Application of cassava common mosaic virus TGBp1 in down-regulation of MeGRXC3
Through the interaction between TGBp1 and MeGRXC3 and downregulating MeGRXC3 expression, the reactive oxygen content of plant tissues is improved, and the harm of ordinary cassava mosaic virus to the cassava industry is solved, and the theoretical basis for disease resistance breeding is provided.
Patent Information
- Application Number
- CN202510681397.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-26
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2045-05-26
AI Technical Summary
The existing technology is difficult to effectively solve the devastating harm of ordinary cassava mosaic virus to the cassava industry, and there is little research on CsCMV and is still in the detection and identification stage.
Through research, TGBp1 interacts with cassava glutenophenin 3 (MeGRXC3), and downregulates its expression, increasing the reactive oxygen content of plant tissue co-expressed with MeGRXC3.
It has achieved the improvement of the growth ability of yeast in specific nutritional defective culture media and laid a theoretical foundation for disease-resistant breeding of cassava common mosaic virus.
Smart Images

Figure CN120193015A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to application of cassava common mosaic virus TGBp1 in down-regulating MeGRXC3. Background Art
[0002] Viruses are obligate parasites that must evade or tolerate various antiviral defense mechanisms of host cells to successfully infect. How viruses evade or tolerate various host immune defense mechanisms, such as post-transcriptional genesilencing (PTGS), to enhance pathogenicity has been a research hotspot in recent years, with significant progress made. PTGS is a conserved gene expression regulatory mechanism in eukaryotes that plays an important role in developmental regulation, metabolism, maintaining genome stability, and responding to biotic and abiotic stresses. It is also a key antiviral immune mechanism. Plants have evolved multiple antiviral PTGS signaling pathways, involving different proteins and with distinct but overlapping functions. Viruses are obligate parasites that must evade or tolerate degradation by host cells to successfully infect. Most plant viruses have co-evolved with plants to produce one or more viral suppressors of RNA silencing (VSRs) to counteract the host's PTGS antiviral immunity. VSRs from different viruses have no sequence homology and no structural similarity, so their modes and mechanisms of action are also different.
[0003] Cassava (Manihot esculenta) is a perennial crop in the Euphorbiaceae family, primarily cultivated in tropical and subtropical countries and regions. It is the sixth largest food crop in the world and plays a vital role in the agricultural economy. Cassava mosaic virus (CMV) is devastating to the cassava industry, resulting in an annual global production loss of 25 million tons, impacting the food security of over 500 million people. Cassava common mosaic virus (CsCMV) is a member of the genus Potexvirus in the family Alphaflexiviridae. CsCMV was first reported in southern Brazil. It exhibits typical molecular characteristics of Potexviruses: a monopartite, positive-sense, curvilinear (ssRNA) virus with a virion size of approximately 15 nm × 495 nm. The genome is approximately 6.4 kb in size, with a cap at the 5′ and poly(A) tail at the 3′ ends, respectively. It produces three subgenomic RNAs (sgRNAs) containing five open reading frames (ORFs): ORF1 at the 5′ end encodes the 165 kD RNA-dependent RNA polymerase (RdRp), essential for viral replication; ORF2, ORF3, and ORF4 at the center encode three overlapping triple gene block proteins (TGBs): 25 kD TGBp1, 12 kD TGBp2, and 10 kD TGBp3; and ORF5 at the 3′ end encodes the 24 kD coat protein (CP). ORF1 is directly translated from the viral genomic RNA, while the other ORFs are translated by sgRNAs. Research has shown that RdRp is the only viral protein absolutely required for viral replication, while TGBp1-3 and CP are essential for intercellular and long-distance viral movement. Currently, there are few reports on CsCMV both domestically and internationally, and research is still in the detection and identification phase. The host range, transmission vectors, and gene functions of CsCMV remain unclear, necessitating in-depth research. This study discovered that TGB1 interacts with and downregulates cassava glutaredoxin 3 (MeGRXC3), increasing reactive oxygen species levels in plant tissues co-expressing MeGRXC3. Summary of the Invention
[0004] The object of the present invention is to overcome the deficiencies in the prior art and provide an application of cassava common mosaic virus TGBp1 in downregulating MeGRXC3 and increasing the content of active oxygen in plant tissues co-expressing MeGRXC3.
