Rapid detection kit for mycoplasma pneumoniae and drug-resistant gene

Abstract

The invention belongs to the field of pathogen detection, and particularly relates to a rapid detection kit for detecting mycoplasma pneumoniae and drug-resistant genes, the kit comprises: a mycoplasma pneumoniae upstream primer, a mycoplasma pneumoniae downstream primer, and a probe for detecting mycoplasma pneumoniae; the kit comprises an upstream primer and a downstream primer of the drug-resistant mutant gene at the 23S rRNA A2063G site of the mycoplasma pneumoniae, and a probe for detecting the drug-resistant mutant gene at the 23S rRNA A2063G site of the mycoplasma pneumoniae. The kit provided by the invention is shorter in actual amplification time and better in detection effect, can provide more accurate and more reference value detection results for clinicians, can complete detection under general instruments in the market, and is better in general applicability and wider in application range.

Description

Technical Field

[0001] The present invention relates to the field of pathogen detection, and particularly to a rapid detection kit for detecting Mycoplasma pneumoniae and drug resistance genes. Background Art

[0002] Community acquired pneumonia (CAP) is a common infectious disease in children and one of the main causes of death in children under 5 years old. CAP pathogens include bacteria, viruses, mycoplasmas, chlamydias, fungi, protozoa, etc. Mycoplasma pneumoniae (MP) is one of the common pathogens causing CAP in school-age and pre-school children and is also not uncommon in infants. Pneumonia and extrapulmonary complications caused by MP pose a serious threat to children's health.

[0003] Due to the lack of a cell wall, MP is insensitive to antibacterial drugs acting on the cell wall (such as penicillins and cephalosporins), but sensitive to antibacterial drugs affecting bacterial protein synthesis (such as macrolides, quinolones, etc.). Since children are in the growth and development stage, there are fewer drug options available for treating MP infections in children. The first choice is macrolide drugs, mainly 14-membered erythromycin and 15-membered azithromycin. Most cases of Mycoplasma pneumoniae pneumonia (MPP) are mild and have good treatment effects and prognoses after treatment. However, there are still a few children who, even after 7 days of regular macrolide antibiotic treatment, experience symptoms worsening, persistent fever, or worsening of pulmonary imaging manifestations, which is considered refractory Mycoplasma pneumoniae pneumonia (RMPP). Currently, the main reasons for RMPP are considered to be: (1) abnormal immune function of the body, (2) MP resistance to macrolide antibiotics, and (3) mixed infections, among which MP resistance to macrolide antibiotics is an important factor in the occurrence and development of RMPP. In recent years, the situation of MP resistance to macrolide antibiotics has been increasing globally, and there are literature reports in China with a drug resistance rate of over 90%.

[0004] For whether MP develops drug resistance, the "gold standard" is to perform MP culture and drug susceptibility testing. However, MP culture requires high conditions, takes a long time, and has a low positive rate, which is of little significance for early clinical identification. Detecting relevant target sites by molecular biology methods is the main aspect of the worldwide research on the MP drug resistance mechanism. Research shows that the main mutation sites include positions 2063, 2064, and 2617 in the V region of 23S rRNA. Some research reports that all the mycoplasma drug-resistant strains isolated in China currently have mutations at 2063 and 2064, and the detection rate of the A2063G mutation (A / G mutation occurs at position 2063) is as high as over 95%. As can be seen from the above, the early and rapid diagnosis of MP has guiding significance for the rational use of antibiotics in clinical practice; at the same time, detecting drug-resistant genes of MP can provide a theoretical basis for replacing antibiotics for some children with poor response to macrolide drugs.

[0005] Currently, the detection methods for Mycoplasma pneumoniae are mainly divided into three categories: isolation culture and identification, molecular biology detection, and serological detection. Among them, real-time fluorescence quantitative PCR belongs to molecular biology detection. The "Expert Consensus on Laboratory Diagnosis and Clinical Practice of Mycoplasma pneumoniae Infection in Chinese Children (2019)" describes nucleic acid detection as follows: "Including DNA or RNA, it has the characteristics of high sensitivity and specificity and is suitable for the rapid diagnosis of MP infection. (1) The main detection method for MP-DNA is fluorescence quantitative PCR, and amplification primers are designed according to the P1 protein or 16S rRNA target gene. MP targets are also set in some multiplex PCR detection kits for respiratory pathogens. It has high specificity and sensitivity, the detection time is about 3h, the results are stable, and it can meet the needs of early clinical diagnosis. It should be noted that MP can be continuously carried during the recovery period after infection, and the DNA load shows a gradually decreasing trend. Therefore, MP-DNA should be quantitatively detected, and the detection results need to be comprehensively analyzed in combination with the clinical situation. The quantitative detection is reported in units of 1×10 3 copies / L or 1×10 3 U / L. If the detection result is higher than the upper limit of the detection method, it is reported as ≥XX×10 3 copies / L or ≥XX×10 3 U / L, and if it is lower than the lower limit of detection, it is reported as <XX×10 3 copies / L or <XX×10 3 U / L".

