GZFW22_11.

[0012] Preferably, the suspension concentrate contains, by volume fraction, 0.05-0.1% of Tween 80, 0.01-0.03% of PEG-200, 0.02-0.06% of sodium dodecylbenzenesulfonate, with water as the solvent, and 1×10 8 conidia / mL of Metarhizium rileyi GZFW22_11 conidia.

[0013] The present invention isolated and identified the strain Metarhizium rileyi GZFW22_11, prepared a suspension concentrate of conidia of Metarhizium rileyi GZFW22_11, determined the pathogenicity of this biocontrol agent against Spodoptera frugiperda, Spodoptera litura and Agrotis ipsilon, and found that Metarhizium rileyi GZFW22_11 grew well and had the highest sporulation amount. The suspension concentrate had strong and stable pathogenicity against Spodoptera frugiperda, Spodoptera litura and Agrotis ipsilon, and could be widely used for the control of pests such as Spodoptera frugiperda, Spodoptera litura and Agrotis ipsilon, having good development and application prospects.

[0014] Metarhizium rileyi GZFW22_11 was deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) on February 13, 2025. Address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Postcode: 510070, Deposit Number: GDMCC No: 65784. Description of the Drawings

[0015] Figure 1 It is a morphological diagram of Metarhizium rileyi GZFW22_11. A: Cultured for 5 days; B: Cultured for 10 days;

[0016] Figure 2 It is a diagram of conidia of Metarhizium rileyi GZFW22_11;

[0017] Figure 3It is the phylogenetic tree of Metarhizium rileyi GZFW22_11;

[0018] Figure 4 It is the figure of Metarhizium rileyi GZFW22_11 infecting Spodoptera frugiperda. Detailed implementation manners

[0019] The following examples are for further illustration of the present invention rather than limitation thereof.

[0020] Example 1: Isolation and identification of Metarhizium rileyi GZFW22_11

[0021] 1.1 Materials and methods

[0022] 1.1.1 Preparation of culture medium

[0023] The experimental culture medium is Sabouraud dextrose agar medium SDAY, and the preparation of SDAY medium is as follows: 40 g of glucose, 10 g of peptone, 10 g of yeast extract powder, 20 g of agar, and 1000 mL of water. Autoclave at 121 °C for 25 min.

[0024] 1.1.2 Isolation and purification of Metarhizium rileyi strains

[0025] Larvae of Spodoptera frugiperda infected with Metarhizium epidemic were collected in a corn field in Guangzhou. In a laminar flow hood, the mycelia on the surface of the larvae were continuously streaked and inoculated onto Sabouraud SDAY medium containing streptomycin and ampicillin resistance. After a white transparent colony was formed, it was continuously streaked and separated on Sabouraud SDAY medium without resistance to obtain a single-spore purified strain, and a single-spore purified strain with strong sporulation ability was screened.

[0026] 1.1.3 Rejuvenation of Metarhizium rileyi strains

[0027] The isolated strain was cultured on SDAY medium at 28 °C for 10 - 12 days, and the spore powder was scraped off. Then the spore powder was transferred to a 50 mL centrifuge tube containing sterile water with 0.05% Tween 80, and the suspension was vortexed for 5 min. Quantification was performed using a hemocytometer, and sterile water was added to adjust the spore concentration to 1×10 8 cells / mL. The adjusted spore suspension was used to infect the larvae of Galleria mellonella aseptically by the immersion method. After the larvae of Galleria mellonella died and produced a large number of conidia, the conidia were used for streak culture, and a strain with fast sporulation and high sporulation yield was obtained by single-spore isolation and purification.

[0028] 1.1.4 Molecular identification of Metarhizium rileyi strains

[0029] Identify the dominant pathogenic fungi of Spodoptera frugiperda by homology alignment and rDNA internal transcribed spacer (ITS) phylogeny. The genomic DNA of the isolate GZFW22_11 was extracted using the Ezup column fungal genomic DNA extraction kit (Sangon, Shanghai). The ITS region of the strain was amplified using ITS primers (ITS1): 5'-TCCGTAGGTGAACCTGCGG-3'; reverse (ITS4): 5'-TCCTCCGCTTATTGATATGC-3'), sent to Sangon Biotech (Guangzhou) Co., Ltd. for sequencing, and the obtained sequences were analyzed by blastn alignment, and a phylogenetic tree was constructed using MEGA7.