[0005] The first aspect of the present invention is to provide the use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacteria containing the coding region of the TGBp1 gene in down-regulating the expression level of MeGRXC3.
[0006] Wherein, the nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO: 1; Among them, the nucleotide sequence of the gene corresponding to MeGRXC3 is shown in SEQ ID NO: 2.
[0007] The second aspect of the present invention is to provide the use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacteria containing the coding region of the TGBp1 gene in interacting with MeGRXC3.
[0008] Among them, TGBp1 interacts with MeGRXC3 to downregulate the expression level of MeGRXC3.
[0009] Among them, TGBp1 interacts with MeGRXC3 to increase the content of reactive oxygen species in plant tissues.
[0010] Among them, TGBp1 interacts with MeGRXC3 to improve the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade nutrient-deficient medium.
[0011] The third aspect of the present invention is to provide the use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacteria containing the coding region of the TGBp1 gene in increasing the active oxygen content in plant tissues.
[0012] The fourth aspect of the present invention is to provide the use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacteria containing the TGBp1 gene coding region in improving the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade nutrient-deficient culture medium.
[0013] This study found that TGBp1 interacts with MeGRXC3, enhancing yeast growth in SD / -Leu / -Trp / -His / -Ade-deficient medium. Downregulating MeGRXC3 expression can also increase reactive oxygen species (ROS) levels in plant tissues co-expressing MeGRXC3, ultimately improving yeast growth in SD / -Leu / -Trp / -His / -Ade-deficient medium. These findings will lay a theoretical foundation for breeding for resistance to cassava common mosaic virus (CMV). BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 This represents the interaction between pGBKT7-TGBp1 and pGADT7-MeGRXC3 in yeast. AD-T + BD-53, AD-T + BD-Lam, BD-TGBp1 + AD-MeGRXC3, BD-TGBp1 + AD, and BD + AD-MeGRXC3 represent yeast co-transformations of AD-T + BD-53, AD-T + BD-Lam, BD-TGBp1 + AD-MeGRXC3, BD-TGBp1 + AD, and BD + AD-MeGRXC3, respectively. SD-LW: SD-LW / -Leu / -Trp medium; SD-LWH: SD-LWHA / -Ade / -His / -Leu medium; SD-LWHA: SD-LWHA / -Ade / -His / -Leu / -Trp medium.
[0015] Figure 2 BiFC analysis confirms the interaction between CsCMV TGBp1 and MeGRXC3 proteins in tobacco. Top: MeGRXC3-YC, YNs-TGBp1, and the nuclear localization marker H2B-RFP co-injected into tobacco. Bottom: MeGRXC3-YC, YNs, and the nuclear localization marker H2B-RFP co-injected into tobacco.
[0016] Figure 3 Fluorescence observation on the 5th day after co-expression of MeGRXC3-GFP and different concentrations of YNs-TGBp1.
[0017] Figure 4Western blot analysis of MeGRXC protein accumulation in Nicotiana benthamiana leaves 5 days after infiltration of MeGRXC-Flag3, an empty vector, and TGBp1-GFP. MeGRXC3-Flag: plant expression vector expressing MeGRXC3-Flag; pG1300: plant expression vector pG1300 expressing only the GFP tag; pG1300-TGBp1: plant expression vector pG1300-TGBp1 expressing the TGBp1-GFP fusion protein; FlagFlag antibody; GFP: GFP antibody; Rubisco: Rubisco Coomassie blue staining.
[0018] Figure 5 Laser scanning imaging (left) and DAB staining (right) were used to examine the effects of TGB1 on reactive oxygen species in leaf tissues co-expressed with MeGRXC3. p1300-Flag + TGB1-GFP: N. benthamiana leaves were co-infiltrated with an empty vector and TGBp1-GFP; p1300-Flag + pG1300: N. benthamiana leaves were co-infiltrated with an empty vector and a pG1300 vector expressing only GFP; MeGRXC3-Flag + TGB1-GFP: N. benthamiana leaves were co-infiltrated with MeGRXC3-Flag and TGBp1-GFP; and MeGRXC3-Flag + pG1300: N. benthamiana leaves were co-infiltrated with MeGRXC3-Flag and a pG1300 vector expressing only GFP. DETAILED DESCRIPTION
[0019] The present invention will be further described below with reference to the accompanying drawings and in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not specified in the examples, the methods are based on those described in the literature in this field or on the product specifications. Where the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional products.