[0006] The rapid detection of Mycoplasma pneumoniae (MP), especially the detection of drug-resistant genes, helps to achieve early diagnosis and treatment of MP, select reasonable and effective antibacterial drugs, thereby improving the cure rate, reducing the abuse of antibacterial drugs, and alleviating the pain and economic burden of patients. However, the actual amplification time of common detection kits using PCR methodology is more than 1 hour, and this does not include the sample extraction and system configuration time. In the prior art, rapid PCR mainly shortens the actual amplification time of PCR by improving instruments, specifying consumables, shortening reaction procedures, enhancing reagent performance, etc. How to shorten the time for MP nucleic acid detection on a commonly used instrument platform in the market (such as based on existing fluorescence quantitative PCR instruments) without changing the instrument hardware parameters, consumables, and reaction reagents has become an urgent issue to be solved. Summary of the Invention

[0007] In a first aspect, the present invention provides a rapid detection kit for detecting Mycoplasma pneumoniae and the drug-resistant gene A2063G, characterized in that the kit includes: an upstream primer for Mycoplasma pneumoniae, the nucleotide sequence of which is as shown in SEQ ID NO:1; a downstream primer for Mycoplasma pneumoniae, the nucleotide sequence of which is as shown in SEQ ID NO:3; a probe for detecting Mycoplasma pneumoniae, the nucleotide sequence of which is as shown in SEQ ID NO:2;

[0008] an upstream primer for the drug-resistant mutant gene at the 23S rRNA A2063G locus of Mycoplasma pneumoniae, the nucleotide sequence of which is as shown in SEQ ID NO:4; a downstream primer for the drug-resistant mutant gene at the 23S rRNA A2063G locus of Mycoplasma pneumoniae, the nucleotide sequence of which is as shown in SEQ ID NO:6; a probe for detecting the drug-resistant mutant gene at the 23S rRNA A2063G locus of Mycoplasma pneumoniae, the nucleotide sequence of which is as shown in SEQ ID NO:5.

[0009] In some embodiments, the kit further includes: a human endogenous reference upstream primer, the nucleotide sequence of which is as shown in SEQ ID NO:7; a human endogenous reference downstream primer, the nucleotide sequence of which is as shown in SEQ ID NO:9; a human endogenous reference probe, the nucleotide sequence of which is as shown in SEQ ID NO:8.

[0010] In some embodiments, the 5' end of the probe sequence is labeled with a fluorescent group, and the fluorescent group includes VIC, FAM, ROX or CY5. In some embodiments, the fluorescent groups of each probe sequence should be different from each other and do not interfere with each other, that is, the fluorescent group used for each probe sequence is different and will not affect the detection of each other, that is, detection can be carried out using different channels. In some embodiments, the 3' end of the probe sequence is labeled with a quenching group, and the quenching group includes BHQ1, BHQ3 or MGB. In some embodiments, the 3' end of the probe sequence is labeled with MGB.

[0011] The kit provided by the present invention is based on the Taqman probe method and real-time fluorescence quantitative PCR technology. Using the conserved sequence of Mycoplasma pneumoniae as the target gene, specific primers and probes are designed. Fluorescent groups and fluorescence quenching groups are respectively labeled at both ends of the Taqman probe. Specifically, in PCR, Taq enzyme cuts the probe to separate the fluorescent group, making its fluorescence not quenched. After each cycle, a fluorescence intensity signal is collected, and then the change in the amount of the product is monitored through the change in fluorescence intensity, thereby obtaining a fluorescence amplification curve. When the fluorescence signal of the amplified product reaches the set fluorescence threshold, the Ct (Cycle Threshold) can be obtained, and the Ct value is the corresponding cycle number. Through the obtained Ct value and amplification curve, the presence or absence of the detected pathogenic bacteria and drug-resistant genes can be determined.

[0012] In some embodiments, in the kit provided by the present invention, the primer-probe designed for the MP conserved gene P1 gene (i.e., the probe for detecting Mycoplasma pneumoniae) is labeled with FAM, the primer-probe designed for the 23S rRNA gene mutation site A2063G (i.e., the probe for detecting the drug-resistant mutation gene at the 23S rRNA A2063G site of Mycoplasma pneumoniae) is labeled with VIC, and the primer-probe designed for the human reference gene GAPDH (i.e., the human reference probe) is labeled with CY5, which is used to monitor processes such as sample collection, nucleic acid extraction, and PCR amplification, thereby reducing the probability of false negative results.

[0013] In some embodiments, the 5th, 9th, and 12th bases of the probe for detecting the drug-resistant mutation gene at the 23S rRNA A2063G site of Mycoplasma pneumoniae (SEQ ID NO: 5) are modified with locked nucleic acid.

