Recombinant humanized collagen as well as preparation method and application thereof
The expression of human type VII collagen in E. coli through DNA recombination technology, solving the problems of water insoluble and allotropic rejection in the existing collagen extraction methods, and obtaining high-purity and high-active recombinant humanized collagen, which has significant antioxidant effect and skin repair function.
Patent Information
- Application Number
- CN202510447548.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-10
- Publication Date
- 2025-06-24
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The collagen obtained by the existing collagen extraction methods is water-insoluble and will produce allotropic rejection reactions when applied to the human body, which limits its application in the beauty and medical fields.
Through DNA recombination technology, human type VII collagen is expressed in E. coli, and an E. coli expression system of recombinant humanized collagen is constructed to obtain high purity and high activity recombinant humanized collagen.
The production of high-quality collagen without virus risks and low immune rejection has achieved, with obvious antioxidant effects, can effectively improve the skin structure and delay aging.
Smart Images

Figure CN120192402A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a recombinant humanized collagen, a preparation method thereof, and an application thereof. Background Art
[0002] Collagen is an important structural protein and one of the most abundant proteins in many organisms. It mainly exists in tissues such as bones, muscles, skin, and blood vessels. Collagen has main functions such as promoting cell proliferation, providing structural support for the body, and maintaining tissue stability. Due to its good biocompatibility, biodegradability, and biological activity, collagen has been widely applied in fields such as food, medicine, tissue engineering, and cosmetics.
[0003] Type VII collagen is mainly synthesized by keratinocytes and fibroblasts and is crucial for the function and stability of the ECM. Currently, the main method for preparing collagen is the traditional extraction method, which uses acid and alkali methods to treat animal-derived tissues to extract collagen therefrom. However, the obtained collagen is water-insoluble collagen, and applying it to the human body will cause allogeneic rejection reactions, which limits its application in the beauty and medical fields. Therefore, it has become an urgent need to develop a new recombinant humanized collagen and a preparation method thereof. With the development of biotechnology, the use of DNA recombinant technology to produce collagen directionally in microorganisms has been applied. The collagen produced by DNA recombinant technology has properties similar to natural collagen, has higher purity and activity, has no virus risks, and has a low immune rejection reaction, and can meet the requirements of the medical and beauty fields for high-quality collagen.
[0004] In summary, the recombinant humanized collagen, its preparation method, and its application have broad prospects and important significance. The present invention provides a recombinant humanized collagen and constructs an Escherichia coli expression system for the recombinant humanized collagen, which has a high expression level and can be widely applied in fields such as skin care products, medical beauty, and health foods. Summary of the Invention
[0005] Aiming at the above technical problems, the first object of the present invention is to provide a recombinant humanized collagen, which includes a human-derived type VII collagen fragment, strictly adheres to the Gly-X-Y repeat sequence, has no risk of mutation, has important functional sites of type VII collagen, and has high biological activity.
[0006] In order to achieve the above object, the technical solution adopted by the present invention is:
[0007] A recombinant humanized collagen, wherein the amino acid sequence of the recombinant humanized collagen is as shown in SEQ ID NO.1.
[0008] Further, the nucleotide sequence encoding the recombinant humanized collagen is as shown in SEQ ID NO.2.
[0009] The second object of the present invention is to provide a method for preparing recombinant humanized collagen.
[0010] In order to achieve the above object, the technical solution adopted by the present invention is:
[0011] The method for preparing the recombinant humanized collagen described above is characterized by comprising the following steps:
[0012] (1) Connect the vector with the nucleotide sequence encoding the recombinant humanized collagen to obtain a recombinant plasmid;
[0013] (2) Transfer the recombinant plasmid obtained in step (1) into competent cells, screen positive monoclonal colonies, inoculate them into a medium, add IPTG to induce the expression of the protein, and obtain a bacterial cell precipitate;
[0014] (3) Separate and purify the bacterial cell precipitate obtained in step (2) to obtain recombinant humanized collagen.
[0015] Further, the vector in step (1) is pET21a.