[0030] 1.2 Experimental results

[0031] 1.2.1 Solid culture morphology of Metarhizium rileyi

[0032] The Metarhizium rileyi strain was isolated from single spores of the naturally infected larvae of Spodoptera frugiperda, cultured on SDAY medium, and the strain that produced a large amount of conidia after 10 days of culture ( Figure 1 , green conidial powder) was made into a conidial suspension ( Figure 2 ) to infect the larvae of Galleria mellonella for rejuvenation, and the single-spore strain that formed conidia earliest on the larvae of Galleria mellonella was selected for single-spore isolation to obtain a purified strain, namely Metarhizium rileyi GZFW22_11.

[0033] Metarhizium rileyi GZFW22_11 was cultured on SDAY medium for 3 days to obtain a transparent round colony; after 5-7 days of culture, the colony was white and fluffy, the hyphae were tightly combined with the medium and not easy to pick up, and the hyphae were septate; after 10-12 days of culture, the colony was green and a large amount of conidia were produced on the surface ( Figure 1 ). Under the optical microscope, as Figure 2 shown, the conidiophores were produced from the vegetative hyphae, and the conidia were round or oblong, with a size of (2-8)×(2-4) μm.

[0034] 1.2.2 Molecular identification of Metarhizium rileyi

[0035] The ITS gene fragment of Metarhizium rileyi GZFW22_11 was amplified by PCR using ITS1 and ITS4 as universal primers, and its nucleotide sequence was obtained as shown in SEQ ID NO.1 after sequencing. Using NCBI online alignment blastn, it was found that the homology with Metarhizium rileyi reached 100%, and the phylogenetic tree was as Figure 3As shown, the high-spore-producing strain isolated and purified was determined to be Metarhizium rileyi GZFW22_11, which was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on February 13, 2025, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Postal Code: 510070, and the collection number is: GDMCC No: 65784.

[0036] Based on this, we also isolated and identified Metarhizium reinhardtii GZFW22_2, Metarhizium reinhardtii GZFW22_3, Metarhizium reinhardtii GZFW22_7, Metarhizium reinhardtii GZFW22_10, and Metarhizium reinhardtii GZFW22_15 from the larvae of Spodoptera frugiperda naturally infected with fungi.

[0037] Example 2: Determination of spore production of isolated strains of Metarhizium anisopliae

[0038] 2.1 Materials and methods

[0039] 2.1.1 Determination of spore production of isolated strains of Metarhizium rapae

[0040] The isolated strain was inoculated in the center of the SDAY medium plate and cultured in a constant temperature incubator at a temperature of (28±1)℃ and a photoperiod of 14:10 (L:D). After 15 days of culture, a sterile cork puncher with a diameter of 6mm was used to punch a bacterial block from the center to 1 / 2 of the edge of the colony. Five holes were punched on each culture plate, and the culture medium punched out by the cork puncher was immersed in a 50mL centrifuge tube containing 10mL of sterile 0.05% Tween-80 solution. The spores on the culture medium were vortexed and mixed to dissolve all in the Tween-80 solution. The spores were counted with a hemocytometer and converted into per mm 2 SPSS 27.0 was used for data analysis.

[0041] 2.1.2 Determination of conidia germination rate of isolated strains of Metarhizium rapae

[0042] The conidia powder cultured for 15 days was scraped into a centrifuge tube containing 0.05% Tween80 solution, vortexed and mixed, and counted using a hemocytometer to adjust the conidia concentration to 1×10 5 Spores / mL. Take 100 μL of the above conidia solution and evenly spread it on SDAY medium and culture it at a constant temperature of 28°C. After 24h and 36h of culture, randomly cut off a square culture medium with a side length of 1 cm and observe it under a microscope. The spore germ tube length greater than half of the spore length is considered to be germinated. Spore germination rate = number of spore germination / total number of conidia × 100%. Each statistical germination of 100 spores is considered as a replicate. Three biological replicates are set for each group, and SPSS27.0 is used for data analysis.

[0043] 2.2 Experimental Results

[0044] 2.2.1 Sporulation of Isolated Strains of Metarhizium rileyi

[0045] The conidia yields of isolated strains of Metarhizium rileyi cultured on SDAY medium for 15 days are shown in Table 1. There are differences in the conidia yields of different isolated strains of Metarhizium rileyi. The strain GZFW22_11 has the highest sporulation, which is 3.47×10 6 spores / mm 2 , and the sporulation of different strains is GZFW22_11 > GZFW22_7 > GZFW22_10 > GZFW22_15 > GZFW22_3 > GZFW22_2.

