Expression of regenerative factors in aging / senescence cells
By expressing polynucleotides of Oct4, Sox2 and Klf4 proteins in senescent cells, the growth arrest and DNA damage of senescent cells are solved, and the regeneration of cells and the extension of healthy life span is achieved.
Patent Information
- Application Number
- CN202380080187.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-04-03
- Filing Date
- 2023-09-28
- Publication Date
- 2025-06-27
AI Technical Summary
The prior art is difficult to effectively solve the permanent growth arrest and chronic DNA damage signals of senescent cells, leading to the emergence of aging-related secretory phenotype (SASP), affecting the tissue microenvironment and stem cell function.
Polynucleotides containing senescent cells specific promoters are provided to achieve reprogramming of senescent cells by ligation to nucleic acid sequences encoding Oct4, Sox2 and Klf4 proteins, inhibit SASP activity and promote cell regeneration.
By reprogramming senescent cells, the health and lifespan of mice is significantly improved, the inflammatory response is reduced, stem cell function is enhanced, the lifespan of organisms is extended, and the risk of age-related disease is reduced.
Smart Images

Figure BDA0005408829680000701 
Figure BDA0005408829680000711 
Figure BDA0005408829680000721
Abstract
Description
[0001] Cross - Reference to Related Applications
[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 377,509, filed on September 28, 2022, and U.S. Provisional Application No. 63 / 493,913, filed on April 3, 2023, which are hereby incorporated by reference in their entirety.
[0003] Reference to a Sequence Listing Submitted Electronically
[0004] The content of the sequence listing submitted electronically in the ASCII text file (name: 4967_020PC02_SequenceListing_ST26.xml; size: 98,303 bytes; and creation date: August 31, 2023) is hereby incorporated by reference in its entirety. Background of the Invention
[0005] Aging is a complex process associated with genomic and epigenomic alterations. Mouse genetics studies have shown that disruption of genes involved in genomic maintenance can lead to a shortened lifespan, while genetic or pharmacological interventions in, for example, the insulin signaling pathway in multiple mouse models can extend lifespan (Folgueras, A.R., Freitas - Rodriguez, S., Velasco, G. & Lopez - Otin, C. Mouse Models to Disentangle the Hallmarks of Human Aging. Circ Res 123, 905 - 924, 2018; Grunewald, M. et al. Counteracting age - related VEGF signaling insufficiency promotes healthy aging and extends life span. Science 373, 2021). Other methods, including caloric restriction and heterochronic parabiosis, have shown potential for improving the healthspan of mice and monkeys (Harrison, D.E. et al. Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. Nature 460, 392 - 395, 2009; Colman, R.J. et al. Caloric restriction delays disease onset and mortality in rhesus monkeys. Science 325, 201 - 204, 2009).
[0006] In addition to the permanent growth arrest phenotype of senescent cells, chronic DNA damage signaling can also drive the expression and secretion of multiple cytokines, chemokines, growth factors, and proteases; these features are collectively referred to as the senescence-associated secretory phenotype (SASP), which has a harmful effect on the tissue microenvironment. (Coppe, J.P., Desprez, P.Y., Krtolica, A. & Campisi, J. The senescence-associated secretory phenotype: the dark side of tumor suppression. Annu Rev Pathol 5, 99-118, 2010; Kang, C. et al. The DNA damage response induces inflammation and senescence by inhibiting autophagy of GATA4. Science 349, 2015; Gorgoulis, V. et al. Cellular Senescence: Defining a Path Forward. Cell 179, 813-827, 2019; Herranz, N. & Gil, J.M. Mechanisms and functions of cellular senescence. J Clin Invest 128, 1238-1246, 2018). The SASP can also lead to a decline in the functional capacity of stem cells, thereby impairing their role in tissue renewal. (Lopez-Otin, C., Blasco, M.A., Partridge, L., Serrano, M. & Kroemer, G. The hallmarks of aging. Cell 153, 1194-1217, 2013).
[0007] A major limitation in the clinical application of developing therapies aimed at regeneration is the lack of understanding of the appropriate cell type or cell state of the target. In addition, it is not known whether young cells can expand at the expense of old cells, thereby generating a functional regenerative phenotype at the organ and organism levels, without simply depleting the senescent cells of the organ and organism and thus endangering their structural integrity. Summary of the Invention
[0008] The present invention provides a polynucleotide comprising a senescent cell-specific promoter operably linked to a nucleic acid sequence encoding an Oct4 protein, and / or a nucleic acid sequence encoding a Sox2 protein, and / or a nucleic acid sequence encoding a Klf4 protein.
[0009] In some aspects, the senescent cell-specific promoter is the CDKN2A (p16) promoter.
[0010] In some aspects, the polynucleotide comprises at least one p16 promoter operably linked to a nucleic acid sequence encoding an Oct4 protein, and / or a nucleic acid sequence encoding a Sox2 protein, and / or a nucleic acid sequence encoding a Klf4 protein.
[0011] In some aspects, the p16 promoter is operably linked to nucleic acid sequences encoding an Oct4 protein, a Sox2 protein, and a Klf4 protein.
[0012] In some aspects, the p16 promoter is a human or murine p16 promoter.
[0013] In some aspects, the human p16 promoter has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:1.
[0014] In some aspects, the murine p16 promoter has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:2.
[0015] In some aspects, the polynucleotide encodes a human Oct4 protein, and / or a human Sox2 protein, and / or a human Klf4 protein.
[0016] In some aspects, the nucleic acid sequence encoding Oct4 comprises SEQ ID NO:3, the nucleic acid sequence encoding Sox2 comprises SEQ ID NO:4, and the nucleic acid encoding Klf4 comprises SEQ ID NO:5.
[0017] In some aspects, the polynucleotide further comprises at least one woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) sequence and at least one polyadenylation signal sequence.
[0018] In some aspects, at least one polyadenylation signal sequence is an SV40 polyadenylation signal sequence, a human growth hormone polyadenylation signal sequence, or a bovine growth hormone polyadenylation signal sequence.
[0019] In some aspects, the polynucleotide further comprises at least one internal ribosome entry site (IRES).
[0020] In some aspects, the polynucleotide further comprises at least one proteolytic cleavage site.
[0021] In some aspects, at least one proteolytic cleavage site is a self-processing cleavage site or a furin protease cleavage site.
[0022] In some aspects, the self-processing cleavage site is a P2A, E2A, F2A or T2A peptide.
[0023] In some aspects, the furin protease cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO:6.
[0024] In some aspects, the polynucleotide further comprises a second p16 promoter.
[0025] In some aspects, the first and second promoters initiate transcription in the same direction.
[0026] In some aspects, the first and second promoters initiate transcription in different directions.
[0027] In some aspects, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO:10.
[0028] In some aspects, the polynucleotide comprises a p16 promoter operably linked to a nucleic acid sequence encoding a dominant negative nuclear factor κBIA (dnNKκBIA) protein.
[0029] In some aspects, the p16 promoter of the polynucleotide is a human or murine p16 promoter.
[0030] In some aspects, the human p16 promoter of the polynucleotide has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:1.
[0031] In some aspects, the murine p16 promoter of the polynucleotide has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:2.
[0032] In some aspects, the nucleic acid sequence of the polynucleotide encodes a human dnNKκBIA protein.
[0033] In some aspects, the nucleic acid sequence of the polynucleotide encodes a dnNKκBIA protein comprising SEQ ID NO:7.
[0034] In some aspects, the polynucleotide further comprises a WPRE sequence and a polyadenylation signal sequence.
[0035] In some aspects, the polyadenylation signal sequence is the SV40 polyadenylation signal sequence, the human growth hormone polyadenylation signal sequence, or the bovine growth hormone polyadenylation signal sequence.
[0036] In some aspects, the polynucleotide further comprises an IRES.
[0037] In some aspects, the polynucleotide further comprises a proteolytic cleavage site.
[0038] In some aspects, the proteolytic cleavage site is selected from the group consisting of a self-processing cleavage site and a furin cleavage site.
[0039] In some aspects, the self-processing cleavage site is a P2A, E2A, F2A, or T2A peptide.
[0040] In some aspects, the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO:6.
[0041] In some aspects, the polynucleotides described herein further comprise a reporter gene.
[0042] In some aspects, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO:11.
[0043] In some aspects, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO:12.
[0044] In some aspects, a vector comprising the polynucleotides described herein is provided.
[0045] In some aspects, the vector is a viral vector, a non-viral vector, or a polymer.
[0046] In some aspects, the viral vector is an adeno-associated virus (AAV) vector, an adenovirus vector, a lentivirus vector, or a retrovirus vector.
[0047] In some aspects, the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVRH8, AAVrh9, AAV9, AAVrh10, AAV10, AAVRH10, AAV11, AAV12, or AAV-DJ vector.
[0048] In some aspects, the AAV vector is an AAV-DJ vector.
[0049] In some aspects, the non-viral vector is a plasmid.
[0050] In some aspects, the polymer is a cationic polymer comprising a polyethyleneimine (PEI) backbone linked to a lipid or polyethylene glycol (PEG).
[0051] In some aspects, cells are provided that contain a polynucleotide as described herein or a vector as described herein.
[0052] In some aspects, the cells are bacterial cells, insect cells, or animal cells.
[0053] In some aspects, the animal cells are mammalian cells.
[0054] In some aspects, compositions are provided that contain a polynucleotide as described herein or a vector as described herein and a carrier.
[0055] In some aspects, recombinant adeno-associated virus (rAAV) viruses are provided that contain a polynucleotide as described herein and an AAV capsid protein.
[0056] In some aspects, the rAAV contains an AAV-DJ capsid.
[0057] In some aspects, pharmaceutical compositions are provided that contain a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, or an rAAV as described herein, and a pharmaceutically acceptable carrier.
[0058] In some aspects, kits are provided that contain a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, or an rAAV as described herein.
[0059] In some aspects, methods of making rAAV are provided.
[0060] In some aspects, the method includes providing to a cell an adeno-associated virus (AAV) rep gene, an AAV cap gene, a nucleic acid containing a polynucleotide as described herein, a vector as described herein, and at least one AAV serotype 2 inverted terminal repeat.
[0061] In some aspects, the method further includes providing an auxiliary function that results in efficient AAV infection.
[0062] In some aspects, the method further includes allowing assembly of AAV and collection of rAAV.
[0063] In some aspects, the AAV rep gene and the AAV cap gene are provided by a plasmid.
[0064] In some aspects, the AAV rep gene and the AAV cap gene are stably integrated into the genome of the cell.
[0065] In some aspects, the auxiliary function is provided by a plasmid.
[0066] In some aspects, the auxiliary function is provided by an adenovirus vector.
[0067] In some aspects, rAAV produced by the methods described herein is provided.
[0068] In some aspects, methods for reprogramming senescent cells to a non-senescent stage phenotype are provided. In some aspects, the methods include contacting the senescent cells with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to partially reprogram the senescent cells to a non-senescent stage phenotype.
[0069] In some aspects, methods for reprogramming senescent cells in a subject to a non-senescent stage phenotype are provided. In some aspects, the methods include administering to a subject in need thereof a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein, and partially reprogramming the senescent cells of the subject to a non-senescent stage phenotype. In some aspects, the administration is by systemic administration. In some aspects, methods for completely or partially reversing immune senescence in a subject are provided, the methods comprising: administering to a subject in need thereof an amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein effective to completely or partially reverse immune senescence in the subject. In some aspects, the administration is by systemic administration.
[0070] In some aspects, immune senescence is characterized by a reduced homing ability of hematopoietic stem cells (HSCs), and an amount effective to partially or completely reverse immune senescence in a subject is an amount effective to increase the homing ability of HSCs to the level of HSC homing ability found in HSCs of non-senescent subjects.
[0071] In some aspects, immune senescence is characterized by a reduced regenerative self-renewal activity per cell of HSCs, and an amount effective to partially or completely reverse immune senescence in a subject is an amount effective to increase the regenerative self-renewal activity per cell of HSCs to the level of regenerative self-renewal activity per cell of HSCs found in HSCs of non-senescent subjects.
[0072] In some aspects, immune senescence is characterized by a tendency of HSCs to myeloid differentiation, and an amount effective to partially or completely reverse immune senescence in a subject is an amount effective to reduce the tendency of HSCs to myeloid differentiation to the level of tendency to myeloid differentiation found in HSCs of non-senescent subjects.
[0073] In some aspects, immunosenescence is characterized by increased apoptosis of HSCs after a stress stimulus, and the amount that effectively partially or fully reverses immunosenescence in a subject is the amount that effectively reduces apoptosis of HSCs after a stress stimulus to the level of apoptosis after a stress stimulus found in HSCs of non-senescent subjects.
[0074] In some aspects, methods for reducing the number of senescent cells in a subject are provided, the methods comprising: administering to a subject in need thereof a polynucleotide, a vector, a cell, a composition, an rAAV, or a pharmaceutical composition described herein in an amount effective to reduce the number of senescent cells in the subject. In some aspects, the administration is by systemic administration.
[0075] In some aspects, methods for extending the organismal lifespan of a subject are provided, the methods comprising: administering to a subject in need thereof a polynucleotide, a vector, a cell, a composition, an rAAV, or a pharmaceutical composition described herein in an amount effective to extend the organismal lifespan of the subject. In some aspects, the administration is by systemic administration.
[0076] In some aspects, methods for reducing progressive weight loss in a senescent subject are provided, the methods comprising: administering to a senescent subject in need thereof a polynucleotide, a vector, a cell, a composition, an rAAV, or a pharmaceutical composition described herein in an amount effective to reduce progressive weight loss in the senescent subject. In some aspects, the administration is by systemic administration.
[0077] In some aspects, methods for increasing physical fitness in a senescent subject are provided, the methods comprising: administering to a senescent subject in need thereof a polynucleotide, a vector, a cell, a composition, an rAAV, or a pharmaceutical composition described herein in an amount effective to increase physical fitness in the senescent subject. In some aspects, the administration is by systemic administration.
[0078] In some aspects, methods for reducing an inflammatory response in a subject are provided, the methods comprising: administering to a subject in need thereof a polynucleotide, a vector, a cell, a composition, an rAAV, or a pharmaceutical composition described herein in an amount effective to reduce the inflammatory response in the subject.
[0079] In some aspects, methods for reducing replicative senescence in a subject are provided, the methods comprising: administering to a subject in need thereof a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to reduce replicative senescence in the subject. In some aspects, the administration is by systemic administration.
[0080] In some aspects, methods for reducing DNA damage-induced senescence in a subject are provided, the methods comprising: administering to a subject in need thereof a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to reduce DNA damage-induced senescence in the subject. In some aspects, the administration is by systemic administration.
[0081] In some aspects, methods for reducing oncogene-induced senescence in a subject are provided, the methods comprising: administering to a subject in need thereof a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to reduce oncogene-induced senescence in the subject. In some aspects, the administration is by systemic administration.
[0082] In some aspects, methods for inhibiting the activity of the senescence-associated secretory phenotype (SASP) in cells are provided. In some aspects, the methods comprise contacting the cells with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to inhibit the activity of SASP in the cells.
[0083] In some aspects, methods for regenerating senescent cells into a non-senescent stage phenotype are provided. In some aspects, the methods comprise contacting the senescent cells with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein in an amount effective to partially reprogram the senescent cells. In some aspects, the methods further comprise contacting the senescent cells with a polynucleotide described herein or a vector described herein in an amount effective to inhibit the activity of SASP in the senescent cells.
[0084] In some aspects, methods are provided for regenerating senescent cells of a subject into a non-senescent stage phenotype. In some aspects, the methods include administering to a subject in need thereof a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein to partially reprogram senescent cells; and administering to the subject a therapeutically effective amount of a polynucleotide described herein or a vector described herein to inhibit SASP activity. In some aspects, the administration is by systemic administration.
[0085] In some aspects, methods are provided for increasing age-related survival in a subject. In some aspects, the methods include administering to a subject in need thereof a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein and reprogramming senescent cells in the subject, thereby increasing the age-related survival of the subject. In some aspects, the administration is by systemic administration.
[0086] In some aspects, methods are provided for treating cell senescence-related aging in a subject in need thereof. In some aspects, the methods include administering to the subject a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein. In some aspects, the administration is by systemic administration.
[0087] In some aspects, methods are provided for treating Hutchinson-Gilford Progeria Syndrome in a subject in need thereof. In some aspects, the methods include administering to the subject a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein. In some aspects, the administration is by systemic administration.
[0088] In some aspects, the subject is a human.
[0089] In some aspects, the administration induces an increase in the epidermal thickness of the subject, a decrease in the glomerular basement membrane area in the kidney, an increase in the structural arrangement of hepatocytes in the liver, a rescue of lymphocyte depletion in the germinal center of the spleen, a decrease in the level of inflammatory markers, an increase in the number of hematopoietic stem cells, a restoration of bone marrow tissue, and / or an increase in the activation of DNA repair pathways.
[0090] In some aspects, the decrease in the level of inflammatory markers includes a decrease in neutrophil invasion in the liver and a decrease in inflammatory features in the spleen.
