Group A rotavirus G8P[8] strain CZ-23 and application thereof
By providing G8P[8] type A group rotavirus CZ-23, the problems of declining circulating strains and virus reassortment faced by existing rotavirus vaccines were solved, and a new virus strain was provided for vaccine development, which enhanced the protective effect of the vaccine.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
- Filing Date
- 2025-05-29
- Publication Date
- 2026-06-12
AI Technical Summary
Existing rotavirus vaccines face challenges in protective efficacy due to declining prevalent strains and viral reassortment, and lack diverse viral strains for vaccine development.
A strain of G8P[8] group A rotavirus CZ-23 with good genetic stability, encoding six structural and non-structural proteins, was provided for evaluation of the immunogenicity of existing vaccines and development of new vaccines.
This provides a new source of virus for rotavirus vaccines, enhances vaccine diversity and protective efficacy, and meets the needs of vaccine development.
Smart Images

Figure CN120210133B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of rotavirus technology, and in particular to a G8P[8] type A group rotavirus CZ-23 and its applications. Background Technology
[0002] Rotavirus is a non-enveloped, double-stranded RNA virus. Its genome consists of 11 segments of double-stranded RNA enclosed by three concentric capsid proteins, encoding six structural proteins (VP1, VP2, VP3, VP4, VP6, and VP7) and six non-structural proteins (NSP1, NSP2, NSP3, NSP4, NSP5, and NSP6). Based on the VP6 gene sequence and antigenic differences, rotaviruses are divided into 10 groups (AJ), among which group A rotavirus (RVA) is one of the main pathogens causing acute gastroenteritis in infants and young children under 5 years old.
[0003] Currently, there is no specific treatment for rotavirus gastroenteritis (RVGE), and clinical treatment mainly relies on supportive care. RVA vaccination is the most effective measure to reduce the incidence of RVGE. The six rotavirus vaccines currently used globally offer good protection against the predominantly circulating strains. With the widespread use of vaccines, the selective pressure on rotavirus strains is decreasing, leading to a decline in the prevalence of traditional circulating strains. Simultaneously, natural reassortment between viruses is causing the continuous emergence of new rotavirus strains and their increasing prevalence in some regions. This poses a significant challenge to the protective efficacy of vaccines. Therefore, providing a wider variety of human rotavirus strains to offer more viral sources for rotavirus vaccine development is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0004] This invention provides a novel human rotavirus strain with good genetic stability, which can be used to evaluate the immunization effect of existing vaccines against it, and to provide a new vaccine strain for the development of rotavirus vaccines.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0006] This invention provides a G8P[8] type A group rotavirus CZ-23, which was deposited on April 11, 2023 at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing; the accession number is CGMCC NO.45559.
[0007] Preferably, the G8P[8] type A group rotavirus CZ-23 encodes six structural proteins: VP1, VP2, VP3, VP4, VP6 and VP7 and six non-structural proteins: NSP1, NSP2, NSP3, NSP4, NSP5 and NSP6, with nucleotide sequences as shown in SEQ ID NO.1~11.
[0008] VP1
[0009]
[0010] VP2
[0011]
[0012] VP3
[0013]
[0014] VP4
[0015]
[0016] VP6
[0017]
[0018] VP7