[0046] Table 1 Sporulation of Isolated Strains of Metarhizium rileyi (spores / mm 2 )

[0047] Spore collection time (days) GZFW22_2 GZFW22_3 GZFW22_7 GZFW22_10 GZFW22_11 GZFW22_15 <![CDATA[15d Spore production amount (×10 6 )]]> 1.72±0.27bc 1.58±0.33c 2.97±0.43ab 1.77±0.20bc 3.47±0.31a 0.63±0.03c

[0048] 2.2.2 Germination Rate of Conidia of Isolated Strains of Metarhizium rileyi

[0049] There are no significant differences in the germination rates of conidia of different isolated strains of Metarhizium rileyi. The germination rates of conidia of different strains are GZFW22_11 > GZFW22_7, GZFW22_10 > GZFW22_3 > GZFW22_15 > GZFW22_2 (Table 2).

[0050] Table 2 Germination Rate of Conidia of Isolated Strains of Metarhizium rileyi (%)

[0051]

[0052]

[0053] Preparation Example: Preparation of Conidia Suspension Emulsion of Metarhizium rileyi Strain GZFW22_11

[0054] The preparation of a conidia suspension emulsion of Metarhizium rileyi strain GZFW22_11 is made according to the following steps:

[0055] First, a suspension emulsion mixture (with water as the solvent) is made according to the following volume ratio:

[0056] Mixture 1: 0.05% Tween 80, 0.01% PEG-200, and 0.02% sodium dodecylbenzenesulfonate, mixed evenly in proportion;

[0057] Mixture 2: 0.1% Tween 80, 0.02% PEG-200, and 0.04% sodium dodecylbenzenesulfonate, mixed evenly in proportion;

[0058] Mixture 3: 0.1% Tween 80, 0.03% PEG-200, and 0.06% sodium dodecylbenzenesulfonate, mixed evenly in proportion.

[0059] Secondly, collect fresh conidial powder of Metarhizium rileyi GZFW22_11 strain, scrape the conidial powder, and then transfer the conidial powder into the above-mentioned mixture 1, mixture 2, and mixture 3 of Tween 80, PEG-200, and sodium dodecylbenzenesulfonate, mix well, quantify with a hemocytometer, and adjust the concentration of conidia to 1×10 8 conidia / mL, and prepare suspension emulsions 1, 2, and 3 with a conidial concentration of 1×10 8 conidia / mL. Suspension emulsions of Metarhizium rileyi GZFW22_11 strain with different conidial concentrations can also be prepared according to needs.

[0060] Example 3: Screening of conidial suspension emulsion of Metarhizium rileyi GZFW22_11 strain

[0061] 3.1 Materials and Methods

[0062] 3.1.1 Determination of the pathogenicity of conidial suspension emulsion of Metarhizium rileyi GZFW22_11 strain against Galleria mellonella

[0063] Using the insect dipping method, bioassay the pathogenicity of conidial suspension emulsion of Metarhizium rileyi GZFW22_11 strain against Galleria mellonella. Randomly divide the 5th instar Galleria mellonella reared in the laboratory into groups, with 20 individuals in each group. Immerse the Galleria mellonella into the conidial suspension emulsions 1, 2, and 3 with a concentration of 1×10 8 conidia / mL for 5 s, then place the insects on filter paper to crawl for 20 s to remove the excess liquid, and then transfer the Galleria mellonella to a rearing box (20 cm × 15 cm × 5 cm) for rearing, add feed, observe the number of dead larvae every day, and replace the rearing box and feed. Set 3 replicates, and use the mixture 1, mixture 2, and mixture 3 corresponding to different suspension emulsions as controls.

[0064] 3.2 Experimental Results

[0065] The pathogenicity of different conidial suspension emulsions of Metarhizium rileyi GZFW22_11 strain against Galleria mellonella is shown in Table 3. The suspension emulsions are ranked according to the LT 50 value for the pathogenicity of different suspension emulsions against the 5th instar larvae of Galleria mellonella: suspension emulsion 1 > suspension emulsion 2 > suspension emulsion 3 > aqueous conidia solution control.