[0020] 1 Plant material Wild-type Nicotiana benthamiana N. benthamiana Saved for this laboratory.
[0021] 2 Experimental methods and results
[0022] 2.1 Expression vector construction (1) Construction of yeast expression vector AD-TGBp1 Using pCsCMV as a template, the target fragment TGBp1EB (specific sequence shown in Table 2) was amplified with primers TGBp1-1F EcoRI and TGBp1-696R BamHI (specific primer sequences are shown in Table 1). The PCR product was double-digested with EcoRI and BamHI and ligated with the large fragment of the yeast expression vector pGADT7 that had been double-digested with EcoRI and BamHI. The ligation product was transformed into Escherichia coli, and the positive clone was confirmed to be correct by sequencing and named AD-TGBp1.
[0023] (2) Construction of yeast expression vector BD-MeGRXC3 Shanghai Sangon Biotechnology Co., Ltd. was commissioned to synthesize the target fragment MeGRXC3-EcoRI & BamHI (see Table 2 for the specific sequence), with restriction endonucleases EcoRI and BamHI added to both ends. The target fragment was double-digested with EcoRI and BamHI and ligated with a large fragment of pGBKT that had also been digested with the same enzymes. The ligation product was transformed into E. coli, and the positive clone was confirmed by sequencing and named BD-MeGRXC3.
[0024] (3) Construction of plant expression vector YNs-TGBp1 Using pCsCMV as a template, primers TGBp1-1F MluI and TGBp1-696R KpnI (specific sequences are shown in Table 1) were used to amplify the target fragment TGBp1MK (specific sequences are shown in Table 2). The PCR product was double-digested with MluI and KpnI and then ligated with the large fragment of the plant expression vector p1300-YNs (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Chinese Journal of Tropical Crops, 2024, 45(01): 197-204.) that had been double-digested with the same enzymes. The ligation product was transformed into Escherichia coli, and the positive clone was named YNs-TGBp1 after sequencing confirmation.
[0025] (4) Construction of plant expression vector TGBp1-GFP Using pCsCMV as a template, the target fragment TGBp1SK (specific sequence shown in Table 2) was amplified with primers TGBp1-1F SpeI and TGBp1-696R KpnI (specific sequence shown in Table 1). The PCR product was double-digested with SpeII and KpnI and ligated with the large fragment of the plant expression vector pG1300 that had also been double-digested with SpeII and KpnI. The ligation product was transformed into Escherichia coli, and the positive clone was confirmed by sequencing and named TGBp1-GFP.
[0026] (5) The construction method of the plant expression vector MeGRXC3-YC is as follows: The target fragment MeGRXC3-SpeI& KpnI (specific sequence see Table 2) was synthesized and double-digested with SpeI& KpnI. The fragment was ligated with the large fragment of p1300-FYC (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) that had been double-digested with SpeI& KpnI. The ligated product was transformed into Escherichia coli, and the positive clone was named MeGRXC3-YC after being confirmed by sequencing.
[0027] (6) The construction method of the plant expression vector MeGRXC3-GFP is as follows: The target fragment MeGRXC3-SpeI & KpnI synthesized above was double-digested with SpeI and KpnI and ligated with the large fragment of pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z.,Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNAsilencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) that had been double-digested with SpeI and KpnI. The ligation product was transformed into Escherichia coli, and the positive clone was named MeGRXC3-GFP after being confirmed by sequencing.
[0028] (7) The empty vector p1300-Flag was constructed as follows: Shanghai Sangon Biotechnology Co., Ltd. was commissioned to artificially synthesize the target fragment Flag-XbaI & SacI (see Table 2 for the specific sequence), which was then double-digested with XbaI and SacI and ligated with the large fragment of pG1300 (Liu, L., Wang, H., Fu,Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnipcrinkle virus-encoded suppressor of RNA silencing interacts with ArabidopsisSGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) that had been double-digested. The ligation product was transformed into Escherichia coli, and the positive clone was named p1300-Flag after sequencing and identification.
[0029] (8) The construction method of the plant expression vector MeGRXC3-Flag is as follows: Shanghai Sangon Biotechnology Co., Ltd. was commissioned to artificially synthesize the target fragment MeGRXC3-XbaI & BamHI (see Table 2 for the specific sequence). The fragment was double-digested with XbaI & BamHI and ligated with the p1300-Flag large fragment constructed above by the same double-digestion method. The ligation product was transformed into Escherichia coli, and the positive clone was confirmed by sequencing and named MeGRXC3-Flag.