[0016] Further, the specific operation of step (2) is: transfer the recombinant plasmid obtained in step (1) into competent cells E.coli BL21(DE3), coat them on an LB plate containing ampicillin, screen positive monoclonal colonies, inoculate them into an LB medium containing ampicillin and shake overnight, add IPTG to induce the expression of recombinant humanized collagen, and obtain a bacterial cell precipitate.
[0017] Further, the concentration of ampicillin in both the LB plate containing ampicillin and the LB medium containing ampicillin is 50 - 100 μg / mL, the induction expression concentration of IPTG is 0.3 - 0.7 mM, and the induction expression time of IPTG is 8 - 12 h.
[0018] Further, in step (3), the separation and purification adopt one or more of chromatographic chromatography, ion exchange chromatography, and affinity chromatography.
[0019] The third object of the present invention is to provide an application of recombinant humanized collagen in the preparation of skin care products.
[0020] In order to achieve the above object, the technical solution adopted by the present invention is:
[0021] The application of the recombinant humanized collagen described above in the preparation of skin care products.
[0022] Compared with the prior art, the beneficial effects of the present invention mainly lie in:
[0023] By selecting the effective sequence of human type VII collagen and using genetic recombination technology to construct and express a recombinant humanized collagen, the recombinant humanized collagen has no cytotoxicity, good safety, and obvious antioxidant effect. When applied to skin care products, it can effectively improve the structure of the epidermis and dermis of the skin, exert the antioxidant effect, thereby achieving the effect of repairing the skin and delaying aging, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 It is the expression diagram of the purified recombinant humanized collagen prepared by the present invention;
[0025] Figure 2 It is the result of the hydroxyl radical scavenging rate of recombinant humanized collagen HF3;
[0026] Figure 3 It is the result diagram of the DPPH-radical scavenging rate of recombinant humanized collagen HF3;
[0027] Figure 4 It is the result diagram of the relative expression level of FLG gene in HaCat cells under different culture conditions;
[0028] Figure 5 It is the result diagram of the effect of different concentrations of recombinant humanized collagen on cell viability. DETAILED DESCRIPTION OF THE INVENTION
[0029] The following further describes the technical solutions of the present invention in conjunction with specific embodiments. However, those skilled in the art should understand that the following embodiments are only used to illustrate the present invention and should not be regarded as a limitation of the present invention. The specific conditions not specified in the embodiments are carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, unless otherwise specified, are all conventional products obtained through commercial channels.
[0030] Example 1
[0031] A recombinant humanized collagen HF3, the amino acid sequence of the recombinant humanized collagen HF3 is shown in SEQ ID NO.1, and the nucleotide sequence encoding the recombinant humanized collagen HF3 is shown in SEQ ID NO.2.
[0032] The preparation method of the above-mentioned recombinant humanized collagen HF3 specifically includes the following steps:
[0033] (1) Hydrophobicity and protein stability analysis were respectively carried out on the functional regions of the amino acid sequence of human type VII α1-chain collagen. Two short peptide fragments, namely the 1560 - 1699 amino acid short peptide fragment and the 2533 - 2616 amino acid short peptide fragment, were selected. This sequence is a specific Gly-X-Y repeat sequence on collagen, which has an integrin-binding domain and a cell proliferation-promoting domain. These two short peptide fragments were connected end to end to form a 222aa short peptide as a repeating unit, and repeated 2 times to obtain the recombinant humanized collagen amino acid sequence, as shown in SEQ ID NO.1.
[0034] (2) According to the amino acid sequence SEQ ID NO.1 of the recombinant humanized collagen, the gene sequence was designed in reverse, and codon optimization was carried out to obtain the nucleotide sequence encoding the recombinant humanized collagen, as shown in SEQ ID NO.2. Upstream and downstream primers for amplifying humanized collagen were designed according to the optimized nucleotide sequence. The nucleotide sequence of the upstream primer is CATATGGGCCCAGCAGGTCCACGCGGTGCGA, containing the Nde I restriction enzyme site CATATG, and the nucleotide sequence of the downstream primer is GCGGCCGCAACGTCGCCTTTCTCGCCACGGATA, containing the Not I restriction enzyme site GCGGCCGC. The gene was amplified by PCR method, and the target fragment was purified with a gel recovery kit.
[0035] Table 1 Sequence Listing
[0036]
[0037]
[0038] (3) The plasmid pET21a was double-digested with the restriction endonucleases Nde I and Not I. The double-digestion reaction system is shown in Table 2. The double-digested and recovered expression vector pET21a and the amplified and recovered recombinant collagen HF3 gene fragment were mixed at a molar ratio of 6:1, and T4 DNA ligase was added thereto. The details are shown in Table 3. The correct recombinant plasmid pET21a-HF3 was obtained through sequencing and identification.
[0039] Table 2 Double-digestion Reaction System
[0040] sample volume plasmid pET21a 4 μg NdeI 1 μL NotI 1 μL Cutsmart buffer 5 μL sterile deionized water make up to 50 μL
[0041] Table 3 T4 DNA Ligase Reaction System
[0042]
[0043]
[0044] (4) Transform the correctly recombined plasmid pET21a-HF3 identified in step (3) into the engineered bacterium E. coli BL21(DE3), coat it on an LB plate containing 100 μg / mL ampicillin, incubate it upside down in a 37 °C incubator overnight, select single colonies for PCR verification, and thus obtain the correct recombinant strain, named pET21a-HF3 / BL21.
[0045] (5) Inoculate the correctly verified positive recombinant strain pET21a-HF3 / BL21 obtained in step (4) into 2 mL of LB liquid medium containing 100 μg / mL ampicillin, incubate it overnight at 37 °C and 220 rpm to obtain the primary seed culture solution; aspirate 0.5 mL of the primary seed culture solution and transfer it to 25 mL of LB liquid medium containing 100 μg / mL ampicillin, incubate it overnight at 37 °C and 220 rpm, lower the temperature to 25 °C, and after the temperature stabilizes, add 0.5 mM IPTG and continue culturing for 10 h to induce the expression of recombinant humanized collagen. Centrifuge the above-induced fermentation broth at 4 °C and 5000 rpm for 10 min to collect the cell precipitate.
[0046] (6) Resuspend the cell precipitate with cell disruption buffer (composed of Tris-HCl, NaCl, glycerol, and Triton X-100), perform ultrasonic disruption in an ice bath, centrifuge at 12000 rmp for 10 min at 4 °C, and collect the supernatant. According to the characteristics of this protein, configure two buffers: Buffer A is 20 mM / L potassium phosphate buffer (pH 6.0) for equilibrating the chromatography column and washing; Buffer B is 20 mM / L potassium phosphate buffer + 1 mol / L NaCl (pH 6.0) as the eluent. After adjusting the collected supernatant to an appropriate pH, filter it to remove impurities, and then load it onto a hydrophobic cation exchange chromatography column. Before loading, equilibrate the column with Buffer A, wash it with 20% Buffer B after loading, and finally elute it with Buffer B to obtain purified recombinant humanized collagen HF3. Finally, detect recombinant humanized collagen HF3 by SDS-PAGE gel, and the results are as Figure 1 shown.
[0047] Experimental Example 1
[0048] Antioxidant evaluation of recombinant humanized collagen HF3:
[0049] (1) Hydroxyl radical scavenging experiment: Commercially available Vc and type VII humanized recombinant collagen (product number: BES21430RP) purchased were used as the control groups. Recombinant humanized collagen HF3, Vc, and type VII humanized recombinant collagen solutions with sample gradients of 0.3, 0.6, 0.9, 1.2, and 1.5 mg / mL were respectively prepared. In a 10 mL test tube, 1 mL of 9.0 mmol / L FeSO4 solution, 1 mL of 9.0 mmol / L salicylic acid - ethanol solution, and 1 mL of the sample were added in sequence. Finally, 1 mL of 9.0 mmol / L hydrogen peroxide solution was added. Using distilled water as the reference, the tube lid was tightened and shaken up and down to fully mix the reactants. Then it was incubated in a 37 °C water bath for 15 min to allow the reaction to proceed. Three parallels were set for each group to improve the reliability of the data. The absorbance at 510 nm was measured using a microplate reader. The hydroxyl radical scavenging rate was calculated by the following formula: Hydroxyl radical scavenging rate % = [1 - (A X - A j ) / A0] × 100%, where A X represents the absorbance value after adding the sample, Aj represents the absorbance value without adding hydrogen peroxide solution, and A0 represents the blank absorbance value without adding the sample. The test results are as shown in Figure 2 .