[0066] Table 3 Pathogenicity of 1×10 8 spores / mL conidial suspension emulsion of Metarhizium rileyi GZFW22_11 strain against Galleria mellonella

[0067] Treatment time (d) Conidia aqueous solution control Suspension emulsion 1 Suspension emulsion 2 Suspension emulsion 3 <![CDATA[LT 50 (d)]]> 6.56±0.12a 6.01±0.13b 6.08±0.09ab 6.07±0.13ab

[0068] Example 4: Pathogenicity determination of the conidial suspension emulsion of Metarhizium rileyi strain GZFW22_11

[0069] 4.1 Materials and methods

[0070] 4.1.1 Pathogenicity determination of the conidial suspension emulsion of Metarhizium rileyi strain GZFW22_11 against Spodoptera frugiperda

[0071] The dipping method was used to bioassay the pathogenicity of the conidial suspension emulsion of Metarhizium rileyi strain GZFW22_11 against Spodoptera frugiperda. The 3rd instar larvae of Spodoptera frugiperda reared in the laboratory were randomly grouped, with 20 larvae in each group. The larvae were immersed in suspension 1 with different conidial concentrations for 5 s, then the larvae were placed on filter paper to crawl for 20 s to remove the excess liquid. Then the Spodoptera frugiperda larvae were transferred to individual pudding boxes for single rearing, and feed was added. The rearing conditions were 26℃ (±2), 70 (±5%) RH, and the photoperiod was 14:10 (L:D). The number of dead larvae was observed every 2 d, and the rearing boxes and feed were replaced. Three replicates were set, and sterile water containing 0.05% Tween 80 was used as the control.

[0072] 4.1.2 Pathogenicity determination of the isolated Metarhizium rileyi strain against Spodoptera litura

[0073] The dipping method was used to bioassay the pathogenicity of the conidial suspension emulsion of Metarhizium rileyi strain GZFW22_11 against Spodoptera litura. The 3rd instar larvae of Spodoptera litura reared in the laboratory were randomly grouped, with 20 larvae in each group. The larvae were immersed in suspension 1 with different conidial concentrations for 5 s, then the larvae were placed on filter paper to crawl for 20 s to remove the excess liquid. Then the Spodoptera litura larvae were transferred to rearing boxes (20 cm × 15 cm × 5 cm) for rearing, and feed was added. The rearing conditions were 26℃ (±2), 70 (±5%) RH, and the photoperiod was 14:18 (L:D). The number of dead larvae was observed every 2 d, and the rearing boxes and feed were replaced. Three replicates were set, and sterile water containing 0.05 mL / L Tween 80 was used as the control.

[0074] 4.1.3 Pathogenicity determination of the isolated Metarhizium rileyi strain against Agrotis ypsilon

[0075] The immersion method was used to bioassay the pathogenicity of the conidial suspension emulsion of Metarhizium rileyi strain GZFW22_11 against Agrotis ypsilon. The 3rd instar larvae of A. ypsilon reared in the laboratory were randomly divided into groups of 20 each. The larvae were immersed in suspension emulsion 1 with different conidial concentrations for 5 s, and then the larvae were placed on filter paper to crawl for 20 s to remove the excess liquid. Then the A. ypsilon larvae were transferred to an insect rearing box (20 cm × 15 cm × 5 cm) for rearing, and feed was added. The rearing conditions were 26°C (±2), 70 (±5%) RH, and the photoperiod was 14:10 (L:D). The number of dead larvae was observed every 2 days, and the rearing box and feed were replaced. Three replicates were set up, and sterile water containing 0.05 mL / L Tween 80 was used as the control.

[0076] 4.2 Test results

[0077] 4.2.1 Pathogenicity of the conidial suspension emulsion of Metarhizium rileyi strain GZFW22_11 at different concentrations against Spodoptera frugiperda

[0078] The pathogenicity of the conidial suspension emulsion of Metarhizium rileyi strain GZFW22_11 against Spodoptera frugiperda is shown in Table 4. The results showed that the pathogenicity increased with the increase of the infection spore concentration, and the LT 50 time decreased with the increase of the concentration. Considering the cumulative corrected mortality and LT 50 value, it indicated that the conidial suspension emulsion of strain GZFW22_11 had strong pathogenicity against the larvae of S. frugiperda. After Metarhizium rileyi strain GZFW22_11 infected and killed S. frugiperda, the hyphae penetrated the body wall again, formed white hyphae on the surface of the insect cadaver, and then gradually changed from light green to green, and the insect cadaver was covered with green conidial powder( Figure 4 ).