[0019] TGTATGGTATTGAATATACCCCAACTCTAATCTTCTTGATATTGCTTGTATTATTAAATTATATACTAAAATCAATAACTCGAATTATGGACTATATACTCTACAGATTTTTGTTGTTTATTGTAATTATTACGCCATTTGTAAATTCACAGAACTATGGCATAAATTTACCAATTACTGGATCTATGGACGCAAACTACCAGAACGTATCGACTTCAGAACCATTTCTAACATCAACATTATGTCTTTATTATCCAACAGAGGCTGAAACAGAGATTGCTGACAGTTCATGGAAAGATACGCTATCACAGTTATTTTTAACAAAAGGGTGGCCAACTGGTTCTGTTTATCTTAGAAGCTACACAGATATTTCAACTTTTTCAATAAATCCTCAGTTGTATTGCGATTACAACATAGTTCTAATGAAATATAACGCCGATTCGGAACTAGATATGTCAGAGTTAGCAGACTT GATACTCAATGAATGGCTATGTAATCCAATGGATATAACGTTGTACTATTATCAGCAGACGGATGAAACAAATAAATGGATATCAATGGGAGATTCGGTGTACTATTAAAGTGTGTCCATTAAATACGCAGACATTAGGCATTGGATGTCTCACCACTGACACTACGACTTTTGAAGAAGTTGCGACAGCAGAAAAATTAGCAATAACGGATGTTGTTGATGGGGTGAACTACAAAATAAATGTTACTACTACTACATGTACAATTAGAAACTGTAAAAAAACTGGGACCTAGAGAGAATGTTGCAGTCATCCAAGTAGGTGGTTCAAACATTTTAGATATTACAGCAGATCCTACGACAGCACCACAAACTGAAAGAATGATGAGAGTTAATTGGAAAAAATGGTGGCAAGTTTTCTATACTGTTGTTGATTATGTAAATCAAATAATTCAAGCAATGTCCAAAAGATCGCGAT
[0020] NSP1
[0021]
[0022] NSP2
[0023] GGCTGAGCTAGCTTGCTTTTGCTATCCCCATTTGGAGAACGATAGCTATAGATTTATTCCTTTTAACAATTTGGCTATAAAATGTATGTTGACAGCAAAAGTAGAGAAAAAAGATCAAGATAAATTTTACAACTCGATAATCTATGGTATTGCGCCGCCACCACAATTTAAAAAACGCTATAATACAAATGATAATTCAAGAGGAATGAATTATGAGACTGCAATGTTTAACAAGGTGGCGGTGCTAATTTGTGAAGCATTGAATTCAATTAAAGTCACACAGTCTGATGTTGCAAGTGTACTTTCAAGAGTAGTTTCTGTGAGACATCTTGAGAATTTAGTATTAAGAAGAAAATCATCAGGACGTTCTTTTTCACTCAAAGGAATTACTACTCAAATCAGTTTTAATAGCTATTGGTCATTCAAAAGAGATTGAAACAACTGCCACTGCTGAAGGGGGAGAAATCGTTTTTTTCA AATGCATTTACAATGTGGAAATTGACATACTTAGAACATAAACTAATGCCAATTCTTGATCAAAACTTCATTGAATATAAAATTACAGTAAATGAAGATAAACCGATTTCAGAGTCACACGTAAAAGAACTTATTGCTGAATTACGGTGGCAATACAATAAATTTGCAGTAATTACGCATGGTAAAGGTCACTATAGAGTTGTAAAATACTCGTCAGTTGCAAATCATGCAGACAGAGTTTATGCTACTTTTAAGTAATAACAAAAACGGAGGTTCACTGGAGTTTAATTTGCTTGATCAGAGAATAATATGGCAAAATTGGTACGCATTTACGTCTTCAATGAAACAAGGTAATACTCTTGATGTGTGCAAAAAAACTACTTTTCCAAAAATGAAGCGAGAAAGCAATCCATTTAAGGGGCTGTCAACTGATAGAAAAATGGATGAAGTTTCTCAAGTAGGAATCTAGTTCG
[0024] NSP3
[0025] GGCATCTTCTATTATTAACTCTTCTTTTGAAGCTGCAGTTGTCGCTGCAACTTCTACATTGGAATTAATGGGTATTCAATATGATTATAATGAAGTATATACTAGAGTTAAAAGTAAGTTTGATTTTGTAATGGATGATTCTGGTGTTAAGAATAATTTAATAGGTAAGGCAGTTACAATTGATCAGGCTTTGAATGGTAAGTTTAGTTCATCTATTAGAAATAGAAATTGGATGACTGATTCAAAAACTGTAGCAAGATTAGATGAAGATGTGAATAAACTTAGATTATTATTGTCATCGAAAGGAATTGATCAAAAAATGAGAGTTCTTAATGCATGCTTTAGTGTTAAGAGAATACCTGGAAAATCGTCATCTATCATTAAATGTACTAGGTTAATGAAAGAAAAAATAGAACGTGGAGAAGTCGAAGTAGATGATACATTCATTGAAGAAAAAATGGAAATTGATACTATAGATTGGAA ATCCAGATATGATCAGCTTGAAAGACGATTTGAGTCGTTAAAACAGCGAGTTAATGAAAAGTATAATAATTGGGTTATTAAGGCAAGGAAAGTAAACGAAAACATGAACTCTCTTCAGAATGTTATTTCACAACAGCAAGCTCTATCAATGAATTACAAATATATAATAATAAACTAGAGCGTGATTTACAATCAAAAATAGGATCAGTTGTTTCATCCATTGAATGGTACTTAAGGTCTATGGAACTATCAGATGACATTAAATCAGATATTGAACAACAACTCAATTCAATAGATCATATTAATCCAGCTAATGCTTTCGATGATTTCGAATCTCTCTTCGTAATTTAATATCTGATTATGATAGAATTTTTATTATGTTTAAAGGATTGTTGCAGCAAAGTAATTACACTTATACTTATGAATAGACATAGCATATTACCATCTTCACGTAACCCTCTATGAGCACAATAGTTAAAAGC
[0026] NSP4
[0027] GAGAGAGCGCGTGCGGAAAGATGGAAAAGCTTACCGACCTCAACTACACATTGAGTGTAATCACTCTAATGAACAGTACACTACATACAATACTGGAGGATCCAGGGATGGCGTATTTTCCCTATATTGCATCTGTCCTAACGGTTTTGTTCACATTGCATAAAGCATCAATTCCAACAATGAAAATAGCGTTGAAAACGTCAAAATGTTCGTATAAAGTAATAAAGTATTGTGTTGTAACAATTTTTAACACGTTACTGAAACTAGCAGGTTATAAAGAGCAGATAACTACTAAAGATGAAATAGAAAAACAAATGGACAGAGTCGTTAAAGAAATGAGACGTCAATTGGAAATGATTGATAAACTGACTACACGTGAAATCGAGCAAGTAGAGCTACTTAAACGTATATATGATAAATTGATGGTGCAATCAATTGGCGAGATAGATATGACGAAAGAAATTAATCAAAAGAACGTGAAAACGCTAGAAGAATGGGAAAGTGGAAGAAATCCTTATGAACCGAAAGAAGTGACTGCAGCAATGTAAGAGGTTGAGCTGCCGTCGACTGTCTTCGGAAGCGGCGGAGTTCTTCACAGTAAGCCCCATCGGACCTGATGGCTGGCTGAGAAGCCACAGTCAGCCATATCGCGTGTGGCTCAAGCCTTAATCCCGTTTAACCAATCCGGTCAGCACCGGA
[0028] NSP5 / 6
[0029] TATTGATGTGACTAGTCTTCCTTCAATTTCTTCTAGTGTTTATAAAAATGAATCGTTTTCAACAACGTCAACTATTTCTGGAAAATCTATTGGTAGGAGTGAACAGTACATTTCACCAGATGCAGAAGCTTTCAATAAGTACATGTTATCAAAATCTCCAGAAGATATTGGACCTTCTGATTCTGCA TCGAACGATCCACTCACCAGCTTTTCGATTAGATCGAATGCAGTTAAGACAAATGCAGATGCTGGCGTGTCTATGGATTCATCAGCACAATCACGACCATCTAGCGACATTGGATACGATCAAATGGATTTCTCCTTAAGTAAAGGTATTAAAATTGATGCTACAATGGATTCCTCAATATCAATAT CCACTACATCAAAGAAGGAGAAATCTAAACAAGAGAACAAAAATAAATATAAAAAATGTTATCCAAAAATTGAAGCAGAATCTGATTCTGATGAATACGTATTAGATGATTCAGATAGTGATGATGGAAAATGTAAAAATTGCAAGTATAAAAAGAAATATTTTGCACTTCGTTTAAGAATGAAACA GGTTGCAATGCAATTGATTAAAGATTTGTGAAAATTTTCTGATTACTCTTATTATTAACTGTTAAATATTTACTTAATGTACGGATGATAAATGTTGTTTAATTATATTATAATAATAAGATTACTATGTCGAGTTATTGAATTTAACAACTTTTTAACGAGAGAAGATTAATGCGTCTACCCTAAGA