[0050] (2) DPPH radical scavenging experiment: Commercially available Vc and type VII humanized recombinant collagen (product number: BES21430RP) purchased were used as the control groups. Recombinant humanized collagen HF3, Vc, and type VII humanized recombinant collagen solutions with sample gradients of 0.3, 0.6, 0.9, and 1.2 mg / mL were respectively prepared. The DPPH radical scavenging rate was detected using a commercially available DPPH radical scavenging ability kit. The DPPH radical scavenging rate was calculated by the following formula: DPPH radical scavenging rate % = [(A0 - Ax) / A0] × 100%, where A0 is the absorbance of the blank control group (containing only DPPH solution and solvent, without adding the sample), and Ax is the absorbance of the sample group (the absorbance after the reaction of DPPH solution and the sample). The test results are as shown in Figure 3 .
[0051] Figure 2 and Figure 3 are respectively the hydroxyl radical scavenging rate and DPPH radical scavenging rate of recombinant humanized collagen HF3. From Figure 2 and Figure 3It can be seen that the hydroxyl radical scavenging rate and DPPH radical scavenging rate of the recombinant humanized collagen HF3 prepared by the present invention are higher than those of the commercially available recombinant humanized collagen, and the commercially available recombinant humanized collagen has almost no antioxidant property. This indicates that the recombinant humanized collagen HF3 provided by the present invention has an obvious antioxidant effect, and its active ingredient can be used as a high-quality antioxidant ingredient in cosmetics, with the effect of delaying aging.
[0052] Experimental Example 2
[0053] Barrier repair experiment of recombinant humanized collagen HF3:
[0054] (1) Add the recombinant humanized collagen HF3 prepared in Example 1 to 2 mL of DMEM + double-antibody PS medium containing 10% fetal bovine serum to obtain a DMEM + double-antibody PS medium containing 10% fetal bovine serum with 1 mg / mL recombinant humanized collagen; the blank control group is 2 mL of DMEM + double-antibody PS medium without adding collagen.
[0055] (2) Collect human HaCat cells and prepare a cell suspension with a cell density of 1×10 5 cells / mL using DMEM + double-antibody PS medium containing 10% fetal bovine serum. Take 2 mL of the cell suspension and inoculate it into a 6-well plate, and place it in a cell culture incubator at 37 °C and 5% CO2 for culture. Set 3 replicate wells for each group. After the cells are incubated for 24 hours, aspirate the culture medium, and add 2 mL of each group of media in step (1) respectively, and continue to culture in a cell culture incubator at 37 °C and 5% CO2 for 24 hours.
[0056] (3) Collect the cells obtained after culture, wash the cells twice with 2 mL of PBS buffer in each well, and carry out RNA extraction, reverse transcription, and fluorescence quantitative PCR detection experiments according to the Total RNA extraction kit, and use the 2 -△△CT method to calculate the relative mRNA expression level of the barrier-related protein FLG. The results are as Figure 4 shown.
[0057] Figure 4 is a result graph of the relative expression level of the FLG gene in HaCat cells under different culture conditions. Compared with the blank control group, the recombinant humanized collagen HF3 (experimental group) prepared in the example of the present invention can significantly increase the relative mRNA expression level of the barrier-related protein FLG, indicating that the recombinant humanized collagen prepared by the present invention has an obvious skin barrier repair function.