[0079] Table 4 Pathogenicity of the conidial suspension emulsion of Metarhizium rileyi strain GZFW22_11 at different concentrations against Spodoptera frugiperda

[0080]

[0081] Note: The data in the table are mean ± standard error. Different lowercase letters after the data in the same column indicate significant differences (One-Way ANOVA, Tukey test, p < 0.05)

[0082] 3.2.2 Pathogenicity of the conidial suspension emulsion of Metarhizium rileyi strain GZFW22_11 at different concentrations against Spodoptera litura

[0083] Table 5 results showed that the pathogenicity of the conidial suspension emulsion of Metarhizium rileyi strain GZFW22_11 against Spodoptera litura increased with the increase of the spore concentration, and the LT 50 time decreased with the increase of the concentration. Considering the cumulative corrected mortality and LT 50The value indicates that the conidia suspension emulsion of the GZFW22_11 strain has strong pathogenicity against the larvae of Spodoptera litura.

[0084] Table 5 Pathogenicity of different concentrations of the conidia suspension emulsion of Metarhizium rileyi GZFW22_11 strain against Spodoptera frugiperda

[0085]

[0086] Note: The data in the table are mean ± standard error. Different lowercase letters after the data in the same column indicate significant differences (One-Way ANOVA, Tukey test, p < 0.05)

[0087] 3.2.3 Pathogenicity of different concentrations of the conidia suspension emulsion of Metarhizium rileyi GZFW22_11 strain against Agrotis ypsilon

[0088] Table 6 Results show that the pathogenicity of the conidia suspension emulsion of Metarhizium rileyi GZFW22_11 strain against Agrotis ypsilon increases with the increase of spore concentration, and LT 50 time decreases with the increase of concentration. Considering the cumulative corrected mortality rate and LT 50 value, it indicates that the conidia suspension emulsion of the GZFW22_11 strain has strong pathogenicity against the larvae of Agrotis ypsilon.

[0089] Table 6 Pathogenicity of different concentrations of the conidia suspension emulsion of Metarhizium rileyi GZFW22_11 strain against Spodoptera frugiperda

[0090]

[0091]

[0092] Note: The data in the table are mean ± standard error. Different lowercase letters after the data in the same column indicate significant differences (One-Way ANOVA, Tukey test, p < 0.05)

[0093] >SEQ ID NO.1

[0094] GGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCATGTGAACTTATACCCTTTTCCTGTTGCCTCGGCGGGTCATTTGCCCCGGACCGGGCTCGTCCAGAGCCCGCCCGGAAACAGGCGCCCGCCGCGGGACCGAAACTCTGTATCTCTTAGCCTTTGGCACGTCTGAGTGGAATCATACAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGCGGTTTGGTGTTGGGGGCCGGCGATTGTCAGCTGGGCCGCTCAGGCGGTTCCCTGCGGCGCCGCCCCCGAAATGAATTGGCGGCCCCGTCGCGGCCTCCTCTGCGTAGTAGCACAACCTCGCAACAGGAGCGCGGCGCGGCCACTGCCGTAAAACGCACAAACTTCTCCAAGAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATAT。

Claims

1. Metarhizium rileyi GZFW22_11, deposit number: GDMCC No: 65784.

2. A biocontrol agent, characterized in that: Contains the Metarhizium anisopliae GZFW22_11 described in claim 1 as an active ingredient.

3. Use of the Metarhizium anisopliae GZFW22_11 described in claim 1 in preventing and controlling agricultural pests.

4. The use according to claim 3, characterized in that: The pest is the fall armyworm Spodoptera frugiperda, the fall armyworm Spodoptera litura or the cutworm Agrotis ipsilon.

5. A method for controlling agricultural pests, characterized in that: The control is carried out using the Metarhizium anisopliae GZFW22_11 described in claim 1.

6. The method according to claim 5, characterized in that The method is to infect agricultural pests with a bacterial agent containing the Metarhizium anisopliae GZFW22_11 described in claim 1.

7. The method according to claim 6, characterized in that The bacterial agent containing Metarhizium reinhardtii GZFW22_11 is a suspension emulsion containing Metarhizium reinhardtii GZFW22_11.

8. The method according to claim 7, characterized in that The suspension contains Tween 80, PEG-200, sodium dodecylbenzene sulfonate and conidia of Metarhizium anisopliae GZFW22_11.

9. The method according to claim 8, characterized in that The suspension contains, by volume, 0.05-0.1% Tween 80, 0.01-0.03% PEG-200, 0.02-0.06% sodium dodecylbenzene sulfonate, and the solvent is water. 1×10 8 Conidia of Metarhizium anisopliae GZFW22_11 at spores / mL.

Images