[0030] The present invention also provides the application of the G8P[8] type A group rotavirus CZ-23 in the preparation of rotavirus vaccines.
[0031] The present invention also provides a rotavirus vaccine comprising the G8P[8] group A rotavirus CZ-23.
[0032] Preferably, the G8P[8] type A group rotavirus CZ-23 has undergone attenuation treatment.
[0033] The present invention also provides the application of the reagent for detecting the G8P[8] type A group rotavirus CZ-23 in the preparation of rotavirus detection reagents.
[0034] The present invention also provides a detection reagent, including a reagent for detecting the G8P[8] type A group rotavirus CZ-23.
[0035] The present invention also provides a method for isolating and culturing the G8P[8] type A group rotavirus CZ-23, comprising the following steps:
[0036] (1) Obtaining rotavirus samples;
[0037] (2) MA104 cells that had formed a monolayer were digested with trypsin-EDTA. After the cells were digested and formed into single cells, they were resuspended in DEME-10% FBS and diluted to (3~4)×10⁻⁶. 5 Cells / ml, at (6~7)×10 5 Cells / tubes were seeded and transferred to tubes, and after 1-2 days of culture, an MA104 cell monolayer was obtained.
[0038] (3) Mix the diluted virus sample obtained in step (1), trypsin and CaCl2, activate for 1.5-2 hours, inoculate into the MA104 cell monolayer obtained in step (2), adsorb for 2-3 hours, then add trypsin-serum-free DMEM cell maintenance medium, culture until MA104 cells become diseased, harvest the culture and continue to inoculate into MA104 cells for passage or cryopreservation for later use.
[0039] Preferably, the method for obtaining the virus sample in step (1) is as follows: collect the diarrheal excrement specimens of children with diarrhea, resuspend them in 0.01~0.02 M PBS, pH 7.2~7.4 solution, centrifuge at 13000~14000 g for 10~12 min, take the supernatant, and filter it with a 0.22 μm filter to obtain the rotavirus-infected virus sample.
[0040] Preferably, during the operation of steps (2) and (3), the ambient temperature needs to be maintained at 36~38℃; the volume concentration of the trypsin is 0.23~0.27%; the ratio of the diluent of the virus sample, trypsin and CaCl2 in step (2) is 200~240μl: 1.2~1.4μl: 0.4~0.6μl.
[0041] This invention provides a novel wild-type human rotavirus strain, which is the first reported isolation in China. This strain has strong viral replication ability and good genetic stability, and can be used as a vaccine strain for developing human rotavirus vaccines, including attenuated oral rotavirus vaccines. Attached Figure Description
[0042] Figure 1 Microscopic images (×40) of CPE produced by CZ-23 strain in MA104 cells; (A: MA104 cells 3 days after inoculation with the 7th generation strain, CPE is shown in the red box; B: Normal MA104 cells).
[0043] Figure 2 The results are for the detection of colloidal gold in MA104 cells from passage 1 to passage 10 of the CZ-23 strain.
[0044] Figure 3 The results show the detection of mycoplasma in cells and different generations of CZ-23 strains.
[0045] Figure 4 The genomic nucleic acid banding patterns of different generations of CZ-23 strain were: (P0: original solution of G8P[8] type RVA fecal specimen; P3, P5, P8, P10: all are genomic nucleic acid banding patterns of CZ-23 strain).
[0046] Figure 5 This is a diagram showing the growth of erosion spots in the CZ-23 strain.
[0047] Figure 6 The results are from rapid RT-PCR typing of the purified strain.
[0048] Figure 7 To detect MA104 cells (40×) infected with CZ-23 strain using indirect immunofluorescence assay; (A: 10 -1 B: 10 -2 C: 10 -3 D: 10 -4 E: 10 -5 F: Uninfected MA104 cells).