[0014] In some embodiments, the probe for detecting the drug-resistant mutation gene at the 23S rRNA A2063G site of Mycoplasma pneumoniae (SEQ ID NO: 5) is modified with MGB. Through experimental verification, the above modification of the probe for detecting the drug-resistant mutation gene at the 23S rRNA A2063G site of Mycoplasma pneumoniae in the present invention raises its annealing temperature to 70 °C or above. It should be noted that introducing locked nucleic acid at any site does not necessarily increase the annealing temperature. Through the design and exploration in the present invention, it is experimentally found that adding locked nucleic acid at the middle base positions (such as the 5th, 9th, and 12th bases of SEQ ID NO: 5 in the present invention) has a better effect on raising the annealing temperature than other positions. The primer sequences and probe sequences in the kit provided by the present invention generally have a relatively high annealing temperature (i.e., about 70 °C), and can ensure that both the sensitivity and specificity of the PCR reaction are maintained at a relatively high level.

[0015] In some embodiments, the kit is based on the following PCR amplification program (rapid amplification program): the PCR amplification includes a first amplification stage and a second amplification stage, the amplification conditions of the first stage include a denaturation temperature of 90-99°C, an annealing temperature of 55-65°C, and a number of cycles of 3-15 in each cycle; the amplification conditions of the second amplification stage include a denaturation temperature of at least 85°C, an annealing temperature of 66-82°C, and a number of cycles of 15-50 in each cycle.

[0016] The rapid amplification program corresponding to the kit provided by the present invention is different from the conventional program in that the cycle step is performed in two rounds, the first round uses a conventional annealing temperature, and the second round uses an annealing temperature of about 70° C. Under the rapid amplification program of the present invention, the higher annealing temperature shortens the heating and cooling time of annealing / extension and denaturation, thereby shortening the actual PCR amplification time, and the actual PCR amplification time required (e.g., 29 minutes) is much lower than that of the existing kit (e.g., 67 minutes).

[0017] It is still necessary to emphasize that, although the actual detection time of the kit provided by the present invention is significantly shortened compared with the kit of the prior art (for example, only about 24-35min is required), the sensitivity, specificity and repeatability that can be achieved by the kit provided by the present invention have not decreased. It is particularly noted that the kit provided by the present invention even improves the specificity of the probe, and the higher annealing temperature makes the probe of the present invention have a lower tolerance for mismatches. For example, at a high annealing temperature, the probe for detecting the drug-resistant mutant gene at the 23S rRNA A2063G site of Mycoplasma pneumoniae completely binds to the mutant template, but due to a difference in one base, it cannot bind to the wild template. In other words, the probe of the present invention is conducive to achieving a better distinction between single-base mutations, and thus achieving a better detection of the A2063G mutant gene, overcoming the problem that conventional probes are difficult to distinguish between mutant Mycoplasma pneumoniae and wild-type Mycoplasma pneumoniae.

[0018] Based on this, in conjunction with the corresponding PCR amplification procedure, the kit provided by the present invention can actually achieve specific, accurate, sensitive and rapid qualitative detection of Mycoplasma pneumoniae and the drug resistance gene A2063G in only about 24-35 minutes. In addition, the standard curve method (see Figure 9 , qRT-PCR includes three stages: fluorescence background signal stage, fluorescence signal exponential amplification stage and plateau stage. In the fluorescence signal exponential amplification stage, there is a linear relationship between the logarithm of the PCR product amount and the starting template amount), thus realizing the quantitative detection of Mycoplasma pneumoniae.

[0019] In summary, the kit provided by the present invention can not only accurately and sensitively qualitatively detect Mycoplasma pneumoniae and Mycoplasma pneumoniae drug resistance genes at the early stage of the disease, but also quantitatively detect Mycoplasma pneumoniae. It is precisely because the kit provided by the present invention can quantitatively detect Mycoplasma pneumoniae that clinicians can, based on the quantitative detection results of Mycoplasma pneumoniae DNA of the kit provided by the present invention, combined with the clinical symptoms of the patient, distinguish the infection period and recovery period of the patient (especially children), and further help to achieve a more accurate and objective assessment of the patient's disease development and medication plan.

[0020] In some embodiments, the kit further comprises: DNA polymerase, UDG enzyme.

[0021] In some embodiments, the kit further comprises: a positive control product, and the positive control product comprises a plasmid containing the target fragment of the drug resistance mutation gene at the 23S rRNA A2063G locus of Mycoplasma pneumoniae.

[0022] In some embodiments, the kit further comprises: a positive reference product, and the positive reference product comprises plasmids containing the target fragment of Mycoplasma pneumoniae with concentrations of 1×10 7 copies / mL, 1×10 6 copies / mL, 1×10 5 copies / mL, 1×10 4 copies / mL and 1×10 3 copies / mL.