[0091] In some aspects, provided are methods of treatment, the methods comprising contacting a cell with an amount of a polynucleotide, a vector, a cell, a composition, an rAAV, or a pharmaceutical composition as described herein effective to reprogram the cell. In some embodiments, the methods further comprise administering the cell to a subject in need of partial reprogramming of the cell. In some aspects, the cell is a fibroblast. In some aspects, the fibroblast is a mammalian fibroblast. In some aspects, the fibroblast is a human fibroblast.
[0092] In some aspects, provided is the use of a polynucleotide, a vector, a cell, a composition, an rAAV, or a pharmaceutical composition as described herein for treating aging associated with cellular senescence.
[0093] In some aspects, provided is the use of a polynucleotide, a vector, a cell, a composition, an rAAV, or a pharmaceutical composition as described herein in the manufacture of a medicament for treating aging associated with cellular senescence.
[0094] In some aspects, provided is an article of manufacture comprising a polynucleotide, a vector, a cell, a composition, an rAAV, or a pharmaceutical composition as described herein. BRIEF DESCRIPTION OF THE DRAWINGS
[0095] Figures 1A - 1H . Senescent cell-specific reprogramming improves the health and lifespan of LAKI - / - mice. Figure 1A : Schematic of constructs expressing mOct4, mSox2, mKlf4 (OSK) or human dominant-negative NFκBIA and GFP. All constructs are in an AAV plasmid backbone. Figure 1B : Schematic of a mouse experiment evaluating the effects of CDKN2A promoter-OSK and CDKN2A promoter-NFKBIA expression on the health and lifespan of mice. Figure 1C : Survival curves of LAKI - / - mice injected with control CAG-GFP (green line), m-CDKN2A promoter-OSK (blue line) or m-CDKN2A promoter-NFκBIA (dn) (red line) AAV DJ particles compared to untreated mice (grey line). (GFP, n = 15; m-CDKN2A promoter-OSK n = 18; m-CDKN2A promoter-NFκBIA (dn) n = 18, untreated n = 18). Figure 1D : From 135-day-old wild-type mice or as Figure 1BShown is LAKI transduced with CAG-GFP or m-CDKN2A promoter-OSK AAV at day 60 - / - Histological analysis of the skin and spleen of mice; yellow and white arrows in spleen sections show splenic nodules and red pulp, respectively; scale bar represents 100 μm. Figure 1E : Frequencies of pluripotent hematopoietic stem cells (pHSC), lymphoid-primed multipotent progenitors (LMPP), and multipotent progenitors (MPP) in the multipotent hematopoietic stem cell compartment (HSC-MMP) of mice after m-CDKN2A promoter-OSK expression compared to CAG-GFP expression. Figure 1F : Frequencies of subsets of the mouse HSC compartment after m-CDKN2A promoter-OSK expression compared to CAG-GFP expression. Figure 1G : RT-PCR measurement of CDKN2A and key inflammatory marker gene levels in various organs of mice treated with CAG-GFP or m-CDKN2A promoter-OSK; mRNA levels are shown relative to Gapdh. Figure 1H : GSEA analysis of genes significantly dysregulated after CDKN2A promoter-OSK induction in skin, liver, spleen, and bone marrow, respectively.
[0096] Figures 2A - 2F . Optimization of senescent cell-specific regeneration strategies. Figure 2A : Single-cell RNA sequencing analysis of multiple human organs from different individuals of different age groups revealed four major cell populations: epithelial cell population, endothelial cell population, stromal cell population, and immune cell population (left); color-coded high CDKN2A expression based on individual age is shown (middle), and characteristics of high CDKN2A-expressing cells are shown (right). Data are from the Tabula Sapiens Consortium. Figure 2B : Schematic illustration of the NFκBIA protein domain and serine residues crucial for post-translational regulation. Amino acid sequences of NFκBIA wild-type and dominant-negative isoforms, in which two key serine residues are replaced by alanine residues. Figure 2C : Representative immunofluorescence images showing the localization of NFKB and actin in healthy and senescent cells (3T3 mouse fibroblasts) transfected with AAV carrying GFP or a dominant-negative isoform of NFKBIA. Figure 2D : Schematic of cell culture experiments in mouse embryonic fibroblasts (MEF) to test the specificity of AAV-mediated CDKN2A promoter-driven target gene expression during senescence induced by the DNA-damaging agent etoposide (top panel); RT-PCR measurement of CDKN2A, Oct4, and Sox2 levels during senescence. mRNA levels are shown relative to the TATA-binding protein (Tbp) (bottom panel). Figure 2E:Schematic of mouse experiments in CDKN2A-3MR mice for evaluating organs receiving AAV-DJ carrying the m-CDKN2A-GFP transgene. Figure 2F :Representative immunofluorescence images showing expression of AAV m-CDKN2A promoter-GFP in major organs (including spleen, liver, and skin) of p16-3MR mice. p16-3MR mice consist of a trimodal reporter gene composed of the functional domains of LUC (Renilla luciferase), mRFP (monomeric red fluorescent protein), and HSV-TK (truncated herpes simplex virus 1 thymidine kinase) under the control of the p16-INK4a and p19-Arf promoters. Scale bars represent 100 or 20 μm.
[0097] Figures 3A - 3G . AAV-mediated senescent cell-specific transgene expression. Figure 3A :Schematic of experiments evaluating AAV-DJ organ tropism and retention over time in young and old mice. Figure 3B :RT-qPCR measurement of AAV viral particle levels using primers specific for the WPRE region of the recombinant AAV genome in DNA isolated from different organs. DNA amounts were normalized to an intergenic region of the mouse genome. The y-axis represents relative AAV genomic DNA. Figure 3C :RT-qPCR measurement of the relative levels of p16 expression in various organs of 4.5-month-old LAKI- / - and wild-type B6 mice. The mRNA levels shown on the y-axis are relative to the Gapdh level. Figure 3D :Schematic of mouse experiments evaluating AAV-DJ-mediated transgene expression in LAKI- / - mice. Figure 3E :RT-qPCR measurement of Oct4 levels in various organs of LAKI- / - mice injected with AAV DJ control-GFP or CDKN2A promoter-OSK. The mRNA levels are shown relative to the Gapdh level. Figure 3F :Genome browser tracks derived from ChIP assays of H3K27 acetylation marks performed in proliferating and senescent IMR90 cells showing its enrichment at the promoters of the CDKN2A and MIR146A genes. Figure 3G :Survival curves of LAKI- / - mice injected with AAV DJ particles carrying control-GFP (green line), CDKN2A promoter-OSK (blue line), or mir146-OSK (magenta line). The x-axis represents days, and the y-axis represents survival percentage.
[0098] Figures 4A - 4G . Improvement of healthspan after senescent cell-specific OSK expression. Figure 4A: LAKI at different time points after a single injection of control CAG-GFP or m-CDKN2A promoter-OSK AAV-DJ particles - / - Body weight of mice. Figure 4B : Bar graphs quantifying various activities of the open field maze test in LAKI - / - mice injected with control CAG-GFP and m-CDKN2A promoter-OSK on day 135. Figure 4C : Autopsy analysis of 135-day-old LAKI - / - mice injected with control CAG-GFP or m-CDKN2A promoter-OSK AAV-DJ particles. White arrows indicate megacolon / megacecum, an abnormal gastrointestinal phenotype observed in control CAG-GFP but restored in LAKI - / - mice injected with m-CDKN2A promoter-OSK. Figure 4D : Spleen images of LAKI - / - mice injected with control CAG-GFP or m-CDKN2A promoter-OSK AAV-DJ particles on day 135. Figure 4E : Histological analysis of kidneys from 135-day-old wild-type mice or LAKI- / - mice transduced with CAG-GFP or m-CDKN2A promoter-OSK AAV-DJ particles on day 60 as Figure 1C shown. Figure 4F : Histological analysis of kidney and liver sections from 135-day-old wild-type mice or LAKI- / - mice transduced with CAG-GFP or m-CDKN2A promoter-OSK AAV on day 60 as Figure 1C shown; yellow arrows in kidney sections indicate Bowman's capsule; green arrows in kidney sections indicate the mesangial area of Bowman's capsule; scale bars represent 100 or 20 μm. Figure 4G : Bar graphs showing RNA sequencing data of Oct4, Sox2, and Klf4 expression levels in different organs after using the CDKN2A promoter-OSK.
[0099] Figures 5A - 5I . Upon induction of CDKN2A promoter-OSK, the bone marrow compartment regenerates towards a younger stage. Figure 5A : Gating strategy and representative plots for characterizing the bone marrow compartments of young and old wild-type mice for hematopoietic stem cells (HSCs) and various progenitors; the area outlined by the black box in the scatter plot indicates the gated cell population; lineage markers (Lin) include a mixture of antibodies recognizing CD3ε, B220, CD11b, Ly-6G, and TER-119. Figure 5B: CD135 and CD34 markers were used to characterize the HSC-MMP compartment in young and old wild-type mice on the KSL population (Kit(+), Sca-1(+), and Lin(-)). CD150 and CD41 markers were used to characterize the HSC compartment in the KSL CD34(-) population. MPP: multipotent progenitor; LMPP: lymphoid-primed multipotent progenitor; pHSC: pluripotent hematopoietic stem cell. Figure 5C : LAKI injected with control CAG-GFP or CDKN2A promoter-OSK AAV DJ - / - Young mice and LAKI - / - Representative flow cytometry data of the hematopoietic stem cell compartment in the bone marrow of young and old mice, showing the cell distribution in the HSC-MMP compartment; the regions delineated by the black boxes in the scatter plots indicate the gating of the MPP, LMPP, and pHSC populations, respectively. Figure 5D : Representative flow cytometry data of the bone marrow of LAKI- / - young and LAKI- / - old mice injected with control GFP or CDKN2A promoter-OSK AAV DJ, showing the cell distribution within the HSC compartment. Figure 5E : Representative immunofluorescence images of the bone marrow of LAKI- / - mice injected with AAV-DJ carrying control-GFP or CDKN2A promoter-OSK, showing the abundance of Ki67, Hes1, and CD45 positive cells. Figure 5F : Schematic of in vitro expansion of SLAM (signaling lymphocytic activation molecule) HSCs from LAKI- / - mice. Fifty E-SLAM (EPCR, endothelial protein C receptor) HSCs from the bone marrow were sorted into each well of a 96-well plate with differentiation medium. After 12 days of culture, cell growth and differentiation were observed by microscopy and FACS analysis. Figure 5G : Representative images showing HSC colonies expanded in various arbitrary groups after 12 days in differentiation medium. Figure 5H : Stacked bar graph showing the HSC colony size distribution in CDKN2A promoter-OSK-treated and control HSCs. Figure 5I : Frequency of the HSC-MMP subset of cultured cells from LAKI- / - mice treated with CDKN2A promoter-OSK compared to the control. Dots represent single-group experiments from independent mice, and the horizontal line represents the SEM.
[0100] Figures 6A - 6E . Organ-specific transcriptional changes after CDKN2A promoter-OSK induction. Figure 6A: Volcano plot showing the RNA-seq results of the number of genes with significantly altered expression in the skin after injection of AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP. Tissues were collected from the same LAKI Figure 1B used in - / - mice at day 135. On the right side of the volcano plot, GSEA of genes significantly dysregulated in the skin after using AAV DJ CDKN2A promoter-OSK. Figure 6B : Volcano plot of RNA-seq results showing the number of genes with significantly altered expression in the liver after using AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP and GSEA, and the genes were significantly dysregulated in the liver after AAV DJ CDKN2A promoter-OSK. Figure 6C : Volcano plot of RNA-seq results showing the number of genes with significantly altered expression in the spleen after using AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP and GSEA, and the genes were significantly dysregulated in the spleen after AAV DJ CDKN2A promoter-OSK. Figure 6D : Volcano plot of RNA-seq results showing the number of genes with significantly altered expression in the bone marrow after using AAV DJ CDKN2A promoter-OSK compared to control mice injected with AAV-DJ CAG-GFP and GSEA, and the genes were significantly dysregulated in the bone marrow after using AAV DJ CDKN2A promoter-OSK. Figure 6E : Bar plot showing the expression levels of a group of tissue-specific marker genes in various organs (skin, liver, spleen, and bone marrow) after using AAV DJ CDKN2A promoter-OSK. The y-axis represents normalized reads.
[0101] Figures 7A - 7F . Transcriptional rejuvenation of human primary cells (IMR90). Figure 7A : Bar plot showing the mRNA levels of the CDKN2A promoter and the pluripotency factors Oct4, Sox2, and Klf4 in IMR90 cells transduced with AAV carrying CDKN2A promoter-OSK at various stages of replicative senescence. Day 20 represents healthy young cells, day 125 represents the fully senescent stage, and days 50 and 85 represent intermediate stages. The y-axis represents normalized tag counts. Figure 7B : Principal component analysis (PCA) plot of control and CDKN2A promoter-OSK-treated IMR90 cells at various stages of replicative senescence. Figure 7C: Shows a heatmap of the expression of inflammation-related genes on the CDKN2A promoter - OSK AAV-DJ during replicative senescence. Figure 7D : Shows a heatmap of the expression of cell cycle-related genes on the CDKN2A promoter - OSK AAV-DJ during replicative senescence. Figure 7E : Shows a heatmap of the expression of inflammation-related genes on the CDKN2A promoter - OSK during DNA damage-induced (by etoposide or bleomycin treatment) and oncogenic RAS-induced senescence. Figure 7F : Shows a bioluminescence image of the abundance of senescent cells in 24-month-old CDKN2A promoter - 3MR mice two months after injection of a single dose of control or CDKN2A promoter - OSK AAV particles.
[0102] Figures 8A - 8F . The CDKN2A promoter - OSK regenerates senescent human fibroblasts. Figure 8A : Representative bright-field images of IMR90 cells 12 days after treatment with AAV DJ human CDKN2A promoter human OSK (H-CDKN2Ap-hOSK). Figure 8B : Gating strategy and representative plots for apoptosis analysis of young and senescent human fibroblasts; the area outlined by the black box in the scatter plot represents the gated cell population. Figure 8C : Gating strategy and representative plots for cell cycle analysis of young and senescent human fibroblasts; the area outlined by the black ellipse in the scatter plot represents the indicated gated cell population. Figure 8D : Bar graph showing the cell frequencies at each stage of the cell cycle in IMR90 cells with H-CDKN2Ap-hOSK AAV-DJ. The y-axis represents the cell percentage. Figure 8E : Bar graph showing the expression levels of fibroblast-specific marker genes in IMR90 after treatment with H-CDKN2Ap-hOSK AAV-DJ. The y-axis represents the normalized reads. Figure 8F : Bar graph showing the mRNA levels of senescence-related genes IFIH1 and OAS2 in IMR90 cells after treatment with H-CDKN2Ap-hOSK AAV-DJ. The y-axis represents the normalized read counts.
[0103] Figures 9A - 9I . Transcriptional regeneration of the CDKN2A promoter - OSK in human fibroblasts. Figure 9A : KEGG pathway enrichment analysis of genes dysregulated during senescence. Figure 9B : KEGG pathway enrichment analysis of genes dysregulated by H-CDKN2A promoter - hOSK. Figure 9C: Box plot showing the expression levels of IFN response and cell cycle-related genes on the H-CDKN2A promoter-hOSK in IMR90 cells during replicative senescence. The y-axis represents the normalized reads. Figure 9D : Bar graph showing the mRNA levels of the ECM-related genes elastin and COL1A1 in IMR90 cells after using the H-CDKN2A promoter-hOSK. The y-axis represents the normalized read counts. Figure 9E : Heat map showing the expression of extracellular matrix (ECM)-related genes on the H-CDKN2A promoter-OSK during replicative senescence. Figure 9F : Bar graph showing the RNA levels of CDKN2A, POU5F1 (Oct4), SOX2, and KLF4 in IMR90 cells untreated or treated with bleomycin, etoposide, or oncogenic RAS. Figure 9G : Principal component analysis (PCA) plot of control and H-CDKN2A promoter-hOSK-treated IMR90 cells that have undergone DNA damage (by treatment with etoposide or bleomycin) or oncogene-induced RAS senescence. Figure 9H : Schematic illustration of the p16-3MR mouse experiment evaluating the effect of the H-CDKN2A promoter-OSK on the senescent cell population. Figure 9I : Bioluminescence images showing the abundance of senescent cells in 26-month-old p16 (CDKN2A) promoter-3MR mice 4 months after injection of a single dose of control or m-CDKN2A promoter-OSK AAV particles.
[0104] Figures 10A - 10C . Regeneration of wild-type mice after senescent cell-specific reprogramming. Figure 10A : Schematic illustration (upper panel) of the mouse experiment evaluating the long-term effect of m-CDKN2A (p16) promoter-OSK expression in young wild-type mice and the survival curves (lower panel) of mice injected with control m-CDKN2A (p16) promoter-GFP (green line) or m-CDKN2A (p16) promoter-OSK (red line) AAV-DJ particles. GFP, (n = 6); m-CDKN2A promoter-OSK (n = 6). The x-axis represents days and the y-axis represents survival percentage. Figure 10B : Schematic illustration (upper panel) of the mouse experiment evaluating the effect of m-CDKN2A (p16) promoter-OSK on the health and lifespan of wild-type physiologically aged mice; body weights of mice at different time points after a single injection of AAV-DJ carrying control m-CDKN2A (p16) promoter-GFP or m-CDKN2A (p16) promoter-OSK transgenes (lower panel). The y-axis represents the total body weight (in grams) and the x-axis represents age (in days). Figure 10C:Survival curves of wild-type mice injected with control m-CDKN2A promoter-GFP (green line) or m-CDKN2A promoter-OSK (red line) AAV-DJ particles. (GFP, n = 20; m-CDKN2A promoter-OSK, n = 24). The x-axis represents days, and the y-axis represents survival percentage.