[0049] Figure 8 Electron micrograph of the CZ-23 strain; (A: 100nm; B: 200nm).
[0050] Figure 9 The growth kinetics curves of the CZ-23 strain in MA104 cells before and after purification are shown.
[0051] Figure 10 Phylogenetic trees of the VP7 gene for the original specimen and different generations of CZ-23 strains are presented. (The original specimen is marked with solid triangles; different generations of CZ-23 strains: CZ-23-P2, CZ-23-P9, CZ-23-P16, and CZ-23-P23 are marked with solid squares; vaccine strains are marked with solid circles; Bootstrap is based on a confidence level of 1000 cycles, the same applies below).
[0052] Figure 11The VP4 gene evolution tree is presented for the original specimen and different generations of CZ-23 strains.
[0053] Figure 12 The VP1 gene phylogenetic tree is presented for the original specimen and different generations of CZ-23 strains.
[0054] Figure 13 The VP2 gene evolution tree is presented for the original specimen and different generations of CZ-23 strains.
[0055] Figure 14 The VP3 gene evolution tree is presented for the original specimen and different generations of CZ-23 strains.
[0056] Figure 15 Phylogenetic tree of VP6 gene from the original specimen and different generations of CZ-23 strains.
[0057] Figure 16 The NSP1 gene phylogenetic tree is presented for the original specimen and different generations of CZ-23 strains.
[0058] Figure 17 The NSP2 gene phylogenetic tree is presented for the original specimen and different generations of CZ-23 strains.
[0059] Figure 18 The NSP3 gene evolution tree is presented for the original specimen and different generations of CZ-23 strains.
[0060] Figure 19 The NSP4 gene phylogenetic tree is presented for the original specimen and different generations of CZ-23 strains.
[0061] Figure 20 Phylogenetic tree of NSP5 / 6 genes from the original specimen and different generations of CZ-23 strains.
[0062] Biological Preservation Instructions
[0063] The biological material involved in this invention, G8P[8] type A group rotavirus CZ-23, was deposited on April 11, 2023 at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing; the accession number is CGMCC NO.45559. Detailed Implementation
[0064] Example 1
[0065] 1. CZ-23 strain isolation method: (1) Obtaining virus samples
[0066] A positive sample of G8P[8] type rotavirus from a hospitalized child under 5 years old with acute gastroenteritis in Chenzhou City, Hunan Province in the spring of 2021 was selected from the Institute of Viral Disease Control and Prevention of the Chinese Center for Disease Control and Prevention. The fecal sample was prepared into a 10% fecal suspension using phosphate buffer solution (PBS, 0.01mol / L, pH: 7.4). The suspension was centrifuged at 2500×g for 5min. The supernatant was filtered through a 0.22μm filter membrane to obtain the sample. The sample was aliquoted into EP tubes and stored at -80℃ for later use.
[0067] (2) Adaptation culture of CZ-23 strain in MA104 cells
[0068] MA104 cells in good growth condition were digested with 0.25% Trypsin-EDTA. The digested cells were resuspended in DEME-10% FBS and diluted to 3×10⁻⁶ cells / mL. 5 cells / ml, at 6×10 5 Cells were seeded into tubes and cultured at 37°C in a 5% CO2 incubator for 24 hours. After the cells formed a monolayer, they were washed twice with DMEM and 2 ml of DMEM was added. The cells were then starved in a CO2 incubator for 1.5 hours before use. 200 μl of the sample prepared in step (1) was added to 0.25% trypsin stock solution to maintain a final concentration of 15 µg / ml. 300 g / L CaCl2 was also added to the sample, trypsin (0.25% trypsin concentration, Gibco, catalog number 15050-065, 0.25%), and CaCl2. The ratio was 200 μl: 1.2 μl: 0.4 μl. The cells were incubated at 37°C for 60 min. The activated virus solution was added to the cultured cells and incubated at 37°C for 2 h. The supernatant containing the virus was discarded, and the cells were washed three times with PBS. Serum-free DMEM culture medium (containing 20 µg / ml trypsin) was added to maintain the cells, and the cells were incubated at 37°C in a 5% CO2 incubator. Cytopathic effects were observed daily. After 4 days, when obvious cytopathic effects appeared (…),… Figure 1 Harvest the viral fluid and continue passage. Figure 2 The results of RVA colloidal gold assays of the CZ-23 strain after culturing and harvesting venom on MA104 cells from passage 1 to 10 are presented, demonstrating its stability during passage.
[0069] Colloidal gold assays were performed on MA104 cells from passages 1 to 3 after inoculation, and all results were positive. Colloidal gold assays from passages 4 to 6 showed weak positivity, with almost no positive bands visible to the naked eye. After blind passage to passage 7, inoculation assays revealed significantly brighter bands, and MA104 cells showed significant cytopathic effect (CPE) after inoculation. The occurrence of cytopathic effect and cell fragmentation in MA104 cells was significantly earlier than in passages 3 to 6. The colloidal gold assay results and the earlier occurrence of CPE indicate that RVA is more adaptable to MA104 cells, and that the large-scale replication of RVA in MA104 cells can lead to significant CPE in MA104 cells.