[0023] In some embodiments, the kit further comprises: a negative control product, and the negative control product comprises a plasmid containing the target fragment of the internal reference gene.

[0024] In a second aspect, the present invention also provides a method for detecting Mycoplasma pneumoniae for non-diagnostic purposes, which is characterized by comprising extracting nucleic acid from a sample; using the above kit to perform PCR amplification with the nucleic acid as a template; and analyzing the PCR amplification result.

[0025] In some embodiments, the PCR amplification comprises a first amplification stage and a second amplification stage. The amplification conditions of the first stage include a denaturation temperature of 90-99°C, an annealing temperature of 55-65°C, and a cycle number of 3-15 in each cycle; the amplification conditions of the second amplification stage include a denaturation temperature of at least 85°C, an annealing temperature of 66-82°C, and a cycle number of 15-50 in each cycle.

[0026] In some embodiments, the specific conditions for the PCR amplification include: the first amplification condition includes 92 - 95°C for 1 - 10 s, 56 - 62°C for 10 - 15 s, for 3 - 10 cycles; the second amplification condition includes 92 - 95°C for 1 - 10 s, 68 - 72°C for 10 - 15 s, for 35 - 45 cycles.

[0027] When the nucleic acid concentration in the sample is relatively high and / or there are more stringent requirements for the detection speed, the specific conditions for the PCR amplification can be set as follows: the first amplification condition includes 92°C for 1 s, 62°C for 10 s, for 3 cycles; the second amplification condition includes 92°C for 1 s, 72°C for 10 s, for 35 cycles. After testing, under the above condition settings, the kit provided by the present invention actually only needs 24 min (including the steps of UDG enzyme and DNA polymerase activation, the UDG enzyme and DNA polymerase activation are set at 50°C for 2 min and 98°C for 30 s, using the Bioer Technology 96C PCR instrument) to achieve rapid and accurate detection of Mycoplasma pneumoniae and Mycoplasma pneumoniae drug resistance genes.

[0028] In some embodiments, the specific conditions for the fluorescence quantitative PCR can be set as follows: the first amplification condition includes 92°C for 1 s, 60°C for 10 s, for 5 cycles; the second amplification condition includes 92°C for 1 s, 70°C for 10 s, for 40 cycles. After testing, under the above condition settings, the kit provided by the present invention actually only needs 29 min (including the steps of UDG enzyme and DNA polymerase, the UDG enzyme and DNA polymerase activation are set at 50°C for 2 min and 98°C for 30 s, using the Bioer Technology 96C PCR instrument) to achieve rapid and accurate detection of Mycoplasma pneumoniae and Mycoplasma pneumoniae drug resistance genes.

[0029] In some embodiments, the PCR amplification further includes the steps of UDG enzyme reaction and DNA polymerase activation, and the conditions for the UDG enzyme reaction and DNA polymerase activation include 50°C for 2 min and 98°C for 30 s.

[0030] In some embodiments, the actual detection time of the kit provided by the present invention includes 24 - 35 min. Those skilled in the art should understand that the specific conditions for the PCR amplification can be adjusted according to the actual detection requirements and actual detection scenarios (for example, by extending the denaturation / annealing time, etc.).

[0031] In some embodiments, when amplification curves appear simultaneously in the FAM, VIC, and CY5 channels and the Ct value of the amplification curve ≤ 39, it indicates that the sample contains Mycoplasma pneumoniae nucleic acid and the 23S rRNA A2063G drug-resistant gene, and the sample is evaluated as a positive result for Mycoplasma pneumoniae and the 23S rRNA A2063G drug-resistant gene; when amplification curves appear in the FAM and CY5 channels and the Ct value of the amplification curve ≤ 39, and there is no amplification curve or the Ct value > 39 in the VIC channel, it indicates that the sample contains Mycoplasma pneumoniae and the 23S rRNA A2063G drug-resistant mutant gene is negative, and the sample is evaluated as a positive result for Mycoplasma pneumoniae and a negative result for the 23S rRNA A2063G drug-resistant gene; when there is no amplification curve or the Ct value > 39 in the FAM and VIC measurement channels and the Ct value of the CY5 detection channel ≤ 39, it indicates that the corresponding nucleic acid is not detected in the sample, and the sample is evaluated as a negative result. When there is no amplification curve or the Ct value > 39 in the CY5 detection channel, re-sampling is required.