[0030] Table 1 Primers used Primer name sequence TGBp1-1F EcoRI <![CDATA[ GAATTC ATGGACTCTTTTATTGATGA]]> TGBp1-696R BamHI <![CDATA[ GGATCC TCAGCTGGAGGGAAGGTG]]> <![CDATA[ ACGCGT ATGGACTCTTTTATTGATGA ]]> TGBp1-696R kpnI <![CDATA[ GGTACC TCAGCTGGAGGGAAGGTG]]> TGBp1-1F SpeI <![CDATA[ ACTAGT ATGGACTCTTTTATTGATGA]]> Table 2 Target fragment sequences
[0031] 2.2 Yeast two-hybrid analysis to identify the interaction between TGBp1 and MeGRXC3 (1) Construction of yeast expression vector BD-TGBp1 Using pCsCMV as a template, the target fragment TGBp1EB (specific sequence shown in Table 2) was amplified with primers TGBp1-1F EcoRI and TGBp1-696R BamHI (specific primer sequences are shown in Table 1). The PCR product was double-digested with EcoRI and BamHI and ligated with the large fragment of the yeast expression vector pGBKT that had been double-digested with EcoRI and BamHI. The ligation product was transformed into Escherichia coli, and the positive clone was confirmed to be correct by sequencing and named BD-TGBp1.
[0032] (2) Construction of yeast expression vector AD-MeGRXC3 Shanghai Sangon Biotechnology Co., Ltd. was commissioned to synthesize the target fragment MeGRXC3-EcoRI & BamHI (see Table 2 for the specific sequence), with restriction endonucleases EcoRI and BamHI added to both ends. The target fragment was double-digested with EcoRI and BamHI and ligated with a large fragment of pGADT7 that had also been digested with the same enzymes. The ligation product was transformed into E. coli, and the positive clone was confirmed by sequencing and named BD-MeGRXC3.
[0033] For ease of description, during the co-transformation process, the "pGADT7" vector is abbreviated as "AD" and the "pGBKT7" vector is abbreviated as "BD". The yeast expression vectors pGADT7, pGBKT7, AD-T (pGADT7-T), BD-lam (pGBKT7-lam), and BD-53 (pGBKT7-53) (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNAsilencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.) are all stored in our laboratory.
[0034] Table 3 Pairing combinations of yeast bait plasmids and prey plasmids combination Bait carrier prey carrier 1 (positive control) AD-T BD-53 2 (negative control) AD-T BD-lam 3 AD-MeGRXC3 BD-TGBp1 4 BD-TGBp1 AD 5 AD-MeGRXC3 BD Yeast vectors: Refer to Table 3. After co-transforming competent yeast with different yeast expression vectors, single colonies identified as positive by PCR were picked and resuspended in 25 μL of sterile water to make a suspension. Sterile water was used to serially dilute the suspension to 10-fold, 100-fold, and 1000-fold. 2 μL of each suspension was inoculated into SD / -Leu / -Trp (SD-LW) and SD / -Leu / -Trp / -His / -Ade (SD-LWHA) nutrient-deficient culture media. Yeast co-transformed with AD-T and BD-Lam and AD-T and BD-53 were used as negative and positive controls, respectively. These suspensions were inoculated onto solid culture media along with yeast transformed with the target plasmids and cultured in an inverted incubator at 28°C for 3 days. Observe and record growth.
[0035] The results of yeast two-hybrid studies are as follows Figure 1As shown, all co-transformed yeast cells grew normally in SD-LW deficiency medium. However, only the positive control yeast and yeast co-transformed with BD-TGBp1 and AD-MeGRXC3 grew normally in SD-LWHA deficiency medium. The negative control yeast and yeast co-transformed with BD-TGBp1 and AD-MeGRXC3 did not grow normally. These results indicate that TGBp1 and MeGRXXC3 interact within yeast cells.
[0036] 2.3 Bimolecular fluorescence identification of the interaction between TGBp1 and MeGRXC3 The BiFC vector p1300-YNs (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Chinese Journal of Tropical Crops, 2024, 45(01): 197-204.) and the nuclear localization red light labeling vector H2B-RFP (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plantpathology, 24(2), 154–166.) are both preserved in our laboratory.