[0070] Mycoplasma contamination is a common problem in cell experiments. To ensure the reliability and stability of cell experiments and avoid the impact of mycoplasma contamination on experimental results, mycoplasma detection was performed on MA104 cells and the 3rd, 6th, and 9th generation viruses. Mycoplasma detection was performed using a mycoplasma detection kit, and the specific operating steps are as follows:
[0071] (1) Sample preparation: After the cells and virus have been cultured for 3 days, take 40 μL of cell or virus culture medium and put it into a clean PCR tube. Place it in a PCR instrument and heat it at 95℃ for 10 min before using it as a PCR template.
[0072] (2) System configuration:
[0073] Table 1 PCR reaction system
[0074]
[0075] Set up a negative control (MycoFreeWater) and a positive control (MycoPositiveControlTemplate), and strictly follow the procedures to prevent exogenous mycoplasma contamination.
[0076] (3) Reaction procedure:
[0077] Table 2 PCR reaction procedure
[0078]
[0079] (4) Gel electrophoresis: Take 10 μL of PCR product and electrophore it on a 1.5% agarose gel to detect the PCR results. The size of the positive band is about 350 bp.
[0080] Results: Mycoplasma detection in MA104 cells and the 3rd, 6th, and 9th generation viruses revealed no obvious bands except for the positive control, indicating that the cells and viruses were not contaminated with mycoplasma and the experimental results were reliable (see [link to results]). Figure 3 ).
[0081] 2. Identification of CZ-23 strain
[0082] (1) RT-PCR typing identification of CZ-23 strain
[0083] The strain was amplified using VP7 / VP4 primers from the National Viral Diarrhea Surveillance Program (2021 Edition), sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing, and identified as G8 genotype RVA by NCBI.
[0084] (2) Detection of nucleic acid banding of strain CZ-23 by polyacrylamide gel electrophoresis
[0085] 200 μL of different generations of CZ-23 virus solution, as well as RRV, SA11, and G4P[6] type RVA virus solution, were taken respectively, and viral RNA was extracted using the Biospin Virus RNA Extraction Kit (BioFlux). Polyacrylamide gels were prepared according to standards, and the extracted RNA samples were mixed with 10×Loading Buffe at a ratio of 9:1 and added to each well. Electrophoresis was performed at 90V for 8 hours at room temperature. The PAGE gels were stained using a rapid nucleic acid silver staining kit (Zhongke Tairui, catalog number: RTS5101) and photographed using a Tanon-4800Multi. The nucleic acid banding characteristics were compared and analyzed to determine genetic stability.
[0086] Results: RVA is a dsRNA virus, and its genome consists of 11 segments. The typical characteristics of the CZ-23 strain dsRNA-PAGE electrophoresis image are 4:2:3:2 (…). Figure 4 No significant differences were observed in the genomic banding patterns of the G8P[8] type RVA specimen (P8) and the CZ-23 strain at different generations, indicating that the CZ-23 strain maintained good genetic stability during the adaptation culture on MA104 cells. The genomic banding pattern of the CZ-23 strain was significantly different from that of the RRV, SA11, and G4P[6] strains, and it had a short RNA electrophoretic pattern.
[0087] (3) Purification of CZ-23 strain with etch spots
[0088] The procedure for plaque culture is as follows:
[0089] 1) According to 3×10 5 MA104 cells were seeded in 6-well plates at a density of cells / mL, with 2000 μL of cell suspension added to each well. The cells were then incubated at 37°C in a 5% CO2 incubator for 2 days before inoculation.
[0090] 2) Before challenge, remove the culture medium from the cell wells, wash MA104-03 once with DMEM, replace with DMEM, and incubate at 37°C for 1 hour.
[0091] 3) After centrifugation, aspirate the supernatant from each venom sample and dispense 1000 μL of sample solution for venom challenge. Add 6 μL LDT (trypsin) and 2 μL CaCl2 to each 1000 μL of venom solution and incubate at 37°C for 1 hour.
[0092] 4) Preparation of 2% low melting point agarose: Accurately weigh 2.0g of low melting point agarose dry powder, add it to a sterile Erlenmeyer flask after autoclaving, and add 100mL of ultrapure water quantitatively; autoclave for 2 hours.
[0093] 5) After the time is up, dilute the activated virus according to a gradient of 10. -1 10 -2 10 -3 10 -4 10 -5 10 -6 Remove the DMEM from each well (leaving 100-200 μL of DMEM in each well), slowly add 200 μL of venom sample to each well, and incubate at 37°C for 2 hours (shake gently every 20 minutes, for a total of 3 times).
[0094] 6) Prepare the first layer of low-melting-point agarose gel in time before the adsorption time ends: 8 mL of 2% low-melting-point agarose; 8 mL of MEM (2×); 64 μL of 0.25% EDTA-free trypsin.
[0095] 7) Take the sample solution from each well, and then spread 1 mL of the prepared low melting point agarose solution into the plate for each well. Shake the plate in a cross shape to ensure that the liquid surface is flat after the low melting point agarose solution solidifies.
[0096] 8) After the low-melting-point agarose gel solidifies, invert the 6-well plate to prevent water droplets from flowing on the agar surface and thus avoid cross-fusion of the various etch spots. Then, incubate the 6-well plate in an incubator and observe the virus growth in the 6-well plate after 24 hours.
[0097] 9) Five days later, some cells were found to have undergone CPE, and they were covered with the upper gel.
[0098] 10) Prepare the upper layer of low melting point agarose gel: 8 mL of 2% low melting point agarose.
[0099] 11) Then spread 1 mL of the prepared upper layer low melting point agarose solution into each well, and shake it in a cross shape to ensure that the liquid surface is flat after the low melting point agarose solution solidifies.