[0032] In summary, the kit provided by the present invention has a shorter actual amplification time, better detection effects (including quantitative detection and qualitative detection), can provide more accurate and more valuable detection results for clinicians, and can be completed under general instruments on the market, with better general applicability and a wider application range. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts do not necessarily draw according to the actual ratio. Obviously, the following-described drawings are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0034] Figure 1 It is a schematic diagram of the first amplification stage and the second amplification stage of the present invention;

[0035] Figure 2 It is a schematic diagram of the structure of the primer of the present invention;

[0036] Figure 3 It is an amplification curve of the Mycoplasma pneumoniae sensitivity experiment (the lowest detection limit);

[0037] Figure 4 It is an amplification curve of the Mycoplasma pneumoniae sensitivity experiment (the lowest detection limit) with drug resistance mutation at the 23S rRNA A2063G locus;

[0038] Figure 5 It is an amplification diagram of the Mycoplasma pneumoniae repeatability experiment;

[0039] Figure 6 Amplification diagram of the repetitive experiment (high concentration) of Mycoplasma pneumoniae with drug-resistant mutation at the 23S rRNA A2063G locus;

[0040] Figure 7 Amplification diagram of the repetitive experiment (medium concentration) of Mycoplasma pneumoniae with drug-resistant mutation at the 23S rRNA A2063G locus;

[0041] Figure 8 Amplification diagram of the repetitive experiment (low concentration) of Mycoplasma pneumoniae with drug-resistant mutation at the 23S rRNA A2063G locus;

[0042] Figure 9 Standard curve for clinical sample detection;

[0043] Figure 10 Digital PCR result of clinical sample S001;

[0044] Figure 11 Digital PCR result of clinical sample S002;

[0045] Figure 12 Digital PCR result of clinical sample S003. Detailed implementation manners

[0046] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Apparently, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0047] As used herein, "and / or" includes any and all combinations of one or more of the listed related items.

[0048] As used herein, "a plurality of" means two or more, that is, it includes two, three, four, five, etc.

[0049] It should be noted that, as used herein, the term "comprises", "comprising" or any other variation thereof is intended to cover a non-exclusive inclusion, such that a process, method, article or apparatus comprising a series of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article or apparatus. Without further limitation, an element defined by the phrase "comprising a..." does not exclude the existence of additional identical elements in the process, method, article or apparatus comprising such element.

[0050] As used in this specification, the term "about" typically means + / - 5% of the stated value, more typically + / - 4% of the stated value, more typically + / - 3% of the stated value, more typically + / - 2% of the stated value, even more typically + / - 1% of the stated value, and even more typically + / - 0.5% of the stated value.

[0051] In this specification, certain embodiments may be disclosed in a format that is within a certain range. It should be understood that this description of "within a certain range" is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Thus, the description of a range should be considered to have specifically disclosed all possible sub-ranges and individual numerical values within that range. For example, the description of the range 1 - 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as the individual numbers within that range, such as 1, 2, 3, 4, 5, and 6. The above rules apply regardless of the breadth of the range.

[0052] Example 1

[0053] 1. The kit of the present invention is composed as follows:

[0054] 2. Reagent detection process

[0055] 1) Nucleic acid extraction: Nucleic acid extraction is performed on the sample to be tested, and a conventional commercial kit can be used for nucleic acid extraction.

[0056] 2) Preparation of PCR amplification reagents, and the amplification system is prepared as follows: Reaction solution A Reaction solution B 17 μL 3 μL

[0057] The present invention has no restrictive requirements for the amplification enzyme mix and buffer, and Taq enzyme can be selected according to the actual situation (such as Taq enzyme from companies like Finney Biotechnology Co., Ltd., Nanjing Novoprotein Scientific Co., Ltd., etc.).

[0058] 3. PCR amplification

[0059] The present invention has no restrictive requirements for the real-time fluorescence quantitative PCR instrument, and a suitable PCR instrument can be selected according to the actual situation, such as ABI 7500, ABI Q5, Hongshi SLAN, Anyu Technology AGS, Tianlong Technology Gentier 96E, Bori Technology 96C, etc.

[0060] The PCR amplification experiment of the present invention is divided into two rounds of amplification (after the UDG reaction and pre-denaturation steps are completed), see Figure 1 . See the primer design structure diagramFigure 2 。

[0061] 1) First-round amplification (first amplification stage): Amplification of the template-binding sequence (forward primer / reverse primer), with an annealing temperature generally of about 60 °C. Generally, 3 - 15 cycles are used in this stage, and fluorescence is not collected.

[0062] 2) Second-round amplification (second amplification stage): Amplification with full-length primers (adapter sequence + forward primer / reverse primer), with an annealing temperature generally of about 70 °C. Generally, 15 - 50 cycles are used in this stage, and fluorescence is collected.

[0063] 4. Result analysis

[0064] After the reaction ends, the results are automatically saved. Adjust the Start value, End value, and Threshold value of Baseline according to the analyzed image (users can adjust according to the actual situation. The Start value can be between 3 and 15, the End value can be set between 5 and 20, and set the Value of Threshold in the Log spectrum window so that the threshold line is located in the exponential phase of the amplification curve. The amplification curve of the negative control product is flat or below the threshold line), and click analysis to automatically obtain the analysis results.

[0065] Example 2

[0066] 1. Primer information

[0067] According to the primer and probe sequences described in CN106191239A (shown in Table 1 below), the PCR amplification conditions (shown in Table 6 below), and the corresponding experimental parameters mentioned, the actual amplification time on the Bioer Technology 96C PCR instrument is approximately 67 minutes.

[0068] Table 1: Conventional primers Primer number Primer sequence (5' to 3') P-P1-F TAAGTTCGTTGGTAGGGAAC (SEQ ID NO:13) T-P1 FAM-ATGGGTGATACCGCT-MGB (SEQ ID NO:14) P-P1-R CAACCTGAACTTAGTAGCGCAA (SEQ ID NO:15) P-23S-F ATCCAGGTACGGGTGAAGAC (SEQ ID NO:16) T-2063(A / G) FAM-CGGGACGGGAAGAC-MGB (SEQ ID NO:17) P-23S-R CGCATCAACAAGTCCTAGCGAA (SEQ ID NO:18) P-int-F CCACACGACTCTCGGCAAC (SEQ ID NO:19) T-int VIC-CTCGGCTCTCGCATC-MGB (SEQ ID NO:20) P-int-R TCGATGGTTCACGGGATTCT (SEQ ID NO:21)

[0069] The present invention designs rapid primers for Mycoplasma pneumoniae and Mycoplasma pneumoniae with drug-resistant mutations at the 23S rRNA A2063G locus gene (shown in Table 2), where the primers are partially paired with the template.

[0070] Table 2: Rapid primers Primer number Primer sequence (5' to 3') Tm (°C) MP-F1 <![CDATA CGC CTGTACGATGCGCCTTATGC(SEQ ID NO:1)]]> 71 MP-P1 FAM-CGCGTTGATCACTTGGATCCCAAGG-MGB (SEQ ID NO:2) 72 MP-R1 <![CDATA CTCCC TCACTTGGGCGTTCTTCAACT(SEQ ID NO:3)]]> 70 MP-F2 <![CDATA CCC GTGTAACCATCTCTTGACTGTCTCG(SEQ ID NO:4)]]> 70 MP-2063P2 VIC-CGGGACGGGAAGACC-MGB (SEQ ID NO:5) <![CDATA[53 a > MP-R2 <![CDATA AGGCTG TACCTATTCTCTACATGATAATGTCCTGA(SEQ ID NO:6)]]> 70 GAPDH-F <![CDATA GCT GCCACATCGCTCAGACACCAT(SEQ ID NO:7)]]> 70 GAPDH-P CY5-AGGTGAAGGTCGGAGTCAACGGGTG-MGB (SEQ ID NO:8) 70 GAPDH-R <![CDATA TGCGT AGGCTCGTAGACGCGGTTC(SEQ ID NO:9)]]> 70 Note: The underlined sequence is the adapter sequence; the bold italicized bases are locked nucleic acid modified bases (i.e., the 5th, 9th, and 12th bases shown in SEQ ID NO:5). a: The theoretical Tm value of the MP-2063P2 probe of the present invention after being modified with locked nucleic acid and MGB can reach 70 °C or above.

[0071] The target sequences of the above rapid primers are shown in Table 3 below.

[0072] Table 3

[0073] 2. Nucleic acid extraction

[0074] The Mycoplasma pneumoniae culture was serially diluted with human normal sputum (after liquefaction), and nucleic acid extraction was performed with two replicates for each dilution.

[0075] 3. PCR amplification system

[0076] The extracted nucleic acid was used to prepare the reaction system as follows:

[0077] 1) The PCR amplification system with conventional primers was configured according to the system disclosed in CN106191239A.

[0078] 2) The PCR amplification system corresponding to the rapid program with rapid primers is shown in Table 4 below.

[0079] Table 4

[0080] 4. PCR amplification program

[0081] 1) The conventional program was set according to the PCR amplification program disclosed in CN106191239A (as shown in Table 5).

[0082] Table 5

[0083] 2) The rapid program of the present invention is shown in Table 6.

[0084] Table 6

[0085] After actual testing, the actual amplification time of the PCR amplification program disclosed in CN106191239A was 67 minutes, while the kit provided by the present invention (using the amplification program in Table 6) only required 29 minutes.

[0086] Example 3

[0087] Sensitivity detection

[0088] The Mycoplasma pneumoniae culture (without 23S rRNA A2063G drug resistance mutation) and the Mycoplasma pneumoniae culture containing the 23S rRNA A2063G site drug resistance mutation gene were diluted to 500 copies / mL, and 20 replicates were performed using the kit provided by the present invention respectively. The results are shown in Figure 3 、 Figure 4 and Table 7. Figure 3The amplification curve of Mycoplasma pneumoniae is shown, and the drug-resistant gene A2063G is negative. Figure 4 The green amplification curve in it is the amplification curve of the target gene of Mycoplasma pneumoniae, and the orange amplification curve is the amplification curve of the drug-resistant gene A2063G. The Ct values of its 20 repeated detections are shown in Table 7. The above results indicate that the kit provided by the present invention can detect Mycoplasma pneumoniae and the drug-resistant gene A2063G, and it can be determined that the sensitivity of the kit provided by the present invention is not less than 500 copies / mL.