[0037] (1) Transformation of plant expression vector into Agrobacterium GV3101 The plant expression vectors YNs-TGBp1, p1300-YNs, MeGRXC3-YC, H2B-RFP, and the silencing suppressor expression vector pZP-P19 (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnipcrinkle virus suppresses posttranscriptional gene silencing at an earlyinitiation step. Journal of Virology , 77(1), 511–522.) were transformed into Agrobacterium tumefaciens GV3101 competent cells. The transformed Agrobacterium was evenly spread onto LB solid medium containing the corresponding resistance (YNs-TGBp1, YNs, MeGRXC3, and H2B-RFP were spread onto LB plates containing Kan and Rif resistance, and pZP-P19 was spread onto LB plates containing Spec and Rif resistance. The working concentration was 50 μg / mL). Inverted culture was performed at 28°C for 72–90 h. After 2–3 days, 2–3 mm Agrobacterium colonies were grown, and single colonies were selected for PCR identification.
[0038] (2) Agrobacterium infiltration of Nicotiana benthamiana Single colonies identified as positive by colony PCR were picked with a pipette tip and transferred to 5 mL of LB liquid medium containing the appropriate antibiotics. The culture was shaken overnight at 28°C in a constant temperature shaker at 200 rpm. The culture was centrifuged at 7000 rpm for 15 minutes, the supernatant discarded, and the pellet resuspended in 5 mL of injection buffer. After thorough vortexing, the culture was diluted to an OD600 of 0.5. After the diluted culture was allowed to stand at room temperature for 2-3 hours, the resuspensions of different recombinant vectors were mixed in a 1:1:1 ratio (see Table 4 for specific combinations). MeGRXC3-YC was mixed with YNs and YNs-TGBp1 resuspensions for injection. For each combination, 1 / 10 of the total volume of the nuclear-localizing red-light vector FIB2-RFP was added as a nuclear marker. The mixture was thoroughly mixed and injected into actively growing Nicotiana benthamiana leaves at the 5- to 7-leaf stage. At least three injections were performed for each combination. The injected Nicotiana benthamiana leaves were protected from light overnight and then cultured under normal conditions. After 2-3 days, take about 1-2 cm of each sample 2 A laser confocal microscope (Olympus FV3000) was used to observe the fluorescence of tobacco cells and take pictures. The excitation light for GFP was 488 nm and that for RFP was 546 nm.
[0039] Observation results such as Figure 2 As shown, co-injection of MeGRXC3-YC and YNs-TGBp1 into N. benthamiana leaves restored green fluorescence under 488 nm excitation, which overlapped with the red fluorescence of H2B-RFP under 546 nm excitation. However, co-injection of MeGRXC3-YC with YNs did not restore green fluorescence. These BiFC results further demonstrate the interaction between Sri Lankan cassava common mosaic virus TGBp1 and MeGRXC3.
[0040] Table 4 Combinations of different recombinant plasmids Agrobacterium combination Recombinant plasmid name 1 YNs-TGBp1 + MeGRXC3-YC + pZP-P19 + 1 / 10 nuclear marker FIB2-RFP 2 YNs + MeGRXC3-YC + pZP-P19 + 1 / 10 nuclear marker FIB2-RFP
[0041] TGBp1 negatively regulates MeGRXC3 expression The single-chain green fluorescent protein expression vector pG1300 was preserved in our laboratory.
[0042] First, refer to the method in 2.3 to transform the recombinant plasmid into Agrobacterium (GV3101) competent cells.
[0043] Then, refer to the method in 2.3 to mix the Agrobacterium combinations in Table 5 and inject them into the same tobacco leaf. Fluorescence microscopy observation was performed on the 5th day after injection. Figure 3 As shown, the fluorescence intensity of MeGRXC3-GFP decreased with the increase of YNs-TGBp1 bacterial solution concentration, indicating that TGBp1 negatively regulates MeGRXC3 expression.