[0105] Figures 11A - 11B . Senescent cell-specific reprogramming improves the resilience of wild-type mice. Figure 11A :Tabular representation of tumor frequencies in control and m-CDKN2A promoter-OSK mice used in different experiments. Evidence of tumors was confirmed during autopsy. Figure 11B :Bar graph showing the quantification of various activities in a treadmill test of aged wild-type mice based on the control group and those injected with m-CDKN2A promoter-OSK AAV-DJ. Detailed implementation
[0106] Materials and methods are provided for regenerating senescent cells by expressing reprogramming factors such as Oct4, Sox2, and Klf4 (OSK) proteins and / or dominant-negative nuclear factor κB IA (dnNFκBIA) in senescent cells. In some aspects, the expression of OSK leads to partial reprogramming of senescent cells. In some aspects, the expression of OSK leads to complete or partial reversal of the aging of aged cells. In some aspects, the expression of the dnNFκBIA protein leads to inhibition of the senescence-associated secretory phenotype (SASP) in senescent cells. In some aspects, polynucleotides and vectors comprising OSK under the control of the CDKN2A (p16) promoter are provided. The polynucleotides and vectors enable the specific expression of OSK and / or dnNFκBIA in senescent cells, thereby achieving targeted phenotypic changes in senescent cells while avoiding systemic changes in non-senescent cells. The polynucleotides and vectors also enable the specific expression of OSK and / or dnNFκBIA in aged and / or aging cells, thereby achieving targeted phenotypic changes while avoiding systemic changes in non-aged cells.
[0107] Without being bound by theory, the applicant believes that the expression of reprogramming factors such as OSK driven by the CDKN2A (p16) promoter decreases or weakens with the regeneration and / or partial reprogramming of senescent cells. Without being bound by theory, the applicant believes that the decrease or weakening of the expression of reprogramming factors (such as OSK) driven by the CDKN2A (p16) promoter ages aged cells. Aged cells can be naturally aged cells or prematurely aged cells.
[0108] Without being bound by theory, the expression of reprogramming factors (such as OSK) driven by the CDKN2A (p16) promoter should decrease with the regeneration and / or partial reprogramming of senescent cells, such that OSK expression can serve as a marker for regeneration and / or partial reprogramming. Other markers of regeneration and / or partial reprogramming are disclosed herein, such as downregulation of inflammatory / SASP / stress response / DNA damage / reactive oxygen species (ROS) genes.
[0109] I. Definitions
[0110] To facilitate understanding of the present disclosure, certain terms are first defined. Additional definitions are set forth throughout the detailed disclosure.
[0111] It should be noted that the term "a / an" entity refers to one or more of said entities; for example, "a nucleic acid sequence" should be understood to represent one or more nucleic acid sequences, unless otherwise specified. Thus, the terms "a" or ("an"), "one or more" and "at least one" are used interchangeably herein.
[0112] Furthermore, as used herein, "and / or" will be regarded as a specific disclosure of each of the two specified features or components in the presence or absence of the other. Thus, the term "and / or" as used in a phrase such as (e.g., "A and / or B") herein is intended to include "A and B", "A or B", "A" (alone) and "B" (alone). Similarly, the term "and / or" as used in phrases such as "A, B and / or C" is intended to cover each of the following aspects: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0113] It should be understood that wherever aspects are described herein using the language "comprising", other similar aspects described in terms of "consisting of" and / or "consisting essentially of" are also provided.
[0114] The term "about" is used herein to mean approximate, roughly, approximately or around. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the upper and lower boundaries of the indicated values. In general, the term "about" can modify a value that is higher or lower than the stated value by a variation of, for example, 10% up or down (higher or lower).
[0115] The term "at least" before a number or series of numbers shall be understood to include the number adjacent to the term "at least", as well as all subsequent numbers or integers that can logically be included, as is clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a nucleic acid molecule of 21 nucleotides" means that 18, 19, 20, or 21 nucleotides have the specified property. When "at least" appears before a series of numbers or a range, it should be understood that "at least" can modify each number in the series or range. "At least" is also not limited to integers (e.g., "at least 5%" includes 5.0%, 5.1%, 5.18%, regardless of the number of significant figures).
[0116] As used herein, "not greater than" or "less than" shall be understood to mean the value adjacent to the phrase, as well as the lower value or integer that is logically lower from the context, down to zero. When "not exceeding" appears before a series of numbers or a range, it should be understood that "not exceeding" can modify each number in the series or range.
[0117] The terms "polynucleotide", "nucleic acid", and "oligonucleotide" are used interchangeably in this application. These terms refer only to the primary structure of the molecule. Thus, these terms include double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA. The terms "nucleic acid", "polynucleotide", and "oligonucleotide" as used herein are defined as molecules that are commonly understood by those skilled in the art to contain two or more covalently linked nucleosides. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Polynucleotides can be prepared by recombinant, enzymatic, or synthetic means, such as by solid-phase chemical synthesis followed by purification. When referring to the sequence of a polynucleotide or nucleic acid, the sequence or order of the covalently linked nucleotides or the nucleobase portion of the nucleosides, or their modifications, is referred to.
[0118] The term "polypeptide" as used herein is intended to cover the singular "polypeptide" as well as the plural "polypeptides", and encompasses any chain or chains of two or more amino acids. Thus, as used herein, "peptide", "peptide subunit", "protein", "amino acid chain", "amino acid sequence", or any other term used to refer to a chain or chains of two or more amino acids is included in the definition of "polypeptide", even though each of these terms may have a more specific meaning. The term "polypeptide" may be used in place of any of these terms, or may be used interchangeably with any of these terms. The term also includes polypeptides that have been modified post-translationally or post-synthetically, such as conjugation with a palmitoyl group, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, or modification with non-natural amino acids. The term "peptide" as used herein covers full-length peptides and their fragments, variants, or derivatives. The "peptides" disclosed herein may be part of a fusion polypeptide that contains additional components (such as albumin or a PEG moiety) to increase the half-life. The peptides described herein may also be derivatized in a variety of different ways. The peptides described herein may contain modifications, including for example conjugation with a palmitoyl group.
[0119] The term "in vitro" as used herein refers to events that occur in an artificial environment (such as in a test tube or reaction vessel, in cell culture, in a Petri dish, etc.) rather than within a living organism (such as an animal, plant, or microorganism).
[0120] The term "in vivo" as used herein refers to events that occur within a living organism (such as an animal, plant, or microorganism or its cells or tissues).
[0121] The term "transfection" as used herein refers to methods for introducing exogenous nucleic acid into cells. Transfection methods include, but are not limited to, chemical methods, physical treatments, and cationic lipids or mixtures. The list of reagents that can be transfected into cells is long and includes, for example, siRNA, shRNA, sense and / or antisense sequences, DNA encoding one or more genes and organized into an expression plasmid (such as a vector).
[0122] As used herein, the term "percent (%) sequence identity" with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after alignment of the sequences and introduction of gaps (if necessary) to achieve maximal percent sequence identity. Alignment for determining the percent nucleic acid or amino acid sequence identity can be achieved in various ways within the capabilities of one of ordinary skill in the art, e.g., using publicly available computer software such as BLAST, BLAST-2 or Megalign software. One of ordinary skill in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, the percent sequence identity values can be generated using the sequence comparison computer program BLAST.
[0123] As used herein, the term "level" refers to the amount or activity of a protein or the mRNA encoding the protein, optionally compared to a reference value. The reference can be any useful reference, as defined herein. A "decrease in level" or "increase in level" of a protein or RNA refers to a decrease or increase in the level of the protein or RNA compared to the reference value. The level of a protein or RNA can be expressed as mass / volume (e.g., g / dL, mg / mL, μg / mL, ng / mL) or as a percentage relative to the total protein or RNA in the sample.
[0124] As used herein, the term "promoter" refers to a DNA sequence recognized by the cellular machinery or introduced synthetic machinery required to initiate gene-specific transcription. The term "promoter" also is intended to encompass those nucleic acid elements that are sufficient to effect promoter-dependent gene expression that can be controlled by external signals or agents to achieve cell type-specific, tissue-specific or inducible expression; such elements can be located in the 5' or 3' regions of a native gene. In some aspects, the promoter can be a constitutively active promoter, a cell type-specific promoter, or an inducible promoter.
[0125] As used herein, the term "senescent cell-specific promoter" refers to a promoter that is expressed in senescent cells but not expressed or expressed at a significantly reduced level in non-senescent cells. Examples of senescent cell-specific promoters include, but are not limited to, the CDKN2A promoter (also referred to as the p16 promoter) or the mir146a promoter. The terms p16 promoter and CDKN2A promoter are used interchangeably herein.
[0126] As used herein, the term "CDKN2A promoter" or "p16 promoter" refers to the promoter of the human or murine cyclin-dependent kinase inhibitor 2A (CDKN2A) gene. The human CDKN2A (p16) promoter is provided in SEQ ID NO:1. The murine CDKN2A (p16) promoter is provided in SEQ ID NO:2.
[0127] As used herein, the term "WPRE" refers to the woodchuck hepatitis virus post-transcriptional regulatory element, which is a DNA sequence that, when transcribed, generates a tertiary structure that enhances the expression of viral vector genes.
[0128] As used herein, the term "IRES" refers to an element that promotes the ribosome to directly enter the start codon (such as ATG) of a cistron (protein-coding region), thereby resulting in cap-independent translation of a gene. See, for example, Jackson R J et al., Trends Biochem Sci 15(12):477-83 (199); Jackson R J and Kaminski, A. RNA 1(10):985-1000 (1995). Under the translational control of an IRES, the translation process occurs in a cap-independent manner.
[0129] The terms "operably linked", "operably inserted", "operably positioned", "under control" or "under transcriptional control" mean that a promoter is in the correct position and orientation relative to a nucleic acid to control the initiation of RNA polymerase and the expression of a gene. The term "operably linked" means that a DNA sequence and a regulatory sequence are linked in such a way that when an appropriate molecule (e.g., a transcriptional activator protein) binds to the regulatory sequence, gene expression is permitted. The term "operably inserted" means that the DNA of interest introduced into a cell is located near a DNA sequence that directs the transcription and translation of the introduced DNA (i.e., is conducive to the production of, for example, a polypeptide encoded by the DNA of interest).
[0130] As used herein, the term "proteolytic cleavage site" refers to a polynucleotide encoding an amino acid sequence that can be proteolytically cleaved, including but not limited to self-processing cleavage sites and furin cleavage sites.
[0131] As used herein, the term "self-processing cleavage site" refers to a post-translational or co-translational processing cleavage site or sequence, which can be a DNA or amino acid sequence, and is exemplified herein by a 2A site, sequence or domain or a 2A-like site, sequence or domain. A self-processing peptide is the peptide expression product of a DNA sequence encoding a self-processing cleavage site or sequence, which mediates the rapid intramolecular (cis) cleavage of a protein or polypeptide containing the self-processing cleavage site after translation to produce discrete mature protein or polypeptide products.
[0132] As used herein, the term "furin cleavage site" refers to a nucleic acid encoding an amino acid sequence that can be cleaved by endogenous subtilisin-like proteases such as furin and other serine proteases in the protein secretion pathway. In some aspects, the furin cleavage site includes the consensus sequence RXK(R)R of SEQ ID NO:6.
[0133] As used herein, the term "dominant-negative nuclear factor κBIA" or "dnNFκBIA" refers to a dominant-negative isoform of NFκBIA that can effectively block the nuclear translocation of NFκB, the major transcriptional inducer of the SASP.
[0134] As used herein, the term "termination signal sequence" can be any genetic element that causes RNA polymerase to terminate transcription, such as a polyadenylation signal sequence. The polyadenylation signal sequence is the recognition region required for endonuclease cleavage of an RNA transcript, followed by the polyadenylation consensus sequence AATAAA. The polyadenylation signal sequence provides a "polyA site", i.e., the site on the RNA transcript where adenine residues are added by post-transcriptional polyadenylation.
[0135] As used herein, the term "LAK - / - mouse" refers to a premature aging mouse model with a point mutation in the Lmn gene, which exhibits accelerated aging symptoms similar to those of patients with Hutchinson-Gilford progeria syndrome (HGPS).
[0136] As used herein, the term "senescent cell" refers to a cell that undergoes complex processes associated with genomic and epigenomic alterations, ultimately leading to permanent growth arrest of the cell.
[0137] As used herein, the term "aging" refers to the gradual deterioration of the functional characteristics of cells or organisms.
[0138] As used herein, the term "cellular senescence" refers to the permanent growth arrest phenotype of cells and chronic DNA damage signaling; both permanent growth arrest and chronic DNA damage signaling can drive the expression and secretion of a variety of cytokines, chemokines, growth factors, and proteases; genomic instability; telomere attrition; epigenetic alterations; and mitochondrial dysfunction.
[0139] As used herein, the term "senescence-associated secretory phenotype (SASP)" refers to the expression and secretion of cytokines, chemokines, growth factors, and proteases by senescent cells, which can lead to the degradation of the functional capacity of stem cells, thereby impairing their role in tissue renewal.
[0140] As used herein, the term "organismal aging" refers to the aging of the entire organism, including a decline in the ability to respond to stress, a decrease in regenerative capacity, stem cell exhaustion, an increase in homeostatic imbalance, a loss of proteostasis, and an increase in age-related diseases.
[0141] As used herein, the term "immunosenescence" refers to age-related immunodysfunction, including but not limited to thymic involution, increased numbers of memory T cells, loss of adaptive diversity, loss of the ability to respond to antigens, and persistent low-grade inflammation.
[0142] As used herein, the term "replicative senescence" refers to cellular senescence induced by excessive cell replication.
[0143] As used herein, the term "DNA damage-induced senescence" refers to senescence induced by DNA damage.
[0144] As used herein, the term "oncogene-induced senescence" refers to senescence induced by oncogenic signals resulting from activating mutations in oncogenes or inactivation of tumor suppressor genes. For example, an oncogene can be a Ras GTPase (RAS).
[0145] As used herein, the term "vector" refers to any agent used to clone and / or transfer nucleic acids into a host cell, such as plasmids, phages, transposons, cosmids, chromosomes, artificial chromosomes, viruses, virions, etc. A vector can be a replicon to which another nucleic acid fragment can attach, thereby causing replication of the attached fragment. A "replicon" refers to an autonomous unit that functions as an in vivo replicator, i.e., any genetic element (e.g., plasmid, phage, cosmid, chromosome, virus) capable of replicating under its own control. The term "vector" includes viral and non-viral agents used to introduce nucleic acids into cells in vitro, ex vivo, or in vivo. A large number of vectors are known and used in the art, including, for example, plasmids, modified eukaryotic viruses, or modified bacterial viruses. In some aspects, inserting a polynucleotide into a suitable vector can be accomplished by ligating an appropriate polynucleotide fragment to a selected vector having complementary sticky ends. Vectors can be engineered to encode a selectable marker or a reporter gene, which provides selection or identification of cells that have incorporated the vector. Expression of the selectable marker or reporter gene allows identification and / or selection of host cells that have incorporated and express other coding regions contained on the vector. Examples of selectable marker genes known and used in the art include: genes that confer resistance to ampicillin, streptomycin, gentamicin, kanamycin, hygromycin, bialaphos herbicide, sulfonamides, etc.; and genes that serve as phenotypic markers, i.e., anthocyanin regulatory genes, isopentenyl transferase genes, etc. Examples of reporter genes known and used in the art include: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), β-galactosidase (LacZ), β-glucuronidase (Gus), etc. A selectable marker can also be considered a reporter gene. In some aspects, the delivery vector is selected from the group consisting of viral vectors (e.g., AAV vectors), plasmids, lipids, cationic polymers, protein particles, bacterial vectors, and lysosomes. Some aspects of the present disclosure relate to biological vectors, which can include viruses, particularly attenuated viruses and / or replication-defective viruses. In some aspects, the vector can include microRNA targeting sequences to increase the specificity of vector-mediated transgene expression. In some aspects, the microRNA targeting sequences are integrated into the 3' UTR of the polynucleotide or vector. In some aspects, the delivery vectors of the present disclosure are viral vectors selected from the group consisting of adeno-associated virus (AAV) vectors, adenovirus vectors, lentivirus vectors, or retrovirus vectors.
[0146] As used herein, the term "adeno-associated virus vector" or "AAV vector" refers to any vector that contains or is derived from components of an adeno-associated vector and is suitable for infecting mammalian cells (preferably human cells). The term AAV vector generally refers to an AAV-type viral particle or virion that contains a payload. AAV vectors can be from various serotypes, including combinations of serotypes (i.e., "pseudotyped" AAV) or from various genomes (e.g., single-stranded or self-complementary). In addition, AAV vectors can be replication-deficient and / or targeted. As used herein, the term "adeno-associated virus" (AAV) includes, but is not limited to, AAV serotype 1, AAV serotype 2, AAV serotype 3 (including 3A and 3B), AAV serotype 4, AAV serotype 5, AAV serotype 6, AAV serotype 7, AAV serotype 8, AAV serotype 9, AAV serotype 10, AAV serotype 11, AAV serotype 12, AAV serotype 13, AAV-DJ, AAVrh8, AAVrh10, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, caprine AAV, shrimp AAV, those AAV serotypes and clades disclosed by Gao et al. (J. Virol. 78:6381 (2004)) and Moris et al. (Virol. 33:375 (2004)), and any other AAVs now known or later discovered. See, e.g., FIELDS et al. VIROLOGY, Volume 2, Chapter 69 (4th Edition, Lippincott-Raven Publishers). In some aspects, an "AAV vector" includes derivatives of known AAV vectors. In some aspects, an "AAV vector" includes modified or artificial AAV vectors. The terms "AAV genome" and "AAV vector" can be used interchangeably. In some aspects, the AAV vector is modified relative to the wild-type AAV serotype sequence.
[0147] As used herein, the term "AAV particle" refers to an AAV virus that contains an AAV vector having at least one payload region (e.g., a polynucleotide encoding a therapeutic protein or peptide) and at least one inverted terminal repeat (ITR) region. In some aspects, the term "AAV vector" refers to an AAV vector that contains a polynucleotide encoding an Oct4 protein, a Sox2 protein, and / or a Klf4 protein and / or a dnNFκBIA protein.
[0148] As used herein, the term "AAV rep gene" refers to the large open reading frame (ORF) of the AAV genome, referred to as the AAV replication (rep) region. This ORF encodes the replication gene products Rep78, Rep68, Rep52, and Rep40, which are named according to their apparent molecular weights and can be used for the replication, assembly, and packaging of intact AAV virions.
[0149] As used herein, the term "AAV cap gene" refers to the large open reading frame (ORF) of the AAV genome, referred to as the AAV capsid (cap) region. This ORF encodes at least three capsid proteins: VP1, VP2, and VP3, which permit the assembly of the AAV capsid into which the AAV genome is packaged with the help of AAV Rep proteins to produce AAV virions.
[0150] The phrase "AAV helper functions for producing efficient AAV infection" as used herein refers to AAV rep and AAV cap genes provided from a source other than a nucleic acid comprising a payload region and at least one ITR such that production of the AAV capsid, replication of the AAV payload / ITR nucleic acid, and insertion of the AAV payload / ITR into the assembled AAV capsid can occur. The AAV helper functions can be provided by co-infecting AAV producer cells with wild-type AAV virions, by providing to the AAV producer cells one or more plasmids comprising the AAV rep and AAV cap genes, or by infecting the AAV producer cells with a non-AAV virus carrying the AAV rep and AAV cap genes. AAV particles produced according to the methods described herein lack the AAV rep and AAV cap genes but contain the AAV payload / ITR nucleic acid. When administered to a subject's cells, in the absence of the AAV rep and AAV cap genes, the AAV virions are unable to replicate or form more AAV virions in the subject's cells. Instead, the AAV virions release their payload / ITR nucleic acid upon entry into the subject's cells, and the payload gene is transcribed in the subject's cells to produce the payload protein.
[0151] As used herein, the phrase “contacting a cell” (e.g., contacting a cell with an AAV vector, an AAV capsid, or a pharmaceutical composition of the disclosure) includes contacting the cell either directly or indirectly. In some aspects, contacting a cell with an AAV vector, an AAV capsid, or a composition includes contacting the cell with the composition, AAV vector, or AAV capsid in vitro, or contacting the cell with the AAV vector, AAV capsid, or composition in vivo. Thus, for example, an individual performing the method can physically contact an AAV vector, AAV capsid, or composition with a cell, or can place an AAV vector, AAV capsid, or composition in a situation that permits or results in its subsequent contact with a cell. In some aspects, contacting a cell in vitro can be accomplished, for example, by incubating the cell with an AAV vector, AAV capsid, or composition. In some aspects, contacting a cell in vivo can be effected, for example, by injecting an AAV vector, AAV capsid, or composition of the disclosure into or near the tissue in which the target cell is located, or by injecting an AAV vector, AAV capsid, or composition into a region (e.g., the bloodstream or subcutaneous space) such that the agent subsequently reaches the tissue in which the cell to be contacted is located. Additionally, an AAV vector or AAV virus can be encapsulated and / or conjugated to a ligand that directs the AAV vector or AVA virus to the site of interest. Combinations of in vitro and in vivo contacting methods are also possible. For example, a cell can be contacted with an AAV vector, AAV capsid, or composition in vitro and then transplanted into a subject.
[0152] In some aspects, contacting a cell with an AAV vector, AAV capsid, or composition of the disclosure includes “introducing” or “delivering” (either directly or indirectly) an AAV vector, AAV capsid, or composition into the cell by facilitating or affecting uptake or absorption of the cell. An AAV vector, AAV capsid, or composition can be introduced into a cell in vitro and / or in vivo. For example, for in vivo introduction, an AAV vector, AAV capsid, composition can be injected into a specific tissue site (e.g., the site requiring a therapeutic effect) or administered systemically (e.g., administering an AAV vector directed to the site requiring a therapeutic effect). Introducing an AAV genome or payload / ITR polynucleotide into a cell in vitro includes methods known in the art, such as electroporation and lipofection.
[0153] For example, the terms "effective amount", "therapeutically effective amount", and "sufficient amount" of an AAV vector, AAV capsid, or composition disclosed herein refer to an amount sufficient to produce a beneficial or desired result (including a clinical result) when administered to a subject, including a human. Thus, an "effective amount" or its synonyms depend on the context in which it is applied. In some aspects, a therapeutically effective amount of an agent (e.g., an AAV vector, AAV capsid, composition disclosed herein) is an amount that results in a beneficial or desired result in a subject as compared to a control. The amount of a given agent (e.g., an AAV vector, AAV capsid, or composition disclosed herein) will vary depending on various factors such as the given agent, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject or host being treated (e.g., age, sex, and / or weight), and the like.
[0154] As used herein, the term "gene therapy" refers to the insertion of a nucleic acid sequence (e.g., a polynucleotide comprising a promoter operably linked to a nucleic acid encoding a therapeutic molecule disclosed herein) into the cells and / or tissues of an individual to treat a disease or aging-related disorder, alleviate its symptoms, or reduce its likelihood. Gene therapy also includes the insertion of transgenes that have an inhibitory nature, i.e., that inhibit, reduce, or attenuate the expression, activity, or function of an endogenous gene or protein such as an unwanted (e.g., senescence-inducing) or abnormal (e.g., disease-causing) gene or protein. Such transgenes can be exogenous. An exogenous molecule or sequence is understood to be a molecule or sequence that is not normally present in the cells, tissues, and / or individual to be treated.
[0155] As used herein, the term "pharmaceutical composition" represents a composition comprising a compound or molecule described herein (e.g., an AAV vector disclosed herein), which is formulated with a pharmaceutically acceptable excipient and can be manufactured or sold, under the approval of a government regulatory agency, as part of a treatment regimen for treating a disease in a mammal.
[0156] As used herein, the term "pharmaceutically acceptable excipient" refers to any ingredient other than the compounds described herein (e.g., a vehicle capable of suspending or dissolving the active compound) and having the property of being substantially non-toxic and non-inflammatory to a patient.
[0157] As used herein, the term "subject" refers to any organism to which a composition disclosed herein (e.g., an AAV vector of the present disclosure) can be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include any animal (e.g., a mammal such as a mouse, rat, rabbit, non-human primate, and human). A subject can be seeking or in need of treatment, requesting treatment, receiving treatment, to receive treatment in the future, or is a human or animal under the care of a trained professional for a specific disease or affliction.
[0158] As used herein, the term "treat / treated / treating" refers to therapeutic treatment and / or prophylactic measures, where the goal is to prevent or slow down (mitigate) an undesired physiological condition such as an age-related disorder, condition, or disease, or to obtain a beneficial or desired clinical outcome. In some aspects, age-related disorders include signs and / or symptoms associated with natural aging. In some aspects, treatment reduces or alleviates symptoms associated with, for example, an age-related disease or condition. In some aspects, treatment results in a beneficial or desired clinical outcome. Beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms; reduction in the severity of a disorder, condition, or disease; stabilization (i.e., non-worsening) of a disorder, condition, or disease; delay or slowing in the onset of progression of a disorder, condition, or disease; improvement or alleviation (whether partial or complete), whether detectable or not, of a disorder, condition, or disease state; improvement in at least one measurable physical parameter, which may not necessarily be distinguishable by the patient; or enhancement or improvement of a disorder, condition, or disease. In some aspects, treatment includes eliciting a clinically significant response without excessive side effects. In some aspects, treatment may also mean an extended survival period compared to the expected survival period without treatment. As used herein, the term "amelioration / ameliorating" refers to a reduction in the severity of at least one indicator of a condition or disease. As used herein, the term "preventing / prevention" refers to delaying or preventing the occurrence, development, or progression of a condition or disease over a period of time (including weeks, months, or years). Ameliorating a disease or condition includes slowing the course of the disease or condition, or reducing the severity of an age-related disease or condition that develops later. A "preventive effective amount" can vary depending on the characteristics of the agent (e.g., AAV vector, AAV capsid, or composition), the mode of administration of the agent, the degree of disease risk, medical history, age, weight, family history, genetic makeup, type of previous or concurrent treatment (if any), and other individual characteristics of the patient to be treated.
[0159] As used herein, the term "cell reprogramming" refers to the process of altering a cell using reprogramming factors (e.g., reversing or preventing cellular changes that lead to dysfunction, degeneration, cell death, senescence, or aging). Cell reprogramming can be complete reprogramming such that a differentiated cell (e.g., a somatic cell) is reprogrammed into a pluripotent stem cell. Cell reprogramming may be incomplete such that a differentiated cell (e.g., a somatic cell) retains its cellular characteristics. Cell reprogramming can be partial, e.g., without generating stem cells, such that the cell regenerates or exhibits more youthful properties (e.g., increased survival, reduced inflammation). Cell reprogramming may provide additional cellular functions or prevent cellular senescence.
[0160] As used herein, the term "regenerating cells" refers to preventing or reversing the cellular causes of aging without inducing a pluripotent state.
[0161] As used herein, "pluripotent state" is intended to include a state in which a cell expresses at least one stem cell marker, such as but not limited to Esrrb, Nanog, Lin28, TRA-1-60 / TRA-1-81 / TRA-2-54, SSEA1, or SSEA4. Methods for measuring the expression of stem cell markers on cells are known in the art and include the methods described herein.
[0162] II. Polynucleotides
[0163] Polynucleotides are provided for expressing a cell regeneration promoting protein in senescent cells. In some aspects, the polynucleotide comprises a promoter that is active in senescent cells. In some aspects, the promoter is mIR146A. In some aspects, the promoter is the promoter of the cyclin-dependent protein kinase inhibitor 2A (CDKN2A) / p16 gene. In some aspects, the promoter is mir146A. In some aspects, the promoter comprises a polynucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the human p16 promoter of SEQ ID NO:1. In some aspects, the promoter comprises the polynucleotide sequence of SEQ ID NO:1. In some aspects, the promoter comprises a polynucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the mouse p16 promoter of SEQ ID NO:2. In some aspects, the promoter comprises the polynucleotide sequence of SEQ ID NO:2.
[0164] In some aspects, the polynucleotide comprises a nucleic acid sequence encoding an Oct4 protein. In some aspects, the Oct4 protein is a human Oct4 protein. In some aspects, the polynucleotide comprises a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the human Oct4 sequence of SEQ ID NO:3. In some aspects, the promoter comprises the nucleic acid sequence of SEQ ID NO:3.
[0165] In some aspects, the polynucleotide comprises a nucleic acid sequence encoding a Sox2 protein. In some aspects, the Sox2 protein is a human Sox2 protein. In some aspects, the polynucleotide comprises a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the human Sox2 sequence of SEQ ID NO:4. In some aspects, the promoter comprises the nucleic acid sequence of SEQ ID NO:4.
[0166] In some aspects, the polynucleotide comprises a nucleic acid sequence encoding a Klf4 protein. In some aspects, the Klf4 protein is a human Klf4 protein. In some aspects, the polynucleotide comprises a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the human Klf4 sequence of SEQ ID NO:5. In some aspects, the promoter comprises the nucleic acid sequence of SEQ ID NO:5.
[0167] In some aspects, the nucleic acid sequence encoding an Oct4 protein and / or the nucleic acid sequence encoding a Sox2 protein and / or the nucleic acid sequence encoding a Klf4 protein is operably linked to a promoter that is active in senescent cells. In some aspects, the promoter is the p16 promoter. In some aspects, the nucleic acid sequence encoding an Oct4 protein and / or the nucleic acid sequence encoding a Sox2 protein and / or the nucleic acid sequence encoding a Klf4 protein is operably linked to the p16 promoter of SEQ ID NO:1.
[0168] In some aspects, the polynucleotide further comprises a proteolytic cleavage site. In some aspects, the proteolytic cleavage site is a self-processing cleavage site or a furin cleavage site. In some aspects, the self-processing cleavage site is a P2A, E2A, F2A or T2A peptide. In some aspects, the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO:6. Thus, the polypeptide produced when the polynucleotide is transcribed in a cell can be cleaved by a protease in the cell to release the Oct4, Sox2 and Klf4 proteins.
[0169] In some aspects, the nucleic acid sequences encoding Oct4, Sox2, and Klf4 proteins are arranged on the polynucleotide in the 5'-3' direction such that the desired amounts of Oct4, Sox2, and Klf4 are produced in cells transduced with the polynucleotide. The amounts of Oc4, Sox2, and Klf4 proteins required for inducing partial reprogramming in a particular cell type can vary, and a polynucleotide can be selected that provides an optimal ratio of Oct4, Sox2, and Klf4 protein levels for partial reprogramming of the corresponding cell type. In some aspects, the level of the protein produced by the polynucleotide is highest when the protein-coding polynucleotide sequence is closest to the promoter sequence. In some aspects, Oct4, Sox2, and Klf4 are in the 5’-to-3’ order with respect to the promoter sequence.
[0170] In some aspects, the polynucleotide comprises a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a proteolytically cleavable site, and a nucleic acid sequence encoding a Sox2 protein.
[0171] In some aspects, the polynucleotide comprises a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a proteolytically cleavable site, and a nucleic acid sequence encoding a Klf4 protein.
[0172] In some aspects, the polynucleotide comprises a p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a proteolytically cleavable site, and a nucleic acid sequence encoding a Klf4 protein.
[0173] In some aspects, the polynucleotide comprises a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a first proteolytically cleavable site, a nucleic acid sequence encoding a Sox2 protein, a second proteolytically cleavable site, and a nucleic acid sequence encoding a Klf4 protein.
[0174] In some aspects, the polynucleotide comprises, in the 5’-3’ direction, a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a first proteolytically cleavable site, a nucleic acid sequence encoding a Klf4 protein, a second proteolytically cleavable site, and a nucleic acid sequence encoding a Sox2 protein.
[0175] In some aspects, the polynucleotide comprises, in the 5’-3’ direction, a p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a first proteolytically cleavable site, a nucleic acid sequence encoding an Oct4 protein, a second proteolytically cleavable site, and a nucleic acid sequence encoding a Klf4 protein.
[0176] In some aspects, the polynucleotide comprises, in the 5’-3’ direction, a p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a first proteolytically cleavable site, a nucleic acid sequence encoding a Ktlf4 protein, a second proteolytically cleavable site, and a nucleic acid sequence encoding an Oct4 protein.
[0177] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding the Klf4 protein, a first proteolytic cleavage site, a nucleic acid sequence encoding the Oct4 protein, a second proteolytic cleavage site, and a nucleic acid sequence encoding the Sox2 protein.
[0178] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding the Klf4 protein, a first proteolytic cleavage site, a nucleic acid sequence encoding the Sox2 protein, a second proteolytic cleavage site, and a nucleic acid sequence encoding the Oct4 protein.
[0179] In some aspects, the p16 promoter is a human or murine p16 promoter.
[0180] In some aspects, the first proteolytic site is a P2A peptide, an E2A peptide, an F2A peptide, a T2A peptide, or the RXK(R)R consensus sequence of SEQ ID NO:6.
[0181] In some aspects, the second proteolytic site is a P2A peptide, an E2A peptide, an F2A peptide, a T2A peptide, or the RXK(R)R consensus sequence of SEQ ID NO:6.
[0182] In some aspects, the polynucleotide comprises a second p16 promoter.
[0183] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding the Oct4 protein, a second p16 promoter, a nucleic acid sequence encoding the Sox2 protein, a proteolytic cleavage site, and a nucleic acid sequence encoding the Klf4 protein.
[0184] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding the Oct4 protein, a second p16 promoter, a nucleic acid sequence encoding the Klf4 protein, a proteolytic cleavage site, and a nucleic acid sequence encoding the Sox2 protein.
[0185] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding the Oct4 protein, a proteolytic cleavage site, a nucleic acid sequence encoding the Sox2 protein, a second promoter, and a nucleic acid sequence encoding the Klf4 protein.
[0186] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding the Sox2 protein, a proteolytic cleavage site, a nucleic acid sequence encoding the Oct4 protein, a second promoter, and a nucleic acid sequence encoding the Klf4 protein.
[0187] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a proteolytically cleavable site, a nucleic acid sequence encoding a Klf4 protein, a second promoter, and a nucleic acid sequence encoding a Sox2 protein.
[0188] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding a Klf4 protein, a proteolytically cleavable site, a nucleic acid sequence encoding an Oct4 protein, a second promoter, and a nucleic acid sequence encoding a Sox2 protein.
[0189] In some aspects, the first and second promoters initiate transcription in the same direction.
[0190] In some aspects, the first and second promoters initiate transcription in different directions.
[0191] In some aspects, the polynucleotide further comprises a polyadenylation signal sequence. In some aspects, the polyadenylation signal sequence is an SV40 polyadenylation signal sequence, a human growth hormone polyadenylation signal sequence, or a bovine growth hormone polyadenylation signal sequence.
[0192] In some aspects, the polynucleotide further comprises a WPRE sequence.
[0193] In some aspects, the polynucleotide further comprises an IRES.
[0194] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a first IRES, a nucleic acid sequence encoding a Sox2 protein, a second IRES, and a nucleic acid sequence encoding a Klf4 protein.
[0195] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding an Oct4 protein, a first IRES, a nucleic acid sequence encoding a Klf4 protein, a second IRES, and a nucleic acid sequence encoding a Sox2 protein.
[0196] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a first IRES, a nucleic acid sequence encoding an Oct4 protein, a second IRES, and a nucleic acid sequence encoding a Klf4 protein.
[0197] In some aspects, the polynucleotide comprises, in the 5'-3' direction, a p16 promoter, a nucleic acid sequence encoding a Sox2 protein, a first IRES, a nucleic acid sequence encoding a Klf4 protein, a second IRES, and a nucleic acid sequence encoding an Oct4 protein.
[0198] In some aspects, the polynucleotide contains, in the 5'-3' direction, the p16 promoter, a nucleic acid sequence encoding the Klf4 protein, a first IRES, a nucleic acid sequence encoding the Oct4 protein, a second IRES, and a nucleic acid sequence encoding the Sox2 protein.
[0199] In some aspects, the polynucleotide contains, in the 5'-3' direction, the p16 promoter, a nucleic acid sequence encoding the Klf4 protein, a first IRES, a nucleic acid sequence encoding the Sox2 protein, a second IRES, and a nucleic acid sequence encoding the Oct4 protein.
[0200] In some aspects, the polynucleotide contains, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding the Oct4 protein, a second p16 promoter, a nucleic acid sequence encoding the Sox2 protein, an IRES, and a nucleic acid sequence encoding the Klf4 protein.
[0201] In some aspects, the polynucleotide contains, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding the Oct4 protein, a second p16 promoter, a nucleic acid sequence encoding the Klf4 protein, an IRES, and a nucleic acid sequence encoding the Sox2 protein.
[0202] In some aspects, the polynucleotide contains, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding the Oct4 protein, an IRES, a nucleic acid sequence encoding the Sox2 protein, a second promoter, and a nucleic acid sequence encoding the Klf4 protein.
[0203] In some aspects, the polynucleotide contains, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding the Sox2 protein, an IRES, a nucleic acid sequence encoding the Oct4 protein, a second promoter, and a nucleic acid sequence encoding the Klf4 protein.
[0204] In some aspects, the polynucleotide contains, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding the Oct4 protein, an IRES, a nucleic acid sequence encoding the Klf4 protein, a second promoter, and a nucleic acid sequence encoding the Sox2 protein.
[0205] In some aspects, the polynucleotide contains, in the 5'-3' direction, a first p16 promoter, a nucleic acid sequence encoding the Klf4 protein, an IRES, a nucleic acid sequence encoding the Oct4 protein, a second promoter, and a nucleic acid sequence encoding the Sox2 protein.
[0206] In some aspects, the polynucleotide further contains a nucleic acid sequence encoding a marker protein. In some aspects, the marker protein is a β-galactosidase protein, a green fluorescent protein, a red fluorescent protein, a yellow fluorescent protein, a cyan fluorescent protein, or a blue fluorescent protein, a tdTomato protein, or an mCherry protein.
[0207] In some aspects, the polynucleotide comprises an intron sequence. In some aspects, the intron sequence includes a CMV intron sequence, a β-actin intron sequence, a chicken β-actin intron, an SV40 enhancer sequence, or a combination thereof.
[0208] III. Vectors and Cells
[0209] Also provided are vectors comprising the polynucleotides described herein.
[0210] In some aspects, the vector is a viral vector. In some aspects, the vector is a non-viral vector. In some aspects, the vector is a lipid. In some aspects, the vector is a polymer.
[0211] In some aspects, the viral vector is a vector that is an adeno-associated virus (AAV) vector, an adenovirus vector, a lentivirus vector, or a retrovirus vector. In some aspects, the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVRH8, AAVrh9, AAV9, AAVrh10, AAV10, AVRH10, AAV11, AAV12, or AAV-DJ vector.
[0212] In some aspects, an AAV vector with a broad target spectrum is selected to transduce various cell types. In some aspects, the AAV vector is an AAV-DJ vector.
[0213] In some aspects, an AAV vector with a specific target spectrum is selected to transduce selected cell types. The target specificity of different AAV vectors is known in the art (see, for example, AAV Production Protocol, Genemedi Biotech, Inc. 2018.).
[0214] In some aspects, the AAV vector is modified to target one or more selected cell types. For example, the AAV cap sequence can be modified to remove cell-targeting epitopes from the capsid and introduce alternative cell-targeting sequences into the capsid. AAV cap sequences modified in this way are known in the art.
[0215] In some aspects, the non-viral vector is plasmid DNA, RNA, a cationic polymer, a lipid, a lipid polymer, or a chemical derivative thereof.
[0216] In some aspects, the cationic polymer is present in an amount sufficient to produce a ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid vector or RNA vector of from about 0.1:1 to about 100:1.
[0217] In some aspects, the amount of the cationic polymer present is sufficient such that the ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid vector or RNA vector is from about 0.1:1 to about 10:1.
[0218] In some aspects, the amount of the cationic polymer present is sufficient such that the ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid vector or RNA vector is from about 0.1:1 to about 5:1.
[0219] In some aspects, the non-viral vector comprises from about 0.5 mg / ml to about 5.0 mg / ml of polynucleotide complexed with a cationic polymer. In some aspects, the cationic polymer is a poly(ethyleneimine) (PEI) polymer, poly-L-lysine, polyamidoamine, diethylaminoethyl dextran, chitosan, poly(dimethylaminoethyl methacrylate) or a derivative thereof.
[0220] Cells comprising a polynucleotide as described herein or a vector as described herein are also provided. In some aspects, the cells can be bacterial cells, yeast cells, fungal cells, insect cells or mammalian cells.
[0221] In some aspects, cells comprising a polynucleotide as described herein can be used to produce viral vectors. In some aspects, the cells are insect cells comprising a polynucleotide as described herein and other viral vector production components and are used to prepare a viral vector as described herein. In some aspects, the cells are mammalian cells comprising a polynucleotide as described herein and other viral vector production components and are used to prepare a viral vector as described herein.
[0222] In some aspects, the cells are insect cells comprising a polynucleotide as described herein and AAV viral vector production components and are used to prepare a viral vector as described herein.
[0223] In some aspects, the cells are mammalian cells comprising a polynucleotide as described herein and AAV viral vector production components and are used to prepare a viral vector as described herein.
[0224] In some aspects, cells containing the polynucleotides described herein can be used to treat a subject. In some aspects, cells containing the polynucleotides described herein can be administered to a subject in need of reversing aging, wherein the administered cells express a protein encoded by the polynucleotides described herein, and the expressed protein reverses cellular processes associated with the aging phenotype. In some aspects, the cells containing the polynucleotides described herein replicate after being administered to a subject. In some aspects, the cells containing the polynucleotides described herein can be hematopoietic progenitor cells. In some aspects, the cells containing the polynucleotides described herein can be hematopoietic stem cells. In some aspects, the cells containing the polynucleotides described herein can be mesenchymal / stromal stem cells. In some aspects, the cells containing the polynucleotides described herein can be adipose stem cells.
[0225] IV. Compositions and Kits
[0226] Also provided are compositions comprising the polynucleotides described herein and / or the vectors described herein. In some aspects, the compositions are gene therapy compositions. In some aspects, the compositions comprise a polynucleotide as described herein and a delivery agent or vector as described herein.
[0227] In some aspects, the delivery agent is a cationic polymer. In some aspects, the delivery agent is a lipid, a lipid polymer, or a chemical derivative thereof.
[0228] In some aspects, the cationic polymer of the composition is present in an amount sufficient to provide a ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid or RNA of from about 0.1:1 to about 100:1.
[0229] In some aspects, the cationic polymer of the composition is present in an amount sufficient to provide a ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid or RNA of from about 0.1:1 to about 10:1.
[0230] In some aspects, the cationic polymer of the composition is present in an amount sufficient to provide a ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid or RNA of from about 0.1:1 to about 5:1.
[0231] In some aspects, the polynucleotides described herein are complexed with the cationic polymer of the composition at from about 0.5 mg / ml to about 5.0 mg / ml. In some aspects, the cationic polymer of the composition is a poly(ethyleneimine) (PEI) polymer, poly-L-lysine, polyamidoamine, diethylaminoethyl dextran, chitosan, poly(dimethylaminoethyl methacrylate), or a derivative thereof.
[0232] Also provided are pharmaceutical compositions. In some aspects, the pharmaceutical compositions comprise a pharmaceutically acceptable carrier or excipient.
[0233] Some examples of materials that can be used as pharmaceutically acceptable carriers include, but are not limited to: (1) sugars such as lactose, glucose, and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients such as cocoa butter and suppository wax; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) diols such as propylene glycol; (11) polyols such as glycerol, sorbitol, mannitol, and polyethylene glycol; (12) esters such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) pH buffering solutions; (21) polyesters, polycarbonates, and / or polyanhydrides; and (22) other non-toxic compatible substances used in pharmaceutical formulations.
[0234] Other non-limiting examples of agents suitable for formulation with the polynucleotides of the present disclosure include: PEG-conjugated nucleic acids, phospholipid-conjugated nucleic acids, nucleic acids containing lipophilic moieties, phosphorothioates, P-glycoprotein inhibitors (e.g., Pluronic P85) that can enhance drug entry into various tissues; biodegradable polymers such as poly(DL-lactide-co-glycolide) microspheres for sustained release delivery after implantation (Emerich, D F et al., 1999, Cell Transplant, 8, 47-58) Alkermes, Inc. Cambridge, Mass.; and loaded nanoparticles such as nanoparticles made of polybutylcyanoacrylate that can deliver drugs across the blood-brain barrier and can alter neuronal uptake mechanisms (Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999).
[0235] In some aspects, the composition further comprises wetting agents, emulsifying agents, and lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening agents, flavoring agents, and fragrances, preservatives, and antioxidants.
[0236] Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, etc.; (2) oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, α-tocopherol, etc.; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, etc.
[0237] In some aspects, the compositions of the present disclosure include compositions suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal, and / or parenteral administration. The compositions may conveniently be presented in unit dosage form and may be prepared by any methods well-known in the pharmaceutical art. The amount of active ingredient that may be combined with a carrier substance to produce a single dosage form will vary depending on the host being treated and the particular mode of administration. The amount of active ingredient that may be combined with a carrier material to produce a single dosage form is generally the amount of the compound that produces a therapeutic effect. Generally speaking, on a percentage basis, the amount ranges from about 0.1% to about 99% of the active ingredient, preferably about 5% to about 70%, and most preferably about 10% to about 30%.
[0238] In some aspects, the compositions of the present disclosure contain excipients selected from cyclodextrins, cellulose, liposomes, micelle-forming agents (such as bile acids), and polymeric carriers (such as polyesters and polyanhydrides); and the polynucleotides described herein. In some aspects, the compositions render the polynucleotides described herein orally bioavailable.
[0239] Methods of preparing these compositions or pharmaceutical compositions include the step of combining the polynucleotides of the present disclosure with a carrier and optionally one or more accessory ingredients. Generally, the compositions are prepared by uniformly and intimately bringing the polynucleotides of the present disclosure into association with a liquid carrier or a finely divided solid carrier or both, and then shaping the product as required.
[0240] Compositions of the present disclosure suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored base, usually sucrose and gum arabic or tragacanth), powders, granules, or solutions or suspensions in aqueous or non-aqueous liquids, or water-in-oil or oil-in-water liquid emulsions, or elixirs or syrups, or lozenges (using an inert matrix, such as gelatin and glycerin, or sucrose and gum arabic) and / or mouthwashes, etc., each containing a predetermined amount of the compound of the present disclosure as an active ingredient. The polynucleotides described herein may also be administered as boluses, medicated pastes, or poultices.
[0241] In the solid dosage forms (capsules, tablets, pills, lozenges, powders, granules, etc.) of the present disclosure for oral administration, the active ingredient can be mixed with one or more pharmaceutically acceptable carriers (such as sodium citrate or dibasic calcium phosphate) and / or any one of the following: (1) fillers or extenders, such as starch, lactose, sucrose, glucose, mannitol, and / or silicic acid; (2) binders, such as carboxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and / or acacia; (3) wetting agents, such as glycerol; (4) disintegrants, such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retardants, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds and surfactants, such as poloxamer and sodium lauryl sulfate; (7) wetting agents, such as cetyl alcohol, glyceryl monostearate, and nonionic surfactants; (8) absorbents, such as kaolin and bentonite; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, zinc stearate, sodium stearate, stearic acid, and mixtures thereof; (10) coloring agents; and (11) controlled release agents, such as crosslinked polyvinylpyrrolidone or ethyl cellulose. In the case of capsules, tablets, and pills, the pharmaceutical composition may also contain buffering agents. Similar types of solid pharmaceutical compositions can also be used as fillers in soft-filled and hard-filled gelatin capsules using excipients such as lactose or lactose and high molecular weight polyethylene glycols, etc.
[0242] Tablets can be prepared by compression or molding, optionally with one or more accessory ingredients. Compressed tablets can be prepared using binders (e.g., gelatin or hydroxypropylmethylcellulose), lubricants, inert diluents, preservatives, disintegrants (e.g., sodium starch glycolate or crosslinked sodium carboxymethylcellulose), surfactants, or dispersing agents. Molded tablets can be prepared by molding a mixture of the powdered compound moistened with an inert liquid diluent in a suitable machine.
[0243] Tablets and other solid dosage forms of the pharmaceutical compositions of the invention, such as dragees, capsules, pills, and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulation art. They may also be formulated to provide slow or controlled release of the active ingredient therein, such as using different proportions of hydroxypropyl methylcellulose to provide the desired release profile, other polymeric matrices, liposomes, and / or microspheres. They may be formulated for rapid release, such as by lyophilization. They may be sterilized by filtration through, for example, a bacteria-retaining filter, or by incorporating a sterilizing agent in the form of a sterile solid pharmaceutical composition which can be dissolved immediately before use in sterile water or some other sterile injectable medium. These pharmaceutical compositions may also optionally contain opacifying agents and may be compositions which release the active ingredient only, or preferably, in a particular part of the gastrointestinal tract, optionally in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. The active ingredient may also be in microencapsulated form, and in appropriate cases, the microencapsulated form contains one or more of the excipients described above.
[0244] Liquid dosage forms for oral administration of the compounds of the disclosure include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents; solubilizing agents and emulsifying agents, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butanediol, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols, and fatty acid esters of sorbitan and mixtures thereof.
[0245] In addition to the inert diluent, the oral pharmaceutical compositions may also include adjuvants such as wetting agents, emulsifying agents, and suspending agents, sweetening agents, flavoring agents, coloring agents, perfuming agents, and preservatives.
[0246] In addition to the polynucleotide, the suspension may also contain suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol, and sorbitan esters, microcrystalline cellulose, aluminum hydroxide, bentonite, agar, and tragacanth and mixtures thereof.
[0247] Preparations for rectal or vaginal administration may be in the form of suppositories, which may be prepared by mixing one or more of the polynucleotides described herein with one or more suitable non-irritating excipients or carriers, including, for example, cocoa butter, polyethylene glycols, suppository waxes, or salicylates, and which are solid at room temperature but liquid at body temperature, and will thus melt in the rectal or vaginal cavity and release the active compound.
[0248] Formulations or dosage forms for topical or transdermal administration of the polynucleotides or vectors described herein include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants. The polynucleotides can be mixed with pharmaceutically acceptable carriers and any preservatives, buffers, or propellants that may be required, under sterile conditions. In addition to the polynucleotides described herein, ointments, pastes, creams, and gels can contain excipients such as animal and vegetable fats, oils, waxes, paraffin, starch, gum tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonite, silicic acid, talc, and zinc oxide, or mixtures thereof.
[0249] In addition to the polynucleotides described herein, powders and sprays can contain excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicate, and polyamide powder, or mixtures of these substances. Sprays can additionally contain conventional propellants such as chlorofluorocarbons and volatile unsubstituted hydrocarbons (such as butane or propane).
[0250] Transdermal patches have the additional advantage of providing controlled delivery of the polynucleotides or vectors described herein to the body. Such dosage forms can be prepared by dissolving or dispersing the polynucleotides or vectors in a suitable medium. Absorption enhancers can also be used to increase the flux of the agent across the skin. In addition to other methods known in the art, the rate of this flux can be controlled by providing a rate controlling membrane or by dispersing the agent in a polymeric matrix or gel.
[0251] Pharmaceutical compositions suitable for parenteral administration can contain one or more polynucleotides or vectors as described herein, and one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, or sterile powders, which can be reconstituted into sterile injectable solutions or dispersions before use, which can contain sugars, alcohols, antioxidants, buffers, bacteriostatic agents, solutes that render the composition isotonic with the blood of the intended recipient, or suspending or thickening agents. Examples of suitable aqueous and non-aqueous carriers that can be employed in the pharmaceutical compositions of the present disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.), and suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). For example, appropriate fluidity can be maintained by using coating materials (such as lecithin), by maintaining the desired particle size (in the case of dispersions), and by using surfactants.
[0252] These pharmaceutical compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms on the polynucleotides or vectors described herein can be ensured by including various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, etc. It may also be desirable to include isotonic agents such as sugars, sodium chloride, etc. in the compositions. In addition, prolonged absorption of injectable pharmaceutical forms can be achieved by including agents that delay absorption such as aluminum monostearate and gelatin.
[0253] In some aspects, in order to prolong the effect of the polynucleotides or vectors described herein, or to slow the absorption of subcutaneous or intramuscular injections, liquid suspensions of poorly water-soluble crystalline or amorphous substances can be used in other methods known in the art. The absorption rate of a composition containing the polynucleotides or vectors described herein depends on its dissolution rate, which in turn depends on crystal size and crystal form. Alternatively, delayed absorption of parenteral pharmaceutical forms can be achieved by dissolving or suspending the polynucleotides or vectors described herein in an oily vehicle.
[0254] Injectable depot forms are prepared by forming a microcapsule matrix of the polynucleotide in a biodegradable polymer such as polylactide - polyglycolide. The release rate of the polynucleotide or vector can be controlled according to the ratio of the polynucleotide or vector to the polymer and the nature of the particular polymer used. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations can also be prepared by encapsulating the polynucleotide or vector in liposomes or microemulsions that are compatible with body tissues.
[0255] When the polynucleotides or vectors described herein are administered as a drug to humans and animals, they can be given in the form of the drug itself, or in the form of a pharmaceutical composition containing, for example, 0.1 to 99% (more preferably 10 to 30%) of the active ingredient and a pharmaceutically acceptable carrier.
[0256] As described above, the formulations or preparations of the present disclosure can be administered orally, parenterally, topically, or rectally. They are generally administered in a form suitable for each route of administration. For example, they are administered in the form of tablets or capsules, by injection, inhalation, eye drops, ointments, suppositories, etc., by injection, infusion, or inhalation; topically by lotions or ointments; and rectally by suppositories.
[0257] Regardless of the route of administration selected, the polynucleotides or vectors and / or the pharmaceutical compositions of the present disclosure that can be used in a suitable hydrated form can be formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. The actual dosage level of the active ingredient in the pharmaceutical compositions of the present disclosure can vary to obtain an amount of the active ingredient that effectively achieves the desired therapeutic response for a particular patient, composition, and mode of administration without causing unacceptable toxicity to the patient.
[0258] The selected dosage level will depend on a variety of factors, including the activity of the particular polynucleotide or vector or its ester, salt, or amide employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular polynucleotide or vector employed, the rate and extent of absorption, the duration of treatment, other drugs, compounds, and / or materials used in combination with the particular polynucleotide or vector employed, the age, sex, weight, condition, general health, and prior medical history of the patient being treated, and similar factors well known in the medical arts.
[0259] A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the required pharmaceutical composition. For example, the physician or veterinarian can begin with a dose of the compositions of the present invention used in the pharmaceutical composition at a level lower than that required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. Generally, a suitable daily dose of the compositions of the present disclosure will be the amount of the polynucleotide or vector that is the lowest dose effective to produce a therapeutic effect. Such effective dose generally depends on the above factors. Generally, when used for the specified effect, the oral and parenteral doses of the compositions of the present disclosure for a patient will be in the range of about 0.0001 to about 100 milligrams per kilogram of body weight per day.
[0260] The polynucleotides can be administered to cells by a variety of methods known to those skilled in the art, including but not limited to encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres as described herein and known in the art. In some aspects, microemulsion techniques can be utilized to enhance bioavailability. Examples include Trimetrine (Dordunoo, S.K., et al., Drug Development and Industrial Pharmacy, 17(12), 1685 - 1713, 1991 and REV 5901 (Sheen, P.C., et al., J Pharm Sci 80(7), 712 - 714, 1991). Among other benefits, microemulsion also enhances bioavailability by preferentially directing absorption into the lymphatic system rather than the circulatory system, thereby bypassing the liver and preventing degradation of, for example, viral vector particles in the hepatobiliary circulation.
[0261] In some aspects, the formulation comprises micelles formed from the polynucleotides or vectors described herein and at least one amphiphilic carrier, wherein the micelles have an average diameter of less than about 100 nm. In some aspects, micelles having an average diameter of less than about 50 nm are used with the polynucleotides or vectors described herein. In some aspects, micelles having an average diameter of less than about 30 nm or even less than about 20 nm are used.
[0262] While all suitable amphiphilic carriers are contemplated, currently preferred carriers are generally those having a generally recognized as safe (GRAS) status and that can both solubilize the polynucleotides or vectors described herein and microemulsify them at a later stage upon contact of the solution with a complex aqueous phase (such as that found in the human gastrointestinal tract). Generally, the hydrophilic-lipophilic balance (HLB) value of the amphiphilic components meeting these requirements is 2 - 20, and their structure contains straight-chain aliphatic groups in the range of C-6 to C-20. Examples are polyethylene glycolated fatty glycerides and polyethylene glycol.
[0263] Examples of amphiphilic carriers include saturated and monounsaturated polyethylene glycol fatty acid glycerides, such as those obtained from various vegetable oils that are fully or partially hydrogenated. Such oils may advantageously consist of tri-, di-, and mono-fatty acid glycerides and di- and mono-polyethylene glycol esters of the corresponding fatty acids, with particularly preferred fatty acid compositions including 4 - 10% capric acid, 3 - 9% capric acid, 40 - 50% lauric acid, 14 - 24% myristic acid, 4 - 14% palmitic acid, and 5 - 15% stearic acid. Another class of useful amphiphilic carriers includes sorbitan and / or sorbitol partially esterified with saturated or monounsaturated fatty acids (SPAN series) or the corresponding ethoxylated analogs (TWEEN series).
[0264] Commercially available amphiphilic carriers may be particularly useful, including the Gelucire series, Labrafil, Labrasol, or Lauroglycol (all manufactured and sold by Gattefosse Corporation of Saint Priest, France), PEG-monooleate, PEG-dioleate, PEG-monolaurate, and dilaurate, lecithin, polysorbate 80, etc. (produced and sold by various companies in the United States and around the world).
[0265] In some aspects, delivery can be effected by using liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc. to introduce the pharmaceutical composition into a suitable host cell. Specifically, the pharmaceutical composition can be formulated to be encapsulated in lipid particles, liposomes, vesicles, nanospheres, nanoparticles, etc. for delivery. The formulation and use of such delivery vehicles can be carried out using known and conventional techniques.
[0266] Hydrophilic polymers suitable for use with the polynucleotides or vectors described herein are those that are soluble in water, can be covalently linked to vesicle-forming lipids, and are tolerated in vivo without toxic effects (i.e., biocompatible). Suitable polymers include polyethylene glycol (PEG), polylactic acid (also known as poly(lactide)), polyglycolic acid (also known as poly(glycolide)), polylactic acid-polyglycolic acid copolymers, and polyvinyl alcohol. In some aspects, the molecular weight of the polymer is from about 100 or 120 daltons to about 5,000 or 10,000 daltons, or from about 300 daltons to about 5,000 daltons. In some aspects, the polymer is polyethylene glycol having a molecular weight of from about 100 to about 5,000 daltons or a molecular weight of from about 300 to about 5,000 daltons. In some aspects, the polymer is polyethylene glycol of 750 daltons (PEG(750)). Polymers can also be defined in terms of the number of monomers therein; in some aspects, polymers of at least about three monomers are used, such as a PEG polymer consisting of three monomers (about 150 daltons).
[0267] Other hydrophilic polymers suitable for the present disclosure include polyvinylpyrrolidone, poly(meth)oxazolines, poly(ethyl)oxazolines, poly(hydroxypropyl)methacrylamide, polymethacrylamide, poly(dimethyl)acrylamide, and derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose.
[0268] In some aspects, the compositions of the present disclosure comprise a biocompatible polymer selected from the group consisting of polyamides, polycarbonates, polyolefins, polymers of acrylates and methacrylates, polyvinyl polymers, polyglycolides, polysiloxanes, polyurethanes and their copolymers, celluloses, polypropylenes, polyethylenes, polystyrenes, polymers of lactic and glycolic acids, polyanhydrides, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), polysaccharides, proteins, polyhyaluronic acid, polycyanoacrylates, and blends, mixtures or copolymers thereof.
[0269] In some aspects, the compositions of the present disclosure comprise a cationic polymer. In some aspects, the cationic polymer comprises a polyethylenimine (PEI) backbone. In some aspects, the PEI backbone is linked to a lipid or polyethylene glycol. In some aspects, the cationic polymer includes cationic dextran, cationic chitosan, cationic gelatin, cationic cellulose, or cationic cyclodextrin.
[0270] In some aspects, the compositions of the present disclosure include cyclodextrins. Cyclodextrins are cyclic oligosaccharides that can complex with a variety of relatively hydrophobic compounds through van der Waals interactions and hydrogen bond formation. For a general review of cyclodextrin chemistry, see Wenz, Agnew. Chem. Int. Ed. Engl., 33:803-822 (1994). The physicochemical properties of cyclodextrin derivatives depend to a large extent on the type and degree of substitution. For example, their solubility in water ranges from insoluble (e.g., triacetyl-β-cyclodextrin) to 147% soluble (w / v) (G-2-β-cyclodextrin). In addition, they are also soluble in many organic solvents. The properties of cyclodextrins enable their solubility to be controlled by increasing or decreasing the solubility of various formulation components. A variety of cyclodextrins and their preparation methods have been described. For example, Parmeter (I) et al. (U.S. Patent No. 3,453,259) and Gramera et al. (U.S. Patent No. 3,459,731) described neutral cyclodextrins. Other derivatives include cyclodextrins with cationic properties [Parmeter (II), U.S. Patent No. 3,453,257], insoluble crosslinked cyclodextrins (Solms, U.S. Patent No. 3,420,788), and cyclodextrins with anion properties [Parmeter (III), U.S. Patent No. 3,426,011]. Among the cyclodextrin derivatives with anionic properties, carboxylic acids, phosphorous acids, hypophosphorous acids, phosphonic acids, phosphoric acids, thiophosphonic acids, thiosulfinic acids, and sulfonic acids have been attached to the parent cyclodextrin [see, Parmeter (III), ibid.]. In addition, Stella et al. (U.S. Patent No. 5,134,127) described sulfonated alkyl ether cyclodextrin derivatives.
[0271] In some aspects, the compositions of the present disclosure include liposomes. Liposomes consist of at least one lipid bilayer membrane enclosing an aqueous internal compartment. Liposomes can be characterized by membrane type and size. Small unilamellar vesicles (SUVs) have a single membrane and typically have a diameter between 0.02 and 0.05 μm; large unilamellar vesicles (LUVs) are typically greater than 0.05 μm. Oligolamellar large vesicles and multilamellar vesicles have multiple, usually concentric, membrane layers and are typically greater than 0.1 μm. Liposomes with multiple non-concentric membranes, i.e., several smaller vesicles contained within a larger vesicle, are called multivesicular vesicles.
[0272] In some aspects, a composition comprising a liposome containing a polynucleotide or a vector as described herein is used, wherein the liposome membrane is formulated to provide liposomes with increased carrying capacity. Optionally or additionally, the compositions of the present disclosure can be included within or adsorbed onto the lipid bilayer of the liposome. The polynucleotides described herein can aggregate with lipid surfactants and be carried within the internal space of the liposome; in these cases, the liposome membrane is formulated to resist the disruptive effects of the agent-surfactant aggregates.
[0273] In some aspects, the lipid bilayer of the liposome contains lipids derivatized with polyethylene glycol (PEG) such that PEG chains extend from the inner surface of the lipid bilayer into the interior space encapsulated by the liposome and from the outer surface of the lipid bilayer into the surrounding environment.
[0274] The active agent (e.g., polynucleotide or vector) contained in the liposomes described herein is in dissolved form. According to the present disclosure, surfactants and aggregates of the active agent (e.g., emulsions or micelles containing polynucleotides or vectors) can be encapsulated within the interior space of the liposome. The surfactant serves to disperse and solubilize the polynucleotide or vector and can be selected from suitable aliphatic, cycloaliphatic, or aromatic surfactants, including but not limited to biocompatible lysophosphatidylcholines (LPG) of varying chain lengths (e.g., from about C14 to about C20). Polymer-derived lipids such as PEG-lipids can also be used for micelle formation as they will serve to inhibit micelle / membrane fusion and because addition of the polymer to the surfactant molecule reduces the CMC of the surfactant and aids in micelle formation. Surfactants with a CMC in the micromolar range are preferred; surfactants with a higher CMC can be utilized to prepare micelles encapsulated within the liposomes of the present disclosure.
[0275] The liposomes of the present disclosure can be prepared by any of a variety of techniques known in the art. See, for example, U.S. Patent No. 4,235,871; published PCT application WO 96 / 14057; New RRC, Liposomes: A practical approach, IRL Press, Oxford (1990), pages 33 - 104; Lasic DD, Liposomes from physics to applications, Elsevier Science Publishers BV, Amsterdam, 1993. For example, the liposomes described herein can be prepared by diffusing lipids derivatized with a hydrophilic polymer into preformed liposomes, e.g., by exposing preformed liposomes to micelles composed of lipid-grafted polymers, wherein the lipid concentration corresponds to the final molar percentage of the derivatized lipid desired in the liposome. Liposomes containing hydrophilic polymers can also be formed by homogenization, lipid field hydration, or extrusion techniques known in the art.
[0276] In some aspects of the formulation procedure, the active agent is first dispersed in lysophosphatidylcholine or other low CMC surfactants (including polymer-grafted lipids) by sonication. The resulting active agent micelle suspension is then used to rehydrate a dried lipid sample containing an appropriate molar percentage of polymer-grafted lipid or cholesterol. The lipid and active agent suspension is then formed into liposomes using extrusion techniques known in the art and the resulting liposomes are separated from the unencapsulated solution by standard column separation.
[0277] In some aspects, liposomes are prepared to have a substantially uniform size within a selected size range. An effective sizing method is to extrude an aqueous suspension of liposomes through a series of polycarbonate membranes having a selected uniform pore size; the pore size of the membrane will generally correspond to the maximum size of the liposomes produced by extrusion through the membrane. See, for example, U.S. Patent No. 4,737,323 (April 12, 1988). In some aspects, reagents such as and can be used to introduce polynucleotides or proteins into cells.
[0278] The release characteristics of the formulations of the present disclosure depend on the encapsulating material, the concentration of the encapsulated polynucleotide, and the presence of release regulators. For example, release can be controlled to be pH-dependent, for example, using a pH-sensitive coating that releases only at low pH (such as in the stomach) or at higher pH (such as in the intestine). Enteric coatings can be used to prevent release until after passage through the stomach. Multilayer coatings or mixtures of cyanamides encapsulated in different materials can be used to achieve initial release in the stomach followed by release in the intestine. Release can also be controlled by including salts or pore formers, which can increase water uptake or release of the composition by diffusion from the capsule. Excipients that change the solubility of the composition can also be used to control the release rate. Agents that enhance matrix degradation or release from the matrix can also be incorporated. They can be added to the composition, added as a separate phase (i.e., as particles), or, depending on the composition, co-dissolved in the polymer phase. In some aspects, the amount is between 0.1 and 30% (w / w polymer). Types of degradation promoters include inorganic salts such as ammonium sulfate and ammonium chloride, organic acids such as citric acid, benzoic acid, and ascorbic acid, inorganic bases such as sodium carbonate, potassium carbonate, calcium carbonate, zinc carbonate, and zinc hydroxide, organic bases such as protamine sulfate, spermine, choline, ethanolamine, diethanolamine, and triethanolamine, and surfactants such as and Pore formers that add microstructure to the matrix (i.e., water-soluble compounds such as inorganic salts and sugars) are added in particulate form. The range is generally between one and thirty percent (w / w polymer).
[0279] In some aspects, uptake can also be controlled by altering the residence time of the particles in the gut. This can be achieved, for example, by coating the particles with a mucoadhesive polymer or by selecting a mucoadhesive polymer as the encapsulating material. Examples include most polymers having free carboxyl groups, such as chitosan, cellulose, and especially polyacrylates (the polyacrylates used herein refer to polymers including acrylate groups and modified acrylate groups, such as cyanoacrylates and methacrylates).
[0280] In some aspects, the polynucleotide or vector can be formulated to be included within a surgical or medical device or implant, or to be released by a surgical or medical device or implant. In some aspects, the implant can be coated with or otherwise treated with the polynucleotide or vector. For example, the pharmaceutical compositions of the present disclosure can be coated on an implant using a hydrogel or other polymer (such as a biocompatible and / or biodegradable polymer) (i.e., the composition can be made suitable for a medical device by using a hydrogel or other polymer). Polymers and copolymers for coating medical devices with agents are well known in the art. Examples of implants include, but are not limited to, stents, drug-eluting stents, sutures, prostheses, vascular catheters, dialysis catheters, vascular grafts, artificial heart valves, cardiac pacemakers, implantable cardioverter defibrillators, intravenous needles, devices for bone fixation and formation (such as needles, screws, plates, and other devices), and artificial tissue matrices for wound healing.
[0281] In some aspects, similar to other drugs, the polynucleotides used according to the present disclosure can be formulated for administration in any convenient manner for human or veterinary medicine. The polynucleotide or vector and their corresponding formulations can be administered alone or in combination with other treatment strategies for treating progeria syndrome, progeria, signs and / or symptoms of aging (such as stem cell therapy, administration of reverse transcriptase inhibitors, and therapies against the cellular aging process).
[0282] V. Method for Preparing Recombinant AAV Particles
[0283] Recombinant viral particles are provided for administration to a subject in need of reprogramming of cells from a senescent-stage phenotype to a non-senescent-stage phenotype. In some aspects, the recombinant viral particles are AAV particles.
[0284] In some aspects, a method for preparing rAAV includes (i) providing to a cell an adeno-associated virus (AAV) rep gene, an AAV cap gene, a nucleic acid comprising a polynucleotide as described herein, a vector as described herein, and at least one AAV serotype 2 inverted terminal repeat, (ii) providing helper functions that result in efficient AAV infection; (ii) allowing AAV assembly; and (iii) collecting the rAAV.
[0285] In some aspects, the AAV rep gene and the AAV cap gene are provided by a plasmid.
[0286] In some aspects, the AAV rep gene and the AAV cap gene are provided by an adenovirus vector.
[0287] In some aspects, the AAV rep gene and the AAV cap gene are stably integrated into the genome of the cell.
[0288] In some aspects, the helper function is provided by a plasmid.
[0289] In some aspects, the helper function is provided by an adenovirus vector.
[0290] In some aspects, rAAV produced by the methods described herein is provided.
[0291] VI. Treatment methods
[0292] Methods for treating, preventing or inhibiting premature aging or age-related diseases in a subject are provided, the methods comprising administering to the subject a therapeutically effective amount of a polynucleotide, a vector, a cell, a composition, an rAAV, a pharmaceutical composition described herein in an amount effective to treat, prevent or inhibit premature aging or age-related diseases in the subject.
[0293] In some aspects, the subject has progeria syndrome.
[0294] In some aspects, the progeria syndrome is selected from the group consisting of Hutchinson-Gilford progeria syndrome; Werner syndrome; atypical progeria, mandibuloacral dysplasia type A; mandibuloacral dysplasia type B; mandibuloacral dysplasia associated with MTX2; mandibuloacral dysostosis, progeroid features and lipodystrophy syndrome (MDPL); Nezelof-Guilford progeria syndrome; and restrictive dermopathy.
[0295] In some aspects, the subject has a mutation in the LMNA gene, ZMPSTE24 gene, BANF1 gene, POLD1 gene, MTX2 gene or WRN gene.
[0296] In some aspects, the subject has signs and / or symptoms of aging.
[0297] In some aspects, methods for treating, preventing or inhibiting signs or symptoms of aging in a subject are provided, the methods comprising administering to the subject a therapeutically effective amount of a polynucleotide, a vector, a cell, a composition, an rAAV, a pharmaceutical composition described herein in an amount effective to treat, prevent or inhibit signs and symptoms of aging in the subject.
[0298] In some aspects, methods are provided for treating senescence associated with cellular senescence in a subject in need thereof. In some aspects, the methods include administering to the subject a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein.
[0299] In some aspects, methods are provided for reprogramming senescent cells to a non-senescent stage phenotype. In some aspects, methods are provided for reprogramming cells that express p16 to cells that do not express p16. In some aspects, the cells that express p16 are aged cells. In some aspects, the cells that express p16 are naturally aged cells. In some aspects, the cells that express p16 are prematurely aged cells. In some aspects, methods are provided for reprogramming cells that express p16 in an aged organism. In some aspects, the methods partially or fully reverse the aging of the cells. In some aspects, the methods partially or fully reverse the aging of naturally aged cells. In some aspects, the methods partially or fully reverse the aging of prematurely aged cells. In some aspects, the methods partially or fully reverse the aging of cells in an aged organism. In some aspects, the methods include contacting senescent cells and / or aged cells and / or cells undergoing aging with a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, or an rAAV described herein, or a pharmaceutical composition described herein, in an amount effective to partially reprogram the senescent cells to a non-senescent stage phenotype, and / or to partially reprogram the aged cells to a non-aged or less-aged phenotype, and / or to partially reprogram the cells undergoing aging to a non-cells-undergoing-aging phenotype.
[0300] In some aspects, methods are provided for reprogramming senescent cells in a subject to a non-senescent stage phenotype. In some aspects, the methods include administering to a subject in need thereof a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein, and partially reprogramming the senescent cells of the subject to a non-senescent stage phenotype.
[0301] In some aspects, methods are provided for inhibiting the activity of the senescence-associated secretory phenotype (SASP) in cells. In some aspects, the methods include contacting the cells with an amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, an rAAV described herein, or a pharmaceutical composition described herein, effective to inhibit the SASP activity in the cells.
[0302] In some aspects, methods are provided for regenerating senescent cells into a non-senescent stage phenotype. In some aspects, the methods include contacting the senescent cells with a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein in an amount effective to reprogram the senescent cells. In some aspects, the methods further include contacting the senescent cells with a polynucleotide as described herein or a vector as described herein in an amount effective to inhibit SASP activity in the senescent cells.
[0303] In some aspects, methods are provided for regenerating senescent cells in a subject into a non-senescent stage phenotype. In some aspects, the methods include administering to a subject in need thereof a therapeutically effective amount of a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein to partially reprogram the senescent cells; and administering to the subject a therapeutically effective amount of a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein to inhibit SASP activity.
[0304] In some aspects, methods are provided for regenerating aged cells of a subject into a non-aged or less aged phenotype. In some aspects, the methods include administering to a subject in need thereof a therapeutically effective amount of a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein to partially reprogram the aged cells. In some aspects, the aged cells are naturally aged cells, prematurely aged cells, and / or cells in an aged organism. In some aspects, the aged cells are cells that express p16. In some aspects, administering a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein to the senescent cells partially or completely reverses the aged cells to non-aged cells or less aged cells. In some aspects, administering a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein to cells that express p16 partially or completely reverses the cells that express p16 to cells that do not express p16. In some aspects, administering a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein to cells that express p16 reduces p16 expression in the cells.
[0305] In some aspects, administration induces an increase in the epidermal thickness of the subject, a decrease in the glomerular membrane area in the kidney, an increase in the structural arrangement of hepatocytes in the liver, a rescue of lymphocyte depletion in the germinal center of the spleen, a decrease in the level of inflammatory markers, an increase in the number of hematopoietic stem cells, a restoration of bone marrow tissue, and / or an increase in the activation of DNA repair pathways.
[0306] In some aspects, a decrease in the level of inflammatory markers includes a decrease in neutrophil invasion in the liver and a decrease in inflammatory characteristics in the spleen.
[0307] In some aspects, methods are provided for increasing age-related survival in a subject. In some aspects, the methods include administering to a subject in need thereof a therapeutically effective amount of a polynucleotide as described herein, a cell as described herein, a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein, and reprogramming senescent cells in the subject, thereby increasing the age-related survival of the subject.
[0308] In some aspects, the subject is a human.
[0309] In some aspects, therapeutic methods are provided that include contacting a cell with an amount of a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein that is effective to at least partially reprogram the cell. In some aspects, the contacting is performed ex vivo, such as in a cell culture dish. In some aspects, the contacted cells are subsequently administered to a subject in need of at least partially reprogrammed cells.
[0310] In some aspects, therapeutic methods are provided that include contacting a cell with an amount of a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein that is effective to at least partially reprogram the cell. In a further aspect, the method includes administering the cell to a subject in need of at least partially reprogrammed cells. In some aspects, the cell is a fibroblast. In some aspects, the fibroblast is a mammalian fibroblast. In some aspects, the fibroblast is a human fibroblast.
[0311] In some aspects, use of a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein for treating cell senescence-related aging is provided.
[0312] In some aspects, use of a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein in the manufacture of a medicament for treating cell senescence-related aging is provided.
[0313] In some aspects, articles are provided that comprise a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, an rAAV as described herein, or a pharmaceutical composition as described herein.
[0314] In some aspects, the method further includes administering an additional therapeutic agent to the subject.
[0315] In some aspects, the polynucleotides described herein, the vectors described herein, the cells described herein, the compositions described herein, the rAAVs described herein, the pharmaceutical compositions described herein are administered by intravenous, intramuscular, intradermal, subcutaneous, intraperitoneal or intranasal routes.
[0316] In some aspects, the administration process can vary according to the composition or compositions and the desired effect. Thus, the administration process includes administering to a patient in need of such treatment the polynucleotides described herein, the vectors described herein, the cells described herein, the compositions described herein, the rAAVs described herein, the pharmaceutical compositions described herein.
[0317] In some aspects, administration can be accomplished by any means suitable for a therapeutic agent, such as by parenteral, mucosal, pulmonary, subcutaneous, intradermal, topical, catheter-based or oral delivery means. Parenteral delivery can include, for example, subcutaneous, intravenous, intramuscular, intra-arterial, intraperitoneal, intralymphatic and injection into organ tissue. Mucosal delivery can include, for example, intranasal delivery, such as as a nasal drop, by nebulization, evaporation or other methods known in the art to administer the drug to the airways of the patient, namely the nose, sinuses, throat, lungs. Oral or intranasal delivery can include the administration of a propellant. Pulmonary delivery can include the inhalation of a medicament. Catheter-based delivery can include delivery by ion catheter-based delivery. Oral delivery can include the delivery of coated pills, or the administration of a liquid by mouth. According to the methods and compositions described herein, administration can generally also include delivery with a pharmaceutically acceptable carrier (such as a buffer, polypeptide, peptide, polysaccharide conjugate, liposome and / or lipid).
[0318] In some aspects, a therapeutically effective amount of the polynucleotides described herein, the vectors described herein, the cells described herein, the compositions described herein, the rAAVs described herein, the pharmaceutical compositions described herein are administered by intravenous, intramuscular, intradermal, subcutaneous, intraperitoneal or intranasal routes.
[0319] In some aspects, the polynucleotides described herein, the vectors described herein, the cells described herein, the compositions described herein, the rAAVs described herein, the pharmaceutical compositions described herein are delivered as combination therapies to a subject or a subject's tissue.
[0320] In some aspects, the polynucleotides described herein, the vectors described herein, the cells described herein, the compositions described herein, the rAAVs described herein, the pharmaceutical compositions described herein are delivered to a subject or a tissue of a subject together with at least one additional therapeutic agent. In some aspects, the polynucleotides described herein, the vectors described herein, the cells described herein, the compositions described herein, the rAAVs described herein, the pharmaceutical compositions described herein are administered to a subject before, after, or together with at least one additional therapeutic agent.
[0321] In some aspects, the polynucleotides described herein, the vectors described herein, the cells described herein, the compositions described herein, the rAAVs described herein, the pharmaceutical compositions described herein and at least one additional therapeutic agent can be administered by the same route or different routes; administered at substantially the same time (i.e., simultaneously, concurrently) or at different times (e.g., sequentially, successively, alternately, continuously or according to any other kind of alternating regimen). In some aspects, the additional therapeutic agent can be administered before, simultaneously with, or after the polynucleotide or vector described herein. For example, in some aspects, the polynucleotide or vector is administered to a patient who is undergoing background anti-aging therapy. For example, in some aspects, the patient has received anti-aging therapy treatment before and continues to receive anti-aging therapy before the administration of the polynucleotide or vector as described herein.
[0322] In some aspects, the first therapeutic composition in the combination can be administered by intravenous injection, while the additional therapeutic composition in the combination can be administered intradermally. Alternatively, for example, all therapeutic compositions can be administered by intravenous injection, or all therapeutic compositions can be administered by intradermal injection.
[0323] The described routes of administration are provided only as a guide, as a skilled practitioner will be able to readily determine the optimal route of administration and any dosage for any particular animal and condition.
[0324] Examples
[0325] Materials and Methods
[0326] Cell Culture
[0327] Human primary lung fibroblasts IMR90 cells were obtained from ATCC and cultured in DMEM (Gibco), 10% FBS (Gibco), 1% penicillin / streptomycin (Invitrogen), 1x Glutamax (Invitrogen), and non-essential amino acids (Invitrogen). HEK293A cells were used for AAV production and maintained in medium containing DMEM, 10% FBS, and 1% penicillin / streptomycin. All cells were cultured in a humidified incubator at 37 °C with 7% CO2. When the cells reached approximately 70% confluence, the cells were split at regular intervals and the medium was changed every 2 days.
[0328] AAV production
[0329] AAV was prepared using HEK293-AAV cells (Cell Biolabs, Inc.) with slight modifications as described (Grieger, J.C., Choi, V.W. & Samulski, R.J. Nat Protoc 1, 1412 - 1428, 2006). Cells were transfected with PEI (MW 40000) and then purified by CsCl gradient. Virus titers were determined by qPCR using primers; ITR-F: 5' GGAACCCCTAGTGATGGAGTT 3' and ITR-R: 5' CGGCCTCAGTGAGCG A 3'.
[0330] Inhibitor
[0331] The topoisomerase inhibitor etoposide (Sigma-Aldrich, St. Louis, USA) was dissolved in sterile PBS and diluted to a working concentration of 15 μM before use.
[0332] Plasmid vector
[0333] All plasmids used in this study are shown in Figures 12 - 17.
[0334] Quantitative real-time PCR
[0335] mRNA levels were quantified as previously described (Sahu, S.K. et al. Nat Commun 8, 1523, 2017). Briefly, total RNA was prepared using Trizol (Invitrogen) and reverse transcribed using a First Strand cDNA Synthesis Kit (Fermentas). Transcripts were quantified by PCR using SYBR green PCR MasterMix (ABI) on a ViiA7 PCR machine (Life Technologies). Normalization was performed using human or mouse GAPDH and TBP primers. The sequence details of the primers used in this study are shown below. Mouse real-time PCT primers are listed in Table 1.
[0336] Table 1
[0337] Cdkn2a Forward Primer GTGTGCATGACGTGCGGG Cdkn2a Reverse Primer GTTGCCCATCATCATCACCTGAA Ctcf Forward Primer GCCTGCAGCCACTGCGACAA Ctcf Reverse Primer CCATTGTGTTCCGGCGGGTGA Il1a Forward Primer AGGAGAAGACCAGCCCGTGT Il1a Reverse Primer TGCCAGGTGCACCCGACTTT Il1b Forward Primer AAAGACGGCACACCCACCCT Il1b Reverse Primer TGTGCTCTGCTTGTGAGGTGCT Oct4 Forward Primer CAGCAGATCACTCACATCGC Oct4 Reverse Primer CGCCGGTTACAGAACCATAC Sox2 Forward Primer CCTGGGCGCGGAGTGGAAAC Sox2 Reverse Primer CCGCCGCGGCCGGTATTTAT
[0338] Human real-time PCR primers are listed in Table 2.
[0339] Table 2
[0340] CTCF Forward Primer gggcttgagagctgggttctatt CTCFRP cttcgactgcatcaccttccatt TBP Forward Primer gtgaacatcatggatcagaacaaca TBP Reverse Primer aagatagggattccgggagtcat CDKN2A Forward Primer acattcatgtgggcatttcttg CDKN2A Reverse Primer aatgcttgtcatgaagtcgacag IL1A Forward Primer CCAGTGCTGCTGAAGGAGATGCC IL1A Reverse Primer CCCTGCCAAGCACACCCAGT IL1B Forward Primer GCTCTCCACCTCCAGGGACAGG 1L1B Reverse Primer TGAGGCCCAAGGCCACAGGT
[0341] Mouse
[0342] All animal experiments were conducted in accordance with the protocols and ethical guidelines approved by the IACUC of the Universidad Católica San Antonio de Murcia and complied with regulatory standards. LMNAG609G mice were bred by Carlos López-Otín at the University of Oviedo, Spain, and kindly donated by Brian Kennedy at the Buck Institute. Eight-week-old male C57BL / 6J mice were obtained from Jackson Laboratories. p16-3MR (trimodal reporter) mice were obtained from Jackson Laboratories. p16-3MR mice contain the functional domains of synthetic Renilla luciferase (LUC), monomeric red fluorescent protein (mRFP), and ganciclovir-sensitive truncated herpes simplex virus 1 thymidine kinase (HSV-TK) under the control of one copy of the CDKN2A (p16) promoter. p16-3MR mice show induction of luciferase, consistent with the expression of p16 during the aging process. Animals were housed in a specific pathogen-free environment and maintained under standard conditions with a 12-hour light / dark cycle and ad libitum access to food and water.
[0343] AAV DJ serotype adeno-associated virus (AAV) particles carrying GFP or the CDKN2A promoter-OSK (at a specified 1x10 11Gene copies (GC) / mouse) were injected into each mouse via the tail vein in 300 μL of PBS. The mice were observed regularly for weight loss and other deficiencies. The mice were sacrificed by inhalation of CO2 or cervical dislocation and blood was collected by cardiac puncture. Tissues were fixed immediately or snap-frozen for H&E and RNA.
[0344] Open field test
[0345] Baseline activity was measured by placing each mouse individually in the center of a 40×40 cm2 white box (wall height 40 cm) for 10 minutes. The light intensity at the center of the field was 290 lx. Mouse activity was digitally recorded using a camera placed 1 m above the center of the field. Automatic detection of the mouse path was analyzed using SYGNIS tracker software (SYGNIS). In addition to the analysis of general movement, the latency, duration, and the number of visits to the inner arena (10×10 cm2) away from the wall were calculated to measure the anxiety level. The open field test was performed on day 135 after birth.
[0346] IHC staining
[0347] For IHC, tissues were harvested, fixed in 10% neutral buffered formalin for 2 days, and then stored in 70% ethanol until further processing. Paraffin sections were stained with H&E according to the standard protocol.
[0348] Mouse hematopoietic stem cell / progenitor analysis
[0349] Bone marrow cells were isolated from the tibiae and femurs of mice and stained with antibodies as described below. Antibody staining was performed for 90 minutes and then washed with PBS before analysis. Bone marrow analysis was performed on a FACS AriaII cell sorter (BD Biosciences). The data collected were analyzed using FlowJo software (Tree Star, Ashland, OR). Bone marrow cell type frequencies were calculated based on 2x10 6 live lineage BM cells per mouse.
[0350] Phenotypic cell surface markers used to label hematopoietic stem cells / progenitors (including HSC, MPP, LMPP) were stained with lineage cocktail (CD4, CD8, B220, Gr-1, TER-119, and CD127), CD34, CD150, CD41, c-Kit, Sca-1, and Flt3).
[0351] RNA-seq and data analysis
[0352] Total RNA was extracted using the Invitrogen PureLink RNA Mini Kit. The extracted RNA was quantified at OD260 nm using an ND-1000 spectrophotometer (Nanodrop Technology), and the quality of the RNA was evaluated using a Bioanalyzer 2100 (Nanodrop Technology) with an RNA 6000 LabChip kit. According to the manufacturer's instructions, the Poly(A) mRNA magnetic separation module and Ultra TM II RNA Library Preparation Kit were used for Poly-A RNA isolation and library preparation. Single-end 50-cycle sequencing was performed using an Illumina, HiSeq 4000 SR50. Reads were aligned to the mouse genome (mm8) using TopHat (version 2.0.9) (Trapnell, C., Pachter, L. & Salzberg, S. L. Bioinformatics 25, 1105 - 1111, 2009) with default options. After normalizing the library sizes using DESeq (Anders, S. & Huber, W. Genome Biol 11, R106, 2010), expression was quantified using cufflink (version 2.1.1) and expressed as reads per kilobase of transcript per million mapped reads (RPKM) (Trapnell, C. et al. Nat Biotechnol 28, 511 - 515, 2010). Differential expression analysis was performed using the DESeq package with an FDR cutoff of 0.1.
[0353] Data and materials availability
[0354] The next-generation sequencing data generated in this study are available on the NCBI GEO website under accession number: GSE201710.
[0355] Example 1 - Inhibition and partial reprogramming of senescence-associated secretory phenotype (SASP) activity
[0356] Cellular senescence plays a major role during physiological aging and HGPS through SASP-mediated cell-intrinsic and extrinsic programs (Coppé, J.-P., Desprez, P.-Y., Krtolica, A. & Campisi, J. Annual Review of Pathology: Mechanisms of Disease 5, 99-118, 2010; Kuilman, T. & Peeper, D.S. Nat Rev Cancer 9, 81-94, 2009; Di Mitri, D. et al. Nature 515, 134-137, 2014; Eggert, T. et al. Cancer Cell 30, 533-547, 2016). Although senescent cells are considered detrimental to the organism, they also play beneficial roles in various physiological processes such as wound healing and fibrosis blockade. For example, continuous or acute elimination of p16 高 Senescent cells disrupt the blood-tissue barrier, subsequently leading to liver and perivascular tissue fibrosis and deterioration of health (Grosse, L. et al. Cell Metab 32, 87-99e86, 2020). Moreover, since the general tissue and organ cell composition of aging organisms consists mainly of a large number of senescent cells, the depletion of a large number of senescent cells may not always be the best strategy to prevent further deterioration of health. In fact, recent progress has shown that senescent cells play a key role in normal physiological processes, and the elimination of senescent cells has shown harmful consequences (Baker, D.J. et al. Nature 479, 232-236 (2011); Reyes, N.S. et al. Science 378, 192-201 (2022)). Therefore, there is a need for compositions and methods that target appropriate cell types and / or appropriate cell states (such as senescent, aged, somatic, and / or stem cells) to target senescent cells in a manner that is most beneficial for organismal longevity.
[0357] To target senescent cells, two approaches have been taken: inhibition of SASP activity and partial reprogramming ( Figure 1A , 2B ). To inhibit SASP (a dominant-negative isoform of NFκBIA that can effectively block the nuclear translocation of NF-κB), the master transcriptional inducer of SASP ( Figure 1A , 2B and 2C) was used. For partial reprogramming-mediated regeneration, the transcription factors Oct4, Sox2, and Klf4 (OSK) ( Figure 1A)。Transcription factors and dominant-negative isoforms of NFκBIA were delivered using an adeno-associated virus (AAV) vector containing a recombinant AAV genome carrying genes encoding Oct4, Sox2, and Klf4 (OSK) or a dominant-negative isoform of NFκBIA under the control of the Cdkn2a promoter within the AAV2 inverted terminal repeats( Figure 1A )。Notably, Cdkn2a is an established senescence marker( Figure 2A and 3F )。For example, genomic browser tracks from H3K27 acetylation-marked ChIP assays performed in proliferating and senescent human lung fibroblasts (IMR90 cells) showed enrichment of H3K27 acetylation at the CDKN2A promoter and the miR146 promoter in senescent cells( Figure 3F )。In addition, CDKN2A is expressed in various tissues in a premature aging mouse model with a point mutation in the Lmna gene (LAKI) and exhibits accelerated aging symptoms similar to those of patients with Hutchinson-Gilford progeria syndrome (HGPS)( Figure 1G , above figure and 3C) (see, e.g., Krishnamurthy, J. et al. J Clin Invest 114, 1299-1307, 2004; He, S. & Sharp less, N. E. Cell 169, 1000-1011, 2017; Muss, H. B. et al. Transl Cancer Res 9, 5732-5742, 2020). According to the published human single-cell transcriptome atlas (Tabula Sapiens), higher p16(CDKN2A) expression was found in older individuals, and cells with high p16(CDKN2A) expression were mainly immune system-related cells( Figure 2A )。Specific induction of target genes transduced by AAV particles in an in vitro cell system was demonstrated, and the particles contained the corresponding transgene under the control of the CDKN2A promoter( Figure 2C )。
[0358] Notably, NF-κB is mainly located in the cytoplasm in young cells, but becomes nuclear during senescence and induces the SASP. After transduction of senescent mouse fibroblasts with the CDKN2A promoter-NFKBIA(dn) AAV, NFκB remained in the cytoplasm of senescent cells, confirming the functionality of the CDKN2A promoter-NFKBIA(dn) AAV vector in vitro( Figure 2C )。
[0359] In an in vitro model of DNA damage-induced senescence by treating mouse embryonic fibroblasts (MEFs) with etoposide for 2 days, DNA damage increased CDKN2A expression in CDKN2A promoter-OSK AAV-treated cells and control GFP AAV-treated cells. However, CDKN2A promoter-OSK AAV transduction led to a further increase in CDKN2A expression, and increased expression of Oct4 and Sox2 in CDKN2A promoter-OSK AAV-transduced cells, confirming the functionality of the promoter and transgene of the CDKN2A promoter-OSK AAV vector in vitro( Figure 2D ).
[0360] Example 2 - Cellular reprogramming of p16 (CDKN2A)-expressing cells in an in vivo p16 biomarker-expressing mouse model
[0361] To better analyze the fate of senescent cells undergoing cellular reprogramming in vivo, a mouse model (p16-3MR trimodal reporter mouse) containing synthetic Renilla luciferase (LUC), monomeric red fluorescent protein (mRFP), and a ganciclovir-sensitive truncated herpes simplex virus 1 thymidine kinase (HSV-TK) functional domain under the control of one copy of the p16 promoter was used( Figure 2E , see also Demaria, M. et al. Dev Cell 31, 722-733, 2014). For in vivo studies, the AAV-DJ serotype was selected because of its broad organ tropism in mice( Figure 3A and 3B ).
[0362] A single dose of m-CDKN2A promoter-GFP AAV-DJ was injected into aged p16-3M R mice (22 months old), and RFP and GFP signals in each organ were evaluated 15 days after injection( Figure 2F ). The spleens of aged 3MR mice showed a high level of RFP-positive cells, indicating a high level of senescent cells. Co-expression of GFP and RFP in splenocytes demonstrated that m-CDKN2A promoter-GFP AAV-DJ mediated GFP expression in senescent cells( Figure 2F , magnified image, yellow).
[0363] In the liver, although AAV-DJ successfully transduced hepatocytes, few RFP-expressing hepatocytes were observed and no GFP / RFP co-expression was detected, indicating a low number of senescent cells in the liver( Figure 2F ; several bright colored dots in the liver image did not overlap with DAPI nuclear staining and were likely caused by background fluorescence). Overall, these studies confirmed the successful targeting of p16-expressing cells using the CDKN2A promoter-GFP AAV-DJ vector.
[0364] To analyze the fate of senescent cells undergoing cellular reprogramming in vivo, aged p16-3MR mice (22 months old) were injected with m-CDKN2A promoter-OSK AAV-DJ and GFP AAV-DJ control. Compared with control mice injected with constitutive promoter-GFP AAV-DJ, luciferase expression was reduced in p16-3MR mice treated with CDKN2A promoter-OSK AAV-DJ at 24 and 26 months (2 and 4 months after injection of CDKN2A promoter-OSK AAV-DJ), indicating a reduction in senescent cells after treatment with CDKN2A promoter-OSK AAV-DJ ( Figure 7F 、 9G and 9H). These results indicate that OSK expression driven by the CDKN2A promoter successfully reduced the number of senescent cells in CDKN2A promoter-3MR mice in vivo.
[0365] Example 3 - Effect of Senescent Cell-Specific Intervention on Organism Lifespan
[0366] To test whether senescent cell-specific intervention can improve age-related phenotypes and extend the lifespan of organisms, a premature aging LAKI- / - mouse model was used ( Figure 1B 、 3D ). Eight-week-old LAKI- / - mice were injected with a single dose of AAV-DJ carrying CAG-GFP, m-CDKN 2A promoter-OSK, or m-CDKN2A promoter-NFκBIA-dn ( Figure 1B ). Blocking SASP activity in senescent cells with m-CDKN2A promoter-NFκBIA-dn significantly increased the median lifespan (control group: 120 days vs. CDKN2A promoter-NFκBIA: 140 days, approximately 17%). Partial reprogramming by OSK expression strongly improved the median lifespan (approximately 40%) and maximum lifespan (approximately 32%) of LAKI- / - mice ( Figure 1C ). Expression of Oct4 in various tissues after m-CDKN2A promoter-OSK AAV-DJ was confirmed ( Figure 3E ). Different senescence promoters (such as mir146a) are known to be more sensitive and dynamic in response to senescence / SASP (Kang, C. et al., Science 349, aaa5612 (2015) ( Figure 3F ). However, compared with OSK expression driven by the CDKN2A promoter, the health and lifespan of LAKI- / - mice transduced with m-mir146 OSK AAV-DJ showed a weaker improvement ( Figure 3G ).
[0367] CDKN2A promoter-OSK expression significantly prevented the progressive weight loss characteristic of LAKI- / - mice and improved overall physical fitness and activity, likely due to systemic physiological improvements ( Figure 4A and 4B ). Detailed autopsy analysis performed at 135 days of age showed an overall improvement in the gastrointestinal appearance (reduction of megacolon / megacecum with hardened fecal matter) and reduced splenic atrophy in CDKN2A promoter-OSK LAKI- / - mice ( Figure 4C and 4D ). Compared to GFP AAV-DJ-treated control mice, morphological and histological changes were improved in many organs including the skin, liver, spleen, and kidney in CDKN2A promoter-OSK AAV-DJ-treated LAKI- / - mice ( Figure 1D 、 4E and 4F). For example, increased epidermal and dermal thickness, reduced glomerular basement membrane area in the kidney, reduced kidney atrophy, and increased structural arrangement of hepatocytes in the liver were observed after using CDKN2A promoter-OSK ( Figure 1D 、 4E and 4F). In addition, macroscopic splenic degeneration and white pulp lymphocyte depletion (visible through the shrinkage of germinal centers) in the spleen of LAKI- / - mice were significantly rescued after using CDKN2A promoter-OSK ( Figure 1D ).
[0368] Although most p16-high expressing cells are vascular endothelial cells, macrophages, and adipocytes, see, e.g., Grosse, L., et al., Defined p16(High) Senescent Cell Types Are Indispensable for Mouse Healthspan. Cell Metab 32, 87-99e86, 2020), expression of OSK in senescent cells of LAKI- / - mice strongly reduced the overall inflammatory response in a broader range of organs ( Figure 1G and 1H ). Notably, administration of CDKN2A promoter-OSK to LAKI- / - mice reduced CDKN2A / p16 expression in the treated mice, indicating successful reduction of the senescence marker p16 after CDKN2A / p16 promoter-OSK treatment. Analysis of Oct4 and Sox2 transgenic expression in different organs showed more obvious expression in some tissues including the bone marrow, indicating that the paracrine signaling pattern drives the overall improvement of organ homeostasis and the inhibition of inflammatory response in LAKI- / - mice ( Figure 4G ).
[0369] Example 4 - Reversing Aging in a Premature Aging Mouse Model
[0370] As the aging process progresses, immune senescence plays a key role in driving the aging of different organs (Lee, K. A., Flores, R. R., Jang, I. H., Saathoff, A., Robbins, P. D., Immune Senescence, Immunosenescence and Aging. Front Aging 3, 900028, 2022). For example, in the aging bone marrow, hematopoietic stem cells (HSCs) have reduced homing ability, reduced regenerative self-renewal activity per cell, a bias towards myeloid differentiation, and increased apoptosis in response to stress, which together drive age-related pathologies (Esplin, B. L. et al. J Immunol 186, 5367-5375, 2011; Schuettpelz, L. G. & Link, D. C. Front Immunol 4, 204, 2013; Huggins, C. J. et al. Mol Cell Biol 33, 3242-3258, 2013). In the spleen, with aging, the functional compartments (red pulp and white pulp) composed of specialized populations such as macrophages, B cells, and stromal cells involved in the initial response to blood-borne pathogens become disrupted (Junt, T., Scandella, E., Ludewig, B., Form follows function: lymphoid tissue microarchitecture in antimicrobial immune defence. Nat Rev Immunol 8, 764-775, 2008).
[0371] After treating aged LAKI- / - mice with CDKN2A promoter-OSK AAV-DJ, reversal of immune senescence to a younger cell state was observed in both the hematopoietic stem cell multipotent progenitor (HSC-MMP) and hematopoietic stem cell (HSC) compartments in the bone marrow ( Figure 1E and 1F ). In addition, CDKN2A promoter-OSK AAV-DJ treatment reversed the accelerated depletion of the HSC population in LAKI- / - mice ( Figures 5A - 5D ). For example, increased Ki67 expression in CDKN2A promoter-OSK AAV-DJ-treated mice compared to the constitutive promoter-GFP AAV-DJ control indicated increased proliferation in the bone marrow compartment ( Figure 5E)。In addition, compared with the CDKN2A promoter-GFP AAV-DJ control, the percentage of CD34(-)CD150(+) cells in the cultured bone marrow cells of LAKI- / - mice treated with CDKN2A promoter-OSK AAV-DJ increased, indicating an increase in stem cells after CDKN2A promoter-OSK AAV-DJ treatment( Figure 5I )。And a reversal of certain immune cell populations to a younger state was observed in LAKI- / - mice treated with CDKN2A promoter-OSK AAV-DJ (Figure 5J).
[0372] Bulk transcriptome analysis of the skin, liver, spleen, and bone marrow showed that significant alterations in tissue-specific transcriptomes occurred after CDKN2A promoter-OSK AAV-DJ delivery in LAKI- / - mice( Figure 1H 、 6A -6D), while the overall organ-specific transcriptomes remained unchanged, indicating that CDKN2A promoter-OSK inhibits inflammation without altering cell characteristics( Figure 6E )。In addition, compared with other tested tissues, immune compartment-related organs such as the bone marrow and spleen showed more pronounced transcriptional changes( Figