Porcine DNAJB6 gene editing method and application thereof

Abstract

The invention provides a pig DNAJB6 gene editing method and application thereof. The method is based on a CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / CRISPR associated protein 9) gene editing system, and comprises sgRNA designed and synthesized aiming at nucleotide sequences of an exon 2 and an exon 7 of a DNAJB6 gene and a targeting vector containing the sgRNA. The method can be used for obtaining the porcine testicular cells, tissues or animals edited by the porcine DNAJB6 gene, and the application of the obtained porcine testicular cells, tissues or animals in screening drugs or targets infected by porcine diarrhea virus.

Description

Technical Field

[0001] The present invention belongs to the technical field of animal genetic engineering, and particularly relates to a method for editing the porcine DNAJB6 gene and its application. Background Art

[0002] Heat shock proteins (HSPs) are a diverse subset of molecular chaperones that generally facilitate the correct folding of post-translational proteins and prevent their aggregation during cellular stress. Cellular chaperones may play important antiviral functions for host cells, but may also be beneficial for virus replication. HSP40 (also known as DNAJ), as a co-chaperone factor of HSP70, is a special co-chaperone molecule that has recently received extensive attention due to its key role in constitutive cellular functions and virus pathogenicity. Proteins of the DNAJ / HSP40 family are highly diverse at the primary sequence level but often share various combinations of four typical domains: a highly conserved N-terminal sequence of approximately 70 amino acids, the signature J domain, followed by a Gly / Phe-rich region, four CxxCxGxG-type finger repeats, and a less conserved C-terminal substrate-binding domain. According to the differences in these regions, HSP40s can be divided into three groups: type I proteins, such as Escherichia coli DNAJ, contain all four domains, while type II proteins lack the zinc-binding domain, and type III proteins only retain the characteristic J domain, which can be located at any position in the protein sequence.

[0003] Genome replication and / or virus assembly require the interaction between HSP40 and other chaperone proteins. Regarding the relationship between HSP40 and viruses, studies have shown that it plays a certain role in the host's resistance to virus infection. It may affect the host's resistance to viruses by participating in immune responses, regulating cell signaling, etc. In addition, some viruses may also utilize the cell's heat shock protein system to promote their replication and transmission. Summary of the Invention

[0004] In order to overcome one of the existing problems, the present disclosure provides, through gene editing technology, cells edited with the DNAJ / HSP40 gene (especially the DNAJB6 gene) and a method for constructing the same, so as to obtain somatic cell nuclear transfer donor cells for the cultivation of DNAJB6 gene-edited antiviral pigs and in vitro fertilized porcine microinjected embryos, which can be used for the breeding of disease-resistant pig breeds.

[0005] According to one aspect of the present disclosure, a method for establishing porcine DNAJB6 gene-edited cells is provided, the method comprising obtaining porcine DNAJB6 gene-edited cells by using gene editing technology.

[0006] In some embodiments, the method comprises the following steps:

[0007] (1) Based on the porcine DNAJB6 gene sequence, determine at least one targeting site for the exon sequence;

[0008] (2) Synthesize the sgRNA sequence according to the targeting site determined in step (1), and then ligate the synthesized sequence with a vector to construct an sgRNA targeting vector; and

[0009] (3) Transfect the sgRNA targeting vector into porcine somatic cells.

[0010] In some embodiments, the cells are porcine testicular (ST) cells.

[0011] In some embodiments, the exon is exon 2 and / or exon 7 of the DNAJB6 gene.

[0012] In some embodiments, the target sequence for exon 2 of the DNAJB6 gene has a nucleotide sequence as shown in CTTTTTAATATCCTCGGCTG (SEQ ID NO:30).

[0013] In some embodiments, the target sequence for exon 7 of the DNAJB6 gene has a nucleotide sequence as shown in CGCGTCCCACTACACGTGTG (SEQ ID NO:31).

[0014] In some embodiments, the sgRNA1 sequence synthesized for exon 2 of the DNAJB6 gene and its complementary sequence include: the nucleotide sequence as shown in CTTTTTAATATCCTCGGCTG (SEQ ID NO:30), and the nucleotide sequence as shown in CAGCCGAGGATATTAAAAAG (SEQ ID NO:32).

[0015] In some embodiments, the sgRNA2 sequence synthesized for exon 7 of the DNAJB6 gene and its complementary sequence include: the nucleotide sequence as shown in CGCGTCCCACTACACGTGTG (SEQ ID NO:31), and the nucleotide sequence as shown in CACACGTGTAGTGGGACGCG (SEQ ID NO:33).

[0016] In some embodiments, the gene editing technology includes a CRISPR / Cas9-based gene editing system.

[0017] In some embodiments, the sgRNA targeting vector includes an sgRNA sequence designed for the targeting site sequence of exon 2 and / or exon 7 of the DNAJB6 gene and a backbone vector.

[0018] In some embodiments, the backbone vector is the PX459 vector.

[0019] According to another aspect of the present disclosure, there is provided a pig DNAJB6 gene editing targeting vector.

[0020] In some embodiments, the targeting vector includes an sgRNA sequence designed for the targeting site sequence of exon 2 of the DNAJB6 gene.

[0021] In some embodiments, the target sequence for exon 2 of the DNAJB6 gene has a nucleotide sequence as shown in CTTTTTAATATCCTCGGCTG (SEQ ID NO: 30).

[0022] In some embodiments, the targeting vector includes an sgRNA sequence designed for the targeting site sequence of exon 7 of the DNAJB6 gene.

[0023] In some embodiments, the target sequence for exon 7 of the DNAJB6 gene has a nucleotide sequence as shown in CGCGTCCCACTACACGTGTG (SEQ ID NO: 31).

[0024] In some embodiments, the targeting vector includes a backbone vector.

[0025] In some embodiments, the backbone vector is the PX459 vector.

[0026] In some embodiments, the sgRNA1 sequence synthesized for exon 2 of the DNAJB6 gene and its complementary sequence include: the nucleotide sequence as shown in CTTTTTAATATCCTCGGCTG (SEQ ID NO: 30), and the nucleotide sequence as shown in CAGCCGAGGATATTAAAAAG (SEQ ID NO: 32).

[0027] In some embodiments, the sgRNA2 sequence synthesized for exon 7 of the DNAJB6 gene and its complementary sequence include: the nucleotide sequence as shown in CGCGTCCCACTACACGTGTG (SEQ ID NO: 31), and the nucleotide sequence as shown in CACACGTGTAGTGGGACGCG (SEQ ID NO: 33).

[0028] According to yet another aspect of the present disclosure, there are provided cells, tissues or animals with DNAJB6 gene editing obtained by the above methods of the present disclosure.

[0029] In some embodiments, the cells may include somatic cells of pigs (such as pig testicular cells) and / or germ cells.

[0030] In some embodiments, the obtained cells, tissues or animals may have the nucleotide sequences shown in SEQ ID NO: 28 and SEQ ID NO: 29.

[0031] According to another aspect of the present disclosure, there is provided the use of the above-described method of the present disclosure in obtaining cells, tissues or animals with DNAJB6 gene editing.

[0032] According to another aspect of the present disclosure, there is provided the use of the above-described method of the present disclosure in animal (e.g., pig (Sus scrofa)) breeding.

[0033] In some embodiments, the cells, tissues or animals are capable of resisting viral infection.

[0034] In some embodiments, the virus may include, but is not limited to, classical swine fever virus (CSFV), African swine fever virus (ASFV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), transmissible gastroenteritis virus of swine (TGEV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV), swine acute diarrhea syndrome coronavirus (SADS-COV), porcine respiratory coronavirus (PRCV), porcine hemagglutinating encephalomyelitis virus (PHEV), porcine parvovirus (PPV), porcine circovirus (PCV), Japanese encephalitis virus (JEV).

[0035] According to another aspect of the present disclosure, there is provided the application of the above cells, tissues or animals in screening drugs or targets for viral infection.

[0036] In some embodiments, the animal is a pig.

[0037] In some embodiments, the virus includes one or more of classical swine fever virus (CSFV), African swine fever virus (ASFV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), transmissible gastroenteritis virus of swine (TGEV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV), swine acute diarrhea syndrome coronavirus (SADS-COV), porcine respiratory coronavirus (PRCV), porcine hemagglutinating encephalomyelitis virus (PHEV), porcine parvovirus (PPV), porcine circovirus (PCV), Japanese encephalitis virus (JEV).

[0038] In the first aspect of the present invention, there is provided an sgRNA targeting the DNAJB6 gene, which comprises: sgRNA-1 and / or sgRNA-2;

[0039] The target sequence of the sgRNA-1 has a nucleotide sequence as shown in CTTTTTAATATCCTCGGCTG (SEQ ID NO: 30);

[0040] The target sequence of the sgRNA-2 has a nucleotide sequence as shown in CGCGTCCCACTACACGTGTG (SEQ ID NO: 31).

[0041] In some embodiments, the sense strand of the sgRNA-1 has a nucleotide sequence as shown in CTTTTTAATATCCTCGGCTG (SEQ ID NO: 30); and / or

[0042] The sense strand of the sgRNA-2 has a nucleotide sequence as shown in CGCGTCCCACTACACGTGTG (SEQ ID NO: 31).