[0100] 12) After the upper layer of low-melting-point agarose gel has solidified, turn the 6-well plate over and start observing the etching spots after 24 hours.
[0101] 13) After staining live cells, mark the etched spots with a black marker. Using a sterile pipette tip after autoclaving, use the pipette to remove larger unstained spots and place them in an EP tube. Add 200 μL DMEM and use the pipette tip to mix the spots thoroughly with DMEM. After shaking, freeze and thaw the tube four times at -80℃ to room temperature, and then centrifuge.
[0102] 14) Collect the supernatant. After completion, aspirate the supernatant, filter it through a 0.22μm filter membrane, and dispense it into 1.5mL EP tubes. Then, inoculate the treated venom solution into the tubes for incubation.
[0103] 15) Perform RT-PCR rapid typing on the supernatant obtained after virus amplification to identify the type of virus strain.
[0104] Results: Obvious CPE was observed in the CZ-23 strain after 72 hours. Low-melting-point agarose gel fixed the plaques produced by the strain within a specific area, and 10 were observed. -1 ~10 -6 As the dilution factor increases, the size and number of viral patches gradually decrease. Figure 5 The purified strain underwent rapid G / P typing. Agarose gel electrophoresis revealed a G8-specific fragment (754 bp) with no other G-type-specific fragments; and a P8-specific fragment (224 bp) with no other P-type-specific fragments. Figure 6 It can be determined that the genotype of the purified strain is G8P[8].
[0105] (4) Determination of virus titer of CZ-23 strain
[0106] The activated virus was diluted 10-fold, and 100 μl of the virus sample was added to a solution diluted 3 × 10⁻⁶ times. 5 MA104 cells were seeded in 96-well plates at a density of cells / mL and incubated at 37°C for 2 hours. After 2 hours, the viral load was aspirated, and the plates were washed twice with 100 μL / well PBS. Maintenance medium (4 μL of 0.25% Trypsin per 1 mL L DMEM) was then added to the plates, bringing the final concentration to 10 μg / mL. The plates were then incubated at 37°C in a 5% CO2 incubator. Viral growth was observed after 24 hours. A positive result was defined as the presence of CPE in a replicate well. The percentage of positive wells in each dilution (10 replicates) was expressed as a percentage. The TCID50 value was calculated using the Reed-Muench formula, comparing two adjacent dilutions with positive rates above and below 50%. The calculation formula is as follows:
[0107] Comparison distance = A - 50% / AB
[0108] LogTCID50 = logA dilution + (distance × log dilution factor) A: Positive rate above 50%; B: Positive rate below 50%
[0109] Results: The CZ-23 strain can be stably cultured in MA104 cells, and the titer of the CZ-23 strain obtained after 10 consecutive passages in MA104 cells reaches 7.2 LogTCID50 / mL. The titer of the purified and passaged CZ-23 strain reaches 7.5 LogTCID50 / mL. It can be seen that the viral titer and infectivity of the CZ-23 strain gradually increase during passage in MA104 cells and maintain a high titer level.
[0110] IFA identification of CZ-23 strain
[0111] MA104 cells were fed at a rate of 3 × 10 5 Cells / ml were seeded in 96-well plates and incubated with viral culture after 1 day. After 3 days, the culture medium was discarded, and the cells were washed three times with sterile PBS. 100 μl of pre-chilled 4% tissue cell fixative was added to each well for fixation, and the cells were washed three times with PBS. The cells were then incubated with 0.2% Triton X-100 for 15 min to allow for permeation, and washed three times with PBS. 100 μl of rabbit anti-VP6 antibody was added, and the cells were incubated at 37°C for 1 h, followed by three washes with PBST and then three washes with PBS. 100 μl of goat anti-rabbit fluorescent secondary antibody (FITC) was added, and the cells were incubated at 37°C in the dark for 30 min, followed by three washes with PBS. The cells were then observed under a fluorescence microscope after adding 100 μl of PBS. A negative control was established.
[0112] Result: The CZ-23 strain was administered at 10... -1 ~10 -5 After being diluted proportionally, cells were seeded into 96-well plates. IFA analysis after 24-48 hours showed clear and bright green fluorescence in the cytoplasm. Figure 7 The cell nuclei were pale, which proves that the virus can infect MA104 cells well. Furthermore, the green fluorescence around the cells gradually decreased as the dilution ratio increased, indicating that the virus's ability to infect cells gradually decreased with increasing dilution ratio. In contrast, the control group that was not inoculated with the virus did not show fluorescence.
[0113] (5) Collect samples of MA104 cells with complete lesions and 30%~50% lesions for electron microscopy observation.
[0114] The results are as follows Figure 8 After the virus strain was cultured in MA104 cells, the infected cells were collected and observed under an electron microscope. It was found that the RVA particles were all round, wheel-shaped, without a membrane, about 70 nm in size, with clear outlines and intact morphological structure.
[0115] (6) Growth kinetics curve of CZ-23 strain in MA104 cells
[0116] The purified virus solution was inoculated into MA104 cells, and cells were harvested at 0h, 12h, 24h, 48h, 72h, 96h, 120h, and 144h post-inoculation. After repeated freeze-thaw cycles, centrifugation, and filtration, the virus was cultured according to TCID standards. 50 The procedure was followed to inoculate the virus, and the viral titer was calculated at different time points. The growth kinetics curve of the virus strain in MA104 cells was plotted.
[0117] The results are as follows Figure 9 As shown: The venom purified from the CZ-23 strain plaque and cultured in MA104 cells for 5th generation was used as a seed for sampling at different time points, and TCID was used. 50 Perform titer determination, from Figure 9 It was observed that the viral titer and proliferation showed a significant upward trend from 0 to 120 hours after cell infection, with the viral titer reaching its highest value of 7.7 LogTCID at 120 hours after inoculation. 50 / mL, and then the titer showed a slight decreasing trend, reaching 7.5 LogTCID at 144h. 50 / mL. The growth kinetic curves of the CZ-23 strain before and after purification showed basically the same trend, and the titer of the purified strain was higher than that of the unpurified strain at different time points.
[0118] (7) Based on the corresponding reference sequences in the GenBank database, multiple nucleotide sequences were aligned using the Clustal W method with MEGA 7 software. A phylogenetic tree was constructed using the Neighbor-joining (NJ) method, and the confidence level Bootstrap was set to 1000 cycles.
[0119] Table 3. Amino acid differences between the neutralizing epitopes of CZ-23 strain and VP7 of rotavirus vaccine.
[0120]
[0121] Table 4. Amino acid differences between the neutralizing epitopes of CZ-23 strain and rotavirus vaccine VP8.
[0122]
[0123] Table 5. Amino acid differences between the neutralizing epitopes of CZ-23 strain and rotavirus vaccine VP5.
[0124]
[0125] Among them, the italicized text represents differential proteins.
[0126] Results: The VP7 gene of the original specimen and different generations of CZ-23 strains showed the highest nucleotide homology with the VP7 gene of the popular RVA strain of the G8P genotype in Guangzhou, China[8], including strain GZ-0013 (GenBank No.: OK349192.1) and strain GZ-0005 (GenBank No.: OK349181.1), with homology of 99.4% and 99.6%, respectively; the homology with the VP7 gene of Indian bovine strain 79 was slightly lower (92.9%), which is presumed to be of bovine origin. The VP7 gene of the original specimen and different generations of CZ-23 strains showed low homology with the VP7 gene of the RVA vaccine strains that have been marketed globally (<80% nucleotide homology). The homology of the VP7 gene of the original specimen and different generations of CZ-23 strains with the VP7 gene of the RVA vaccine strain was 73.6%~76.0%. In the phylogenetic tree of the VP7 gene, the original specimen and different generations of CZ-23 strains clustered in lineage I with G8-type DS-1 like strains previously reported in China, Singapore, Japan, Thailand, Argentina, Vietnam and India. In addition, several bovine G8 genotype RVA strains from India (BE4 / IND / G8P[1], 68 / IND / G8P
[14] , 79 / IND / G8P
[14] ) were also located in lineage I. Several human G8 genotype RVA strains reported in Africa (Mali-119 / mLI / G8P[6], GH019-08 / GHA / G8P[6], KisB565 / COD / G8P[6], DRC88 / COD / G8P[8], KDH1629 / KEN / G8P[4], KDH1111 / KEN / G8P[4], MUL-13-160 / UGA / G8P[4]) are all located in lineage II. Other G8 genotype RVA strains, such as those from the United States (2009727045 / USA / G8P[4], 2009727137 / USA / G8P[4]), Croatia (CR2006 / Croatia / G8P[8]) and Turkey (Amasya-1 / TUR / G8P[5]), clustered to form lineage III. G8 genotype RVA strains obtained from India (69M / IND / G8P
[10] ), Hungary (182-02 / HUN / G8P
[14] ), Morocco (ma31 / MAR / G8P
[14] ) and South Korea (KJ11 / KOR / G8P[7]), formed new genotype clusters in lineage IV. Among the VP4 genes, the domestic Guangzhou strains GZ-0005 and GZ-0013 showed the highest nucleotide homology (99.6~99.7%) with the CZ-23 strain. The VP4 gene of the CZ-23 strain detected in Chenzhou City, Hunan Province, is most closely related to two popular RVA strains of the G8P[8] genotype in Guangzhou. The CZ-23 strain is in lineage III with popular strains GZ-0005 and GZ-0013 in Guangzhou, China, and many RVA strains in Asian countries.The RVA strains with genotype P[8] from Brazil (IAL28 / BRA / G5P[8]), Australia (CK20039 / AUS / G1P[8]), the United States (WI61 / USA / G9P[8]), and the vaccine strain (RotaTeq-WI79-4 / Vaccine / G6P[8]) constitute lineage II. The three RVA strains reported from Russia (Nov10-N53 / RUS / G4P[8], Nov09-D386 / RUS / G1P[8]) and Pakistan (PAK56 / PAK / G9P[8]) constitute lineage IV. Several RVA strains from the United States (DC23 / USA / G3P[8], Wa / USA / G1P[8], VU06-07-29 / Vanderbilt / G1P[8]), Belgium (BE1520 / BEL / G1P[8]), and the vaccine strain (Rotarix-A41CB052A / Vaccine / G1P[8]) together constitute lineage I. The sequence homology between the P[8] genotype RVA vaccine strain and the CZ-23 strain is 92.6%~98.4%, which is lower than the sequence homology between the CZ-23 strain and the two Guangzhou G8P[8] genotype RVA strains (>99%). Comparison revealed that the VP1, VP2, VP3, VP6, NSP1, NSP2, NSP3, NSP4, and NSP5 / 6 genes of the CZ-23 strain showed the highest nucleotide homology with two Guangzhou DS-1 like G8P[8] type RVA epidemic strains, and their phylogenetic relationship was also the closest. The results showed that the CZ-23 strain clustered with the G8P[8] type RVA epidemic strains from Guangzhou, China, and other Asian countries in any branch of 11 segments. Overall, the CZ-23 strain had a short genetic distance and a close phylogenetic relationship with the DS-1 like G8P[8] type RVA epidemic strains from Guangzhou, China, and other Asian countries in 11 genomic segments.
[0127] (8) Amino acid sequence analysis of VP7 and VP4 genes of CZ-23 strain
[0128] Results: Sequence alignment revealed five amino acid sequence differences between the original fecal specimen and the virus culture. After culturing in MA104 cells for 2, 9, 16, and 23 generations, amino acid differences (A181T) were detected in the VP7 gene between the original specimen and different generations of the CZ-23 strain. Amino acid changes were detected at four positions (N267D; D385N; A46T; F176S) in the VP4 gene. The CZ-23 strain showed 99.4%–99.8% homology with the VP7 gene sequences of GZ-0013 and GZ-0005 strains from Guangzhou, China, and 99.4%–99.9% homology with the VP8 gene sequences of GZ-0013 and GZ-0005 strains from Guangzhou, China. The CZ-23 strain showed 98.9%–99.3% homology with the VP7 gene of Asian RVA and 96.9%–99.5% homology with the VP8 gene of Asian RVA. The CZ-23 strain showed 67.9%–73.0% amino acid sequence homology with the RVA vaccine strain VP7 gene and 31.9%–94.2% homology with the RVA vaccine strain VP8 gene. To determine whether fecal samples from the adaptation period and post-adaptation period, and the CZ-23 strain, represent the current G8 circulating strain in China, the neutralizing epitopes of VP7 and VP8 proteins in fecal samples from the adaptation period and post-adaptation period, the CZ-23 strain, other G8 genotype RVA circulating strains, and the vaccine strain were compared. The amino acid sequences of the RVA strains involved in this study were compared with those of the vaccine strains. The VP7 amino acid sequence contains nine variable regions (VR): 9-20, 25-32, 37-53, 65-76, 87-100, 119-132, 141-150, 208-224, and 235-242. The variable regions were VR-1, VR-2, VR-3, VR-4, VR-5, VR-6, VR-7, VR-8, and VR-9. Neutralizing epitope analysis of VP7 showed that CZ-23 and MA104 cells differed significantly from other prevalent G8 strains in China during and after adaptation. CZ-23 also showed 23 amino acid differences compared to four vaccines: LLR, Rotateq, Rotarix, and 116E.Amino acid differences exist in the VP7 antigen region: (T9F, I, V), (L15S), and (L16I, V, F) originate from VR1; (F40I, V, M), (T45S, F, A), and (S50A, T) originate from VR3; (N66S, V, A, T), (Q68V, A, T), (V70A, S), and (T72K, Q, S, R) originate from VR4; (E90R, S, K, A, P) and (S (96N, G, D, T) came from VR5; (R119K), (S120E, D), (T122D, S, Y), and (S125A, V, T, L) came from VR6; (D147S, N, T, G) came from VR7; (T213G, D, S, N, A) came from VR8; (Y235H) came from VR9; and (L34I), (L118F), and (D189Q, S, T) came from other regions. Meanwhile, four amino acid sites differed between the CZ-23 strain and the original specimen in the VP4 gene at different passage numbers. The antigenic epitopes of the two subunits VP8 and VP5 of the VP4 gene in the CZ-23 strain were analyzed. Epitope analysis of CZ-23 strain VP8 showed that four regions (8-1, 8-2, 8-3, 8-4) were basically the same as the circulating G8P[8] strain in China. CZ-23 strain differed from the two P[8] genotype vaccines RV1 and RV5 by 7 and 4 amino acids, respectively. CZ-23 strain differed significantly from other P genotype vaccines. Neutralizing epitope analysis of CZ-23 strain VP5 showed that five regions (5-1, 5-2, 5-3, 5-4, 5-5) were basically consistent with the strains in my country in recent years. It differed from the two P[8] genotype vaccines RV1 and RV5 by 2 and 3 amino acids, respectively, and from LLR and 116E by 6 and 7 amino acids, respectively. The above description is only a preferred embodiment of the present invention.
Claims
1. A group A rotavirus strain CZ-23 of G8P[8] was deposited on April 11, 2023 at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; the accession number is CGMCC NO.45559.
2. The Group A rotavirus of the G8P[8] type CZ-23 according to claim 1, characterized by that, The G8P[8] group A rotavirus CZ-23 encodes six structural proteins: VP1, VP2, VP3, VP4, VP6 and VP7 and six non-structural proteins: NSP1, NSP2, NSP3, NSP4, NSP5 and NSP6, with nucleotide sequences as shown in SEQ ID NO.1~11.
3. The application of the G8P[8] type A group rotavirus CZ-23 as described in claim 1 or 2 in the preparation of rotavirus vaccines.
4. A rotavirus vaccine comprising the G8P[8] group A rotavirus CZ-23 as described in claim 1 or 2.
5. The rotavirus vaccine according to claim 4, characterized in that, The G8P[8] type A group rotavirus CZ-23 was attenuated.