[0044] To further confirm that TGBp1 negatively regulates MeGRXC3 expression, we mixed Flag-tagged MeGRXC3-Flag with pZP-p19 and co-injected them with pG1300 and TGBp1-GFP in the same leaf. Proteins were extracted 5 days after injection and Western Blot analysis was performed using Flag antibodies and GFP antibodies, respectively. Figure 4 As shown, the expression level of MeGRXC3-Flag after co-injection with TGBp1-GFP was 1 / 10 of that co-injected with pG1300 expressing only GFP, further indicating that TGBp1 negatively regulates MeGRXC3 expression.
[0045] Table 5 Combinations of different recombinant plasmids Agrobacterium combination Recombinant plasmid name 1 Buffer + MeGRXC3-GFP + pZP-P19 2 OD0.1 YNs-TGBp1 + MeGRXC3-GFP + pZP-P19 3 OD0.5 YNs-TGBp1 + MeGRXC3-GFP + pZP-P19 4 OD1.0 YNs-TGBp1 + MeGRXC3-GFP + pZP-P19
[0046] 2.5 Co-expression of TGBp1 and MeGRXC3 increases the content of reactive oxygen species in tobacco leaves First, transform competent Agrobacterium (GV3101) cells with the recombinant plasmid according to the method in 2.3. Then, mix the Agrobacterium combinations listed in Table 6 and inject them into the same tobacco leaf according to the method in 2.3. On the third day after injection, observe changes in ROS using a laser scanning imager at 532 nm and DAB staining.
[0047] Three days after injection, the leaves were immersed in DAB dye solution and allowed to react in the dark for 3 hours. Then, they were placed in a boiling water bath with stop solution for 10 minutes. 95% ethanol was used to decolorize until the chlorophyll was completely removed. The leaves were then placed in preservation solution and photographed. Figure 5 As shown, ROS levels increased when TGB1 was co-expressed with MeGRXC3.
[0048] Table 6 Combinations of different recombinant plasmids Agrobacterium combination Recombinant plasmid name 1 p1300-Flag + pG1300 + pZP-P19 2 p1300-Flag + TGB1-GFP + pZP-P19 3 MeGRXC3-Flag + pG1300 + pZP-P19 4 MeGRXC3-Flag + TGB1-GFP + pZP-P19 While the specific embodiments of the present invention have been described in detail above, these are intended to be exemplary only, and the present invention is not limited thereto. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, any equivalent changes and modifications made without departing from the spirit and scope of the present invention are intended to be encompassed within the scope of the present invention.
Claims
1. Use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene in down-regulating the expression level of MeGRXC3; wherein, The nucleotide sequence of the TGBp1 gene is shown as SEQ ID NO:1; The nucleotide sequence of the gene corresponding to MeGRXC3 is shown as SEQ ID NO:
2.
2. Use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene in the interaction with MeGRXC3; wherein, The nucleotide sequence of the TGBp1 gene is shown as SEQ ID NO:1; The nucleotide sequence of the gene corresponding to MeGRXC3 is shown as SEQ ID NO:
2.
3. The application according to claim 2, wherein The interaction between TGBp1 and MeGRXC3 results in the down-regulation of the expression level of MeGRXC3.
4. The application according to claim 2, wherein The interaction between TGBp1 and MeGRXC3 increases the content of reactive oxygen species in plant tissues.
5. The application according to claim 2, wherein The interaction between TGBp1 and MeGRXC3 improves the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade nutrient-deficient medium.
6. Use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene in increasing the content of reactive oxygen species in plant tissues, wherein, The nucleotide sequence of the TGBp1 gene is shown as SEQ ID NO:1; The nucleotide sequence of the gene corresponding to MeGRXC3 is shown as SEQ ID NO:
2.
7. Use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene in improving the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade nutrient-deficient medium, wherein, The nucleotide sequence of the TGBp1 gene is shown as SEQ ID NO:1; The nucleotide sequence of the gene corresponding to MeGRXC3 is shown as SEQ ID NO:2.
Citation Information
Patent Citations
Cassava common mosaic virus (CsCMV)induced gene silencing system and application thereof
CN112899301A
Cassava MeGRXC3 gene capable of improving resistance and application of cassava MeGRXC3 gene
CN116024226A
Cassava MeChlD gene as well as silencing system and application thereof
CN116426535A
Malva mosaic virus and virus-like particles and uses thereof
US20110104191A1
Cited By
Application of cassava common mosaic virus TGBp1 in inhibiting RNA silencing
CN120944956A
Use of cassava common mosaic virus tgbp1 in inhibiting rna silencing
CN120944956B