[0058] Experimental Example 3
[0059] Evaluation of the promotion of cell proliferation by recombinant humanized collagen HF3:
[0060] (1) The fibroblast L929 was normally cultured to passage P8 in DMEM + double antibody PS medium containing 10% fetal bovine serum, and the cell density reached about 90%.
[0061] (2) The cells were digested with trypsin to make the cells detached and dispersed into single cells, and inoculated into a 96-well plate at a cell density of 5000 / well, and cultured overnight in a 37°C, 5% CO2 cell culture incubator.
[0062] (3) Discard the original culture medium, and add 100 μL of different concentrations of recombinant humanized collagen HF3 (0.1 mg / mL, 0.5 mg / mL, 1 mg / mL, 5 mg / mL) diluted with cell culture medium (DMEM + double antibody PS medium containing 10% fetal bovine serum) to each well; at the same time, set a control group (cell culture medium containing only 10% fetal bovine serum and double antibody PS).
[0063] (4) Place the 96-well plate after changing the medium in a 37°C, 5% CO2 cell culture incubator and continue to culture. After 24 hours, use a CCK8 kit to detect the cell proliferation situation, and the results are as Figure 5 shown.
[0064] Figure 5 This is the result graph of the effect of the recombinant humanized collagen HF3 prepared by the present invention on cell viability. Compared with the control group, the cell viability of the experimental group added with recombinant humanized collagen HF3 has increased, indicating that the recombinant humanized collagen HF3 prepared by the present invention has the effect of promoting cell proliferation, has no cytotoxicity, good safety, and can be used for the preparation and use of cosmetics.
[0065] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them. The basic principles and main features of the present invention have been described with specific implementation schemes above. On the basis of the present invention, some modifications or substitutions can be made, but these modifications or substitutions do not make the essence of the corresponding technical solutions deviate from the scope of the present invention claimed.
Claims
1. A recombinant humanized collagen, characterized in that: The amino acid sequence of the recombinant humanized collagen is shown in SEQ ID NO.
1.
2. The recombinant humanized collagen according to claim 1, characterized in that The nucleotide sequence encoding the recombinant humanized collagen is shown in SEQ ID NO.
2.
3. The method for preparing recombinant humanized collagen according to claim 1 or 2, characterized in that: The following steps are involved: (1) connecting the vector with the nucleotide sequence encoding recombinant humanized collagen to obtain a recombinant plasmid; (2) transferring the recombinant plasmid obtained in step (1) into competent cells, screening positive monoclonal colonies and inoculating them into culture medium, adding IPTG to induce protein expression, and obtaining bacterial precipitates; (3) Isolating and purifying the bacterial precipitate obtained in step (2) to obtain recombinant humanized collagen.
4. The method for preparing recombinant humanized collagen according to claim 3, characterized in that: The vector of step (1) is pET21a.
5. The method for preparing recombinant humanized collagen according to claim 3, characterized in that: The specific operation of step (2) is as follows: the recombinant plasmid obtained in step (1) is transferred into competent cells E. coli BL21 (DE3), spread on an LB plate containing ampicillin, screen positive monoclonal colonies, inoculate them in an LB medium containing ampicillin, shake overnight, and add IPTG to induce the expression of recombinant humanized collagen to obtain bacterial precipitation.
6. The method for preparing recombinant humanized collagen according to claim 5, characterized in that: The concentration of ampicillin in the LB plate containing ampicillin and the LB medium containing ampicillin is 50-100 μg / mL, the induction expression concentration of IPTG is 0.3-0.7 mM, and the induction expression time of IPTG is 8-12 hours.
7. The method for preparing recombinant humanized collagen according to claim 3, characterized in that: The separation and purification in step (3) adopts one or more of chromatography, ion exchange chromatography and affinity chromatography.
8. Use of the recombinant humanized collagen according to claim 1 in the preparation of skin care products.
Citation Information
Cited By
Preparation method of human collagen and application of human collagen in anti-aging
CN120988105A
Recombinant collagen with anti-aging effect as well as preparation method and application thereof
CN121426931A