[0043] In some embodiments, the antisense strand of the sgRNA-1 has a nucleotide sequence as shown in CAGCCGAGGATATTAAAAAG (SEQ ID NO: 32); and / or

[0044] The antisense strand of the sgRNA-2 has a nucleotide sequence as shown in CACACGTGTAGTGGGACGCG (SEQ ID NO: 33).

[0045] In some embodiments, the DNAJB6 gene is the porcine DNAJB6 gene (preferably with the accession number XM_047776810.1).

[0046] In a second aspect of the present invention, there is provided a biomaterial related to the sgRNA of the first aspect of the present invention, and the biomaterial comprises any one of n1)-n9):

[0047] n1) A nucleic acid molecule encoding the sgRNA of the first aspect of the present invention;

[0048] n2) An expression cassette comprising the nucleic acid molecule of n1);

[0049] n3) A vector comprising the nucleic acid molecule of n1);

[0050] n4) A vector comprising the expression cassette of n2);

[0051] n5) A cell comprising the nucleic acid molecule of n1);

[0052] n6) A cell comprising the expression cassette of n2);

[0053] n7) A cell comprising the vector of n3);

[0054] n8) A cell comprising the vector described in n4);

[0055] n9) A cell comprising the sgRNA of the first aspect of the present invention;

[0056] Any one of the cells in n5)-n9) does not contain propagating material.

[0057] In some embodiments, any one of the vectors in n3)-n4) includes a prokaryotic expression vector and a eukaryotic expression vector.

[0058] In some embodiments, the eukaryotic expression vector includes a yeast expression vector, a mammalian expression vector, an insect expression vector, etc.

[0059] In some embodiments, the backbone vector of any one of the vectors in n3)-n4) is the PX459 vector.

[0060] In some embodiments, when the sgRNA comprises sgRNA-1 and sgRNA-2, the nucleic acid molecule encoding sgRNA-1 and the nucleic acid molecule encoding sgRNA-2 are located in the same vector or in two separate vectors.

[0061] In some embodiments, any one of the cells in n5)-n9) is selected from prokaryotic cells and eukaryotic cells.

[0062] In some embodiments, the prokaryotic cells include bacterial cells, Escherichia coli, and Streptomyces.

[0063] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.

[0064] In the third aspect of the present invention, there is provided the use of the sgRNA of the first aspect of the present invention, or the biological material of the second aspect of the present invention, in any one of a1)-a5);

[0065] a1) Knock out the DNAJB6 gene;

[0066] a2) Construct a cell, tissue or animal with a knocked-out DNAJB6 gene;

[0067] a3) Animal breeding;

[0068] a4) Prepare a product for use in any one of a1)-a3);

[0069] a5) Prepare a drug for preventing and / or treating viral infections or diseases caused by viruses.

[0070] In some embodiments, the DNAJB6 gene is the porcine DNAJB6 gene (preferably with the accession number XM_047776810.1).

[0071] In some embodiments, a4) the product is a reagent or a kit.

[0072] In some embodiments, a2) the cell, tissue or animal may have a nucleotide sequence as shown in SEQ ID NO:28 and / or SEQ ID NO:29 (i.e., a C base deletion occurs at position 244 of the DNAJB6 gene (porcine DNAJB6 gene (preferably with the accession number XM_047776810.1)) of the cell, tissue or animal, and / or a T base is inserted after position 1022 (i.e., a T base is inserted between positions 1022 and 1023).

[0073] In some embodiments, a2) the cell comprises a somatic cell (e.g., porcine testicular cell) and / or a germ cell of a pig; more specifically, it is a porcine ST cell.

[0074] In some embodiments, a2) and a3) the animal is a pig.

[0075] In some embodiments, a2) the cell, tissue or animal is resistant to viral infection.

[0076] In some embodiments, a3) the animal is resistant to viral infection.

[0077] In some embodiments, the virus comprises at least one of classical swine fever virus (CSFV), African swine fever virus (ASFV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), transmissible gastroenteritis virus of swine (TGEV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV), swine acute diarrhea syndrome coronavirus (SADS-COV), porcine respiratory coronavirus (PRCV), porcine hemagglutinating encephalomyelitis virus (PHEV), porcine parvovirus (PPV), porcine circovirus (PCV), Japanese encephalitis virus (JEV); more specifically, it is transmissible gastroenteritis virus of swine (TGEV).

[0078] In a fourth aspect of the present invention, a method for constructing a cell with a DNAJB6 gene knockout is provided, by introducing the sgRNA of the first aspect of the present invention, or the nucleic acid molecule, expression cassette, or vector in the biological material of the second aspect of the present invention into the cell.

[0079] In some embodiments, the DNAJB6 gene is a porcine DNAJB6 gene (preferably with the accession number XM_047776810.1).

[0080] In some embodiments, the cell comprises a somatic cell (e.g., porcine testicular cell) and / or a germ cell of a pig; more specifically, it is a porcine ST cell.

[0081] In some embodiments, the method comprises the following steps: introducing a vector in the biomaterial of the second aspect of the present invention into a cell.

[0082] In some embodiments, the mode of introduction is transfection.

[0083] The fifth aspect of the present invention provides a cell constructed by the method of the fourth aspect of the present invention.

[0084] In some embodiments, the cell may have the nucleotide sequences shown in SEQ ID NO: 28 and / or SEQ ID NO: 29 (i.e., the 244th C base of the DNAJB6 gene (porcine DNAJB6 gene, preferably with the accession number XM_047776810.1) of the cell, tissue or animal is deleted, and / or a T base is inserted after the 1022nd position (i.e., a T base is inserted between the 1022nd and 1023rd positions).

[0085] In some embodiments, the cell does not relate to propagating materials.

[0086] The sixth aspect of the present invention provides a product comprising: the sgRNA of the first aspect of the present invention, or the biomaterial of the second aspect of the present invention.

[0087] In some embodiments, the product is used for any one of a1)-a3) in the third aspect of the present invention.

[0088] In some embodiments, the product is a reagent or a kit.

[0089] The seventh aspect of the present invention provides a drug comprising: the sgRNA of the first aspect of the present invention, or the biomaterial of the second aspect of the present invention.

[0090] In some embodiments, the drug further comprises a pharmaceutically acceptable excipient.

[0091] In some embodiments, the drug is used for preventing and / or treating viral infections or diseases caused by viruses.

[0092] In some embodiments, the virus includes at least one of classical swine fever virus (CSFV), African swine fever virus (ASFV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), transmissible gastroenteritis virus of swine (TGEV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV), swine acute diarrhea syndrome coronavirus (SADS-COV), porcine respiratory coronavirus (PRCV), porcine hemagglutinating encephalomyelitis virus (PHEV), porcine parvovirus (PPV), porcine circovirus (PCV), Japanese encephalitis virus (JEV); further, it is transmissible gastroenteritis virus of swine (TGEV).

[0093] The beneficial effects of the present invention are as follows:

[0094] The present invention provides sgRNAs targeting the DNAJB6 gene, which can achieve efficient targeting and can be used for knocking out the DNAJB6 gene, constructing cells, tissues or animals with the DNAJB6 gene knocked out, animal breeding, and preventing and / or treating virus infections or diseases caused by viruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0095] Figure 1 Shows the relative targeting positions of DNAJB6 sgRNA1 to sgRNA8.

[0096] Figure 2 Shows the gene editing efficiency of DNAJB6 sgRNA1 to sgRNA8.

[0097] Figure 3 Shows the expression levels of the DNAJB6 gene in DNAJB6-edited cells and unedited cells.

[0098] Figure 4 Shows the mRNA sequence alignment results between DNAJB6-edited cells and porcine HSP40 / DNAJB1.

[0099] Figure 5 Shows the results of infecting DNAJB6-edited cells and unedited cells with TGEV. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0100] To make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the embodiments. The specific embodiments described herein are only used to explain the present invention and do not constitute any limitation to the present invention. In addition, in the following description, the descriptions of well-known structures and technologies are omitted to avoid unnecessarily confusing the concepts of the present disclosure. Such structures and technologies have also been described in many publications.

[0101] Definition

[0102] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular form will also include the plural form and vice versa.

[0103] Unless the context clearly indicates otherwise, the expressions "a" and "an" as used herein include plural referents. For example, reference to "a cell" includes multiple such cells and equivalents known to those skilled in the art, and so on.

[0104] The term "about" as used herein indicates a range of ±20% of the value that follows. In some embodiments, the term "about" indicates a range of ±10% of the value that follows. In some embodiments, the term "about" indicates a range of ±5% of the value that follows.

[0105] Porcine testicular cells (ST cells) are fibroblast-like cells isolated from the testes of male pigs in 1960. ST cells are diploid cells, generally used for virus propagation and isolation, and are ideal hosts for porcine parvovirus, and can be used for the isolation and propagation of such viruses, and can also be used for the propagation of enteroviruses and pseudorabies viruses.

[0106] The PX459 vector is a gene editing tool based on the CRISPR / Cas9 system, which cuts DNA at specific positions in the genome through the Cas9 protein, thereby triggering the cell's repair mechanism, resulting in the knockout or insertion of one or more nucleotide residues in the gene. As a vector for the Cas9 protein, the PX459 vector can introduce the Cas9 protein into cells and express it intracellularly, thereby achieving gene editing. The PX459 vector has resistance to ampicillin and the like, which can facilitate screening and identification.

[0107] The DNAJB6 (DnaJ Heat Shock Protein Family, member B6 of Hsp40) gene encodes a member of the DNAJ protein family. Members of the DNAJ family are characterized by a highly conserved amino acid extension called the "J domain" and participate in a wide range of cellular events, such as protein folding and oligomeric protein complex assembly, as one of two major classes of molecular chaperones. Diseases associated with DNAJB6 also include muscular dystrophy, limb-girdle, autosomal dominant 1, and hereditary late-onset Parkinson's disease. Its related pathways include the cell's response to stimuli and the cell's response to heat stress. An important paralog of this gene is DNAJB7.

[0108] Unless otherwise specified, in the following examples, quantitative tests are all set up with three repeated experiments, and the results are averaged.

[0109] Embodiments and accompanying drawings are provided below to assist in understanding the present invention. However, it should be understood that these embodiments and accompanying drawings are only for illustrating the present invention and do not constitute any limitation. The actual protection scope of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present invention.

[0110] Embodiment

[0111] Embodiment 1: Screening of sgRNA for DNAJB6 gene editing

[0112] In this embodiment, multiple sgRNAs were designed for exons 2 and 7 of the DNAJB6 gene, and their cleavage efficiencies were screened. The specific steps are as follows:

[0113] The pig gene sequence (NC_010460.4) was downloaded from the NCBI database, and the DNAJB6 gene sequence was analyzed. sgRNA1, sgRNA3 - sgRNA8 were designed for exon 2, and sgRNA2 was designed for exon 7. The sequences designed to form sgRNA are shown in Table 1 below, and the relative targeting positions are shown Figure 1 . BbsI restriction enzyme cleavage sites (lowercase letters) were added to the 5' ends of the sense and antisense strands of the sequences, as shown in Table 1 specifically.

[0114] Table 1

[0115] Sequence number Name Sequence (5'-3') SEQ ID NO:1 sgRNA1 F caccgCTTTTTAATATCCTCGGCTG SEQ ID NO:2 sgRNA1 R aaacCAGCCGAGGATATTAAAAAGc SEQ ID NO:3 sgRNA2 F caccgCGCGTCCCACTACACGTGTG SEQ ID NO:4 sgRNA2 R aaacCACACGTGTAGTGGGACGCGc SEQ ID NO:5 sgRNA3 F caccgCGTGTAGTGGGACGCGTGCT SEQ ID NO:6 sgRNA3 R aaacAGCACGCGTCCCACTACACGc SEQ ID NO:7 sgRNA4 F caccgAGTGGGACGCGTGCTTGGGC SEQ ID NO:8 sgRNA4 R aaacGCCCAAGCACGCGTCCCACTc SEQ ID NO:9 sgRNA5 F caccgCACGGAGGGGGGCTCCCAGG SEQ ID NO:10 sgRNA5 R aaacCCTGGGAGCCCCCCTCCGTGc SEQ ID NO:11 sgRNA6 F caccgCTGGTGGCGCGGGGCCTGCT SEQ ID NO:12 sgRNA6 R aaacAGCAGGCCCCGCGCCACCAGc SEQ ID NO:13 sgRNA7 F caccgGGGGGGCTCCCAGGTGCTGG SEQ ID NO:14 sgRNA7 R aaacCCAGCACCTGGGAGCCCCCCc SEQ ID NO:15 sgRNA8 F caccgGGAGGGGGGCTCCCAGGTGC SEQ ID NO:16 sgRNA8 R aaacGCACCTGGGAGCCCCCCTCCc

[0116] (2) The vector PX459 (Addgene plasmid #48139) was digested with the restriction enzyme BbsI to obtain a linearized vector, and the gel was run to recover it.

[0117] (3) The sense and antisense strands of the sgRNA with the BbsI restriction enzyme cleavage site added in Table 1 were reacted at 95°C for 5 min and then annealed at room temperature to form a hybridization product.

[0118] (4) The synthesized double-stranded sgRNA with the BbsI restriction enzyme cleavage site added was ligated overnight with the PX459 linearized vector at 16°C under the action of T4 ligase.

[0119] (5) The ligation product was transformed into E. coli DH5α competent cells, spread on an ampicillin-resistant plate, and single colonies were picked and cultured in a 4 mL LB medium culture flask containing ampicillin resistance.

[0120] (6) Sequencing and identification of the bacterial solution were carried out to confirm the successful construction of the sgRNA targeting vectors, which were named PX459-sgRNA1, PX459-sgRNA2, PX459-sgRNA3, PX459-sgRNA4, PX459-sgRNA5, PX459-sgRNA6, PX459-sgRNA7, and PX459-sgRNA8 respectively. The plasmids were extracted for standby.

[0121] (7) ST cells were seeded in 6-well plates at a density of 6×10 4 cells per well. Lipofectamine TM 3000 transfection reagent (ThermoFisher) was mixed with 5 μg of the targeting vector, and the targeting vectors PX459-sgRNA1 to PX459-sgRNA8 were transfected into porcine ST cells respectively. After transfection, the cells were cultured for 48 h, and the transfected ST cells were digested and collected using 0.25% trypsin. Genomic DNA was extracted using TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 as a template. The genomic DNA of ST cells not transfected with the targeting vector was used as a control group. PCR was performed using the primers shown in Table 2. The PCR reaction conditions were: pre-denaturation at 94 °C for 4 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, for a total of 35 cycles; extension at 72 °C for 5 min. After identification by 1.0% agarose gel electrophoresis, the PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing.

[0122] Table 2

[0123] Sequence number Name Sequence (5’-3’) SEQ ID NO:17 PCR-DNAJB6-F1 AGACCTCCAACAACATTCCAG SEQ ID NO:18 PCR-DNAJB6-R1 TAATCCTGGCTGGGTAAAATGA

[0124] The ab1 files in the sequencing results were input into the TIDE website (http: / / tide.nki.nl / ) for gene editing efficiency evaluation, and the results are as Figure 2 shown. It can be seen from Figure 2 that the editing efficiency of DNAJB6 sgRNA1 is approximately 69.9%, which is significantly higher than the editing efficiencies of sgRNA3 to sgRNA8 (17.1%, 14.6%, 32.1%, 44.7%, 42.4%, 37.5% respectively). The editing efficiency of sgRNA2 is approximately 54.2%. Therefore, sgRNA1 and / or sgRNA2 were used for the construction of DNAJB6 gene-edited cells in the following.

[0125] Example 2. Construction of DNAJB6 gene-edited cell lines

[0126] In this example, the targeting vectors PX459-sgRNA1 and / or PX459-sgRNA2 were used to construct porcine ST cells with DNAJB6 gene editing.

[0127] Porcine ST cells were inoculated into 6-well plates for culture. When the cell density reached 70% to 80% (the amount of cells was 4×10 5 ), Lipofectamine TM 3000 (Thermofisher) was used to transfect the targeting vector (the amount of the vector was 5 μg, among which, 2.5 μg each of the targeting vectors PX459-sgRNA1 and PX459-sgRNA2), and the simultaneously cultured ST cells without transfection treatment were used as the negative control group. After 24 h of transfection, the cells were changed to Gibco TM DMEM, high-glucose medium (Thermofisher) containing 2.0 μg / mL puromycin for screening. Subsequently, the screening medium was continuously changed. When the cells in the negative control group died under the screening pressure, the edited cells were picked into 96-well plates at 1 cell / well using the limiting dilution method, and after 7 d, monoclonal cells were picked into 48-well plates for expansion culture.

[0128] The cell genome was extracted using NP-40 lysis buffer, and PCR amplification was performed using DNAJB6 identification primers (Table 3). A 50 μL PCR reaction system was used, including 5 μL of genomic DNA (100 ng / μl), 2 μL each of the upstream and downstream primers, 25 μL of 2×Prime STAR Max Premix, and 16 μL of ddH2O.

[0129] The PCR reaction conditions included: pre-denaturation at 94 °C for 4 min; denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, for a total of 35 cycles. Extension at 72 °C for 5 min. After the PCR products were identified by 1.0% agarose gel electrophoresis, they were sent to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing.

[0130] After constructing the DNAJB6 gene-edited porcine ST cell line (transfecting PX459-sgRNA1 and PX459-sgRNA2 simultaneously), to further verify the gene editing effect, the monoclonal cell lines obtained by single transfection of the targeting vectors PX459-sgRNA1 and PX459-sgRNA2 were detected by qPCR (the treatment method was the same as above, that is: porcine ST cells were inoculated into 6-well plates for culture. When the cell density reached 70% to 80% (the amount of cells was 4×10 5 ), Lipofectamine TM3000 (Thermofisher) transfection targeting vector (the amount of targeting vector PX459-sgRNA1 or PX459-sgRNA2 was 5 μg, and the untransfected ST cells cultured simultaneously were used as the negative control group. After 24 h of transfection, the cells were changed to Gibco TM DMEM, high-glucose medium (Thermofisher) containing 2.0 μg / mL puromycin for screening. Subsequently, the screening medium was continuously changed. When the cells in the negative control group died under the screening pressure, the edited cells were picked into 96-well plates at a density of 1 cell / well using the limiting dilution method. After 7 d, monoclonal cells were picked into 48-well plates for expansion culture) the expression level of the DNAJB6 gene. First, total RNA was extracted from the transfected cells using TRIzol reagent (Thermofisher) to ensure that the quality of the RNA was suitable for subsequent experiments. Then the extracted RNA was reverse transcribed into cDNA using a reverse transcription kit (Thermofisher) according to the standard procedure. In the qPCR reaction, specific primers for the DNAJB6 gene and the internal reference gene GAPDH were selected for normalization (Table 4), and SYBR Green PCR Master Mix (Thermofisher) was used for amplification. In each qPCR reaction system, it contained cDNA template (1 μg), upstream and downstream primers (2 μL each), SYBR Green PCR Master Mix (10 μL), and ddH2O (made up to 20 μL). The qPCR program was set as initial denaturation at 95 °C for 10 min, followed by 40 cycles, and the cycle conditions were 95 °C for 15 s (denaturation), 60 °C for 30 s (annealing and extension). Finally, the specificity of the amplification products was confirmed by melting curve analysis. By calculating the ΔΔCt value, the relative expression levels of the DNAJB6 gene in the edited group and the control group were obtained.

[0131] Table 3

[0132] Sequence number Name Sequence (5’-3’) SEQ ID NO:19 DNAJB6-Exon 2-F CTTGGCAGCCTTGTCTCTGACCACG SEQ ID NO:20 DNAJB6-Exon 2-R GAATGGAGGGAGTCACGCAACGGG SEQ ID NO:21 DNAJB6-Exon 7-F GCTTTCAGGTGTGGCCGACGAGGAC SEQ ID NO:22 DNAJB6 - exon 7 - R GCTGGGCGGTGGTCTCCCTGTG

[0133] Table 4

[0134] Sequence number Name Sequence (5’-3’) SEQ ID NO:23 qPCR - DNAJB6 - F1 AGCGTCCTCGGACTGGTT SEQ ID NO:24 qPCR - DNAJB6 - R1 ACCTCATACGCCTCAGCAAC SEQ ID NO:25 qPCR - GAPDH - F1 TCGGAGTGAACGGATTTGGC SEQ ID NO:26 qPCR - GAPDH - R1 TGACAAGCTTCCCGTTCTCC

[0135] The sequencing results (simultaneously transfected with PX459-sgRNA1 and PX459-sgRNA2) were respectively aligned with the mRNA (XM_047776810.1, SEQ ID NO: 27) sequence of DNAJB6 of Sus scrofa, and the results were as Figure 4 shown.

[0136]

[0137] From Figure 4 It can be seen that for the positive sgRNA1 editing, the sequencing results (only showing the fragments that change relative to SEQ ID NO: 27) are shown in SEQ ID NO: 28 (corresponding to nucleotides 230 - 261 of SEQ ID NO: 27, Table 5). There is a deletion of C base at the 244th position corresponding to SEQ ID NO: 27, resulting in the amino acid sequence at the 28th position mutating to a stop codon, and the translation of DNAJB6 protein is prematurely terminated, and the DNAJB6 protein cannot be completely expressed. For the positive sgRNA2 editing, the sequencing results (only showing the fragments that change relative to SEQ ID NO: 27) are shown in SEQ ID NO: 29 (corresponding to nucleotides 1001 - 1031 of SEQ ID NO: 27, Table 5). After the 1022nd position corresponding to SEQ ID NO: 27, a T base is inserted, resulting in the amino acid sequence at the 394th position mutating to a stop codon, and the translation is prematurely terminated, and the DNAJB6 protein cannot be completely expressed.

[0138] Table 5

[0139]

[0140] The results of the monoclonal cell lines obtained by single transfection of the targeting vectors PX459 - sgRNA1 or PX459 - sgRNA2 are as Figure 3 shown: The DNAJB6 gene editing was successful, and the expression level in the experimental group should be significantly lower than that of the WT wild - type cells.

[0141] Example 3. Experiment for effect verification

[0142] Place the healthy ST cells in a 6 - well plate for culture, about 6×10 4 cells per well. When the cell confluence is about 80%, take the infectious dose of transmissible gastroenteritis virus (TGEV) as 1 MOI and inoculate it into wild - type ST cells and the DNAJB6 - knockout cell line obtained in Example 2 (transfected with PX459 - sgRNA1 and PX459 - sgRNA2 simultaneously). Place the 6 - well culture plate in a 37°C, 5% CO2 cell culture incubator for 1 h, then discard the liquid. After culturing for 48 h, collect the cells, and perform band analysis by Western blot immunoblotting. Use the lysis solution to fully lyse the two groups of cell pellet samples, and perform SDS - PAGE electrophoresis on the protein samples (the N protein of TGEV). Transfer the protein to the PVDF membrane by semi - dry transfer method, incubate with ECL high - efficiency luminescent solution in the dark, and expose and photograph it in the imager for preservation. The results are as Figure 5 shown: After DNAJB6 knockout, the virus amount of TGEV decreased significantly compared with that before knockout.