[0089] Table 7 Statistics of Ct values of 20 repeated detections in the sensitivity experiment

[0090] Example 4

[0091] Specific detection

[0092] The pathogens in the cross-reaction experiment are respiratory syncytial virus, parainfluenza virus, adenovirus, influenza A virus, influenza B virus, measles virus, human cytomegalovirus, herpes simplex virus, Streptococcus pneumoniae, Staphylococcus aureus, Klebsiella pneumoniae, Haemophilus influenzae, Pseudomonas aeruginosa, Escherichia coli, Mycobacterium tuberculosis, Streptococcus salivarius, Streptococcus pyogenes, Bordetella pertussis. Nucleic acid extraction and amplification were performed on the above pathogen cultures / samples. The results are shown in Table 8. Using the kit provided by the present invention to detect the above pathogens, no cross-reaction occurred.

[0093] Table 8

[0094] Example 5

[0095] Repeatability detection

[0096] Cultures of Mycoplasma pneumoniae without the 23S rRNA A2063G drug-resistant mutation were set at high, medium, and low concentrations for verification respectively. The low concentration was near the lowest detection limit. Each concentration was repeatedly detected 20 times, and the calculated CV was <5%. The results are shown in Table 9 and Figure 5 as shown. Figure 5 Among them, there are 60 amplification curves from left to right. The closest 20 are the amplification curves of samples of the same concentration. The high, medium, and low concentrations corresponding to the amplification curves are 1×10 7 copies / mL, 1×10 5 copies / mL, 1×10 3 copies / mL. The above results indicate that the kit provided by the present invention has good repeatability.

[0097] Table 9

[0098] Mycoplasma pneumoniae cultures containing the 23S rRNA A2063G drug-resistant mutation were verified with high, medium, and low concentration samples respectively. The low concentration was near the lowest detection limit, and each concentration was detected 20 times repeatedly. The calculated CV was <5%. The results are shown in Table 10 and Figures 6 - 8 as follows ( Figures 6 - 8 In it, the green amplification curve is the amplification curve of the target gene of Mycoplasma pneumoniae, and the orange amplification curve is the amplification curve of the drug-resistant gene A2063G). Figure 6 is a high-concentration Mycoplasma pneumoniae sample with a 23S rRNA A2063G site gene drug-resistant mutation, and the concentration is 5×10 7 copies / mL; Figure 7 is a medium-concentration Mycoplasma pneumoniae sample with a 23S rRNA A2063G site gene drug-resistant mutation, and the concentration is 5×10 5 copies / mL; Figure 8 is a low-concentration Mycoplasma pneumoniae sample with a 23S rRNA A2063G site gene drug-resistant mutation, and the concentration is 5×10 3 copies / mL. The above results indicate that the kit provided by the present invention has good repeatability.

[0099] Table 10

[0100] Example Six

[0101] Clinical Sample Detection

[0102] According to the above test results, when amplification curves appear simultaneously in the FAM, VIC, and CY5 channels and the Ct value of the amplification curve ≤ 39, it indicates that the sample contains Mycoplasma pneumoniae nucleic acid and the 23S rRNA A2063G drug-resistant gene, and the sample is evaluated as a positive result for Mycoplasma pneumoniae and the 23S rRNA A2063G drug-resistant gene; when amplification curves appear in the FAM and CY5 channels and the Ct value of the amplification curve ≤ 39, and there is no amplification curve or the Ct value > 39 in the VIC channel, it indicates that the sample contains Mycoplasma pneumoniae and the 23S rRNA A2063G drug-resistant mutant gene is negative, and the sample is evaluated as a positive result for Mycoplasma pneumoniae and a negative result for the 23S rRNA A2063G drug-resistant gene; when there is no amplification curve or the Ct value > 39 in the FAM and VIC measurement channels and the Ct value of the CY5 detection channel ≤ 39, it indicates that the corresponding nucleic acid is not detected in the sample, and the sample is evaluated as a negative result. When there is no amplification curve or the Ct value > 39 in the CY5 detection channel, re-sampling is required.

[0103] Further, according to the above test results, the clinical sample detection standard curve for Mycoplasma pneumoniae is as Figure 9 shown.