[0143] The technical solution of the present invention is not limited to the limitations of the above specific embodiments. Any technical deformation made according to the technical solution of the present invention falls within the protection scope of the present invention.

Claims

1. sgRNA targeting DNAJB6 gene, comprising: sgRNA-1 and / or sgRNA-2; The target sequence of the sgRNA-1 has a nucleotide sequence as shown in CTTTTTAATATCCTCGGCTG (SEQ ID NO: 30); The target sequence of the sgRNA-2 has a nucleotide sequence as shown in CGCGTCCCACTACACGTGTG (SEQ ID NO: 31).

2. The sgRNA according to claim 1, characterized in that The positive strand of the sgRNA-1 has a nucleotide sequence as shown in CTTTTTAATATCCTCGGCTG (SEQ ID NO: 30); and / or The positive strand of the sgRNA-2 has a nucleotide sequence as shown in CGCGTCCCACTACACGTGTG (SEQ ID NO: 31); Preferably, the antisense strand of the sgRNA-1 has a nucleotide sequence as shown in CAGCCGAGGATATTAAAAAG (SEQ ID NO: 32); and / or The antisense strand of the sgRNA-2 has a nucleotide sequence as shown in CACACGTGTAGTGGGACGCG (SEQ ID NO: 33).

3. A biological material related to the sgRNA according to any one of claims 1 to 2, wherein the biological material comprises any one of n1) to n9): n1) a nucleic acid molecule encoding the sgRNA according to any one of claims 1 to 2; n2) an expression cassette comprising the nucleic acid molecule described in n1); n3) a vector comprising the nucleic acid molecule described in n1); n4) a vector comprising the expression cassette described in n2); n5) a cell comprising the nucleic acid molecule described in n1); n6) a cell comprising the expression cassette described in n2); n7) a cell comprising the vector described in n3); n8) a cell comprising the vector described in n4); n9) A cell comprising the sgRNA according to claim 1 or 2; The cell of any one of n5) to n9) does not contain propagation material.

4. The biomaterial according to claim 3, characterized in that Any of the vectors described in n3)-n4) includes prokaryotic expression vectors and eukaryotic expression vectors; Preferably, the backbone vector of any of the vectors described in n3)-n4) is a PX459 vector.

5. Use of the sgRNA according to any one of claims 1 to 2, or the biological material according to any one of claims 3 to 4 in any one of a1) to a5); a1) Knockout of DNAJB6 gene; a2) constructing cells, tissues or animals with DNAJB6 gene knockout; a3) Animal breeding; a4) preparing a product, wherein the product is used in any one of a1) to a3); a5) Preparation of drugs for preventing and / or treating viral infections or diseases caused by viruses.

6. The use according to claim 5, characterized in that: a4) The product is a reagent or a kit; Preferably, a2) the cell, tissue or animal has a nucleotide sequence as shown in SEQ ID NO: 28 and / or SEQ ID NO: 29; Preferably, a2) the cells comprise porcine somatic cells and / or germ cells; further porcine ST cells; Preferably, the animals described in a2) and a3) are pigs; Preferably, a3) the animal is resistant to viral infection; Preferably, the virus comprises at least one of classical swine fever virus, African swine fever virus, porcine reproductive and respiratory virus, pseudorabies virus, porcine transmissible gastroenteritis virus, porcine epidemic diarrhea virus, porcine deltacoronavirus, porcine acute diarrhea syndrome coronavirus, porcine respiratory coronavirus, porcine hemagglutinating encephalomyelitis virus, porcine parvovirus, porcine circovirus, and Japanese encephalitis virus.

7. A method for constructing a cell with a DNAJB6 gene knockout, comprising introducing the sgRNA according to any one of claims 1 to 2, or the nucleic acid molecule, expression cassette, or vector according to any one of claims 3 to 4 into the cell.

8. The method according to claim 7, characterized in that The method comprises the following steps: introducing the vector described in any one of claims 3 to 4 into a cell; Preferably, the cells comprise porcine somatic cells and / or germ cells; further porcine ST cells; Preferably, the introduction method is transfection.

9. A cell constructed by the method according to any one of claims 7 to 8 of the present invention.

10. A product comprising: the sgRNA according to any one of claims 1-2, or the biological material according to any one of claims 3-4; Preferably, the product is used for any one of a1) to a3) described in claim 5; Preferably, the product is a reagent or a kit.

11. A drug comprising: the sgRNA according to any one of claims 1-2, or the biomaterial according to any one of claims 3-4.

Images