[0104] The nucleic acids of 6 clinical samples were detected using the kit provided by the present invention, and Mycoplasma pneumoniae was quantified based on the above standard curve. The results are shown in Table 11 below and Figures 10 - 12 shown. Figure 10 shows the result of performing digital PCR detection of Mycoplasma pneumoniae on sample S001 after diluting it 10-fold. The abscissa represents the number of generated droplets, the ordinate represents the detected Mycoplasma pneumoniae DNA signal value, and the pink dots represent the droplets that detected the Mycoplasma pneumoniae signal. Figure 11 shows the result of performing digital PCR detection of Mycoplasma pneumoniae on sample S002 after diluting it 10-fold. The abscissa represents the number of generated droplets, the ordinate represents the detected Mycoplasma pneumoniae DNA signal value, and the pink dots represent the droplets that detected the Mycoplasma pneumoniae signal. Figure 12 shows the result of performing digital PCR detection of Mycoplasma pneumoniae on sample S003 after diluting it 10-fold. The abscissa represents the number of generated droplets, the ordinate represents the detected Mycoplasma pneumoniae DNA signal value, and the pink dots represent the droplets that detected the Mycoplasma pneumoniae signal.

[0105] Table 11

[0106] The embodiments of the present invention have been described above in conjunction with the accompanying drawings. However, the present invention is not limited to the above specific embodiments. The above specific embodiments are merely illustrative and not restrictive. Under the inspiration of the present invention, those of ordinary skill in the art can also make many forms without departing from the spirit of the present invention and the scope protected by the claims. All of these fall within the protection scope of the present invention.

Claims

1. A rapid detection kit for detecting Mycoplasma pneumoniae and drug-resistant genes, characterized in that, The kit includes: an upstream primer for Mycoplasma pneumoniae, the nucleotide sequence of which is shown in SEQ ID NO: 1; a downstream primer for Mycoplasma pneumoniae, the nucleotide sequence of which is shown in SEQ ID NO: 3; a probe for detecting Mycoplasma pneumoniae, the nucleotide sequence of which is shown in SEQ ID NO: 2; an upstream primer for the drug-resistant mutation gene at the A2063G site of Mycoplasma pneumoniae 23S rRNA, the nucleotide sequence of which is shown in SEQ ID NO: 4; a downstream primer for the drug-resistant mutation gene at the A2063G site of Mycoplasma pneumoniae 23S rRNA, the nucleotide sequence of which is shown in SEQ ID NO: 6; a probe for detecting the drug-resistant mutation gene at the A2063G site of Mycoplasma pneumoniae 23S rRNA, the nucleotide sequence of which is shown in SEQ ID NO:

5.

2. The kit according to claim 1, characterized in that The kit further includes: an upstream primer for human endogenous reference, the nucleotide sequence of which is shown in SEQ ID NO: 7; a downstream primer for human endogenous reference, the nucleotide sequence of which is shown in SEQ ID NO: 9; a probe for human endogenous reference, the nucleotide sequence of which is shown in SEQ ID NO:

8.

3. The kit according to claim 1, characterized in that, The kit further includes: DNA polymerase and UDG enzyme.

4. The kit according to claim 1, characterized in that, The kit further includes: a positive control product, which includes a plasmid containing the target fragments of Mycoplasma pneumoniae and the drug-resistant mutation gene at the A2063G site of Mycoplasma pneumoniae 23S rRNA.

5. The kit according to claim 1, wherein, The kit further includes: a positive reference product, which includes plasmids containing Mycoplasma pneumoniae target fragments with concentrations of 1×10 7 copies / mL, 1×10 6 copies / mL, 1×10 5 copies / mL, 1×10 4 copies / mL, and 1×10 3 copies / mL respectively.

6. The kit according to claim 1, wherein The 5th, 9th, and 12th bases of the probe for detecting the drug-resistant mutation gene at the A2063G site of Mycoplasma pneumoniae 23S rRNA are modified with locked nucleic acids.

7. A detection method for Mycoplasma pneumoniae for non-diagnostic purposes, characterized in that, It includes extracting nucleic acids from a sample; using the nucleic acids as a template and performing PCR amplification with the kit according to any one of claims 1-6; and analyzing the PCR amplification results.

8. The method according to claim 7, wherein The PCR amplification includes a first amplification stage and a second amplification stage. The first amplification conditions of the first amplification stage include that the denaturation temperature in each cycle is 90-99°C, the annealing temperature is 55-65°C, and the number of cycles is 3-15; the second amplification conditions of the second amplification stage include that the denaturation temperature in each cycle is at least 85°C, the annealing temperature is 66-82°C, and the number of cycles is 15-50.

9. The method according to claim 8, characterized in that, The specific conditions of the PCR amplification include: the first amplification conditions include 92-95°C for 1-10 s, 56-62°C for 10-15 s, and 3-10 cycles; the second amplification conditions include 92-95°C for 1-10 s, 68-72°C for 10-15 s, and 35-45 cycles.

10. The method according to claim 8, wherein The PCR amplification further includes steps of UDG enzyme reaction and DNA polymerase activation, and the conditions for the UDG enzyme reaction and DNA polymerase are 50°C for 2 min and 98°C for 30 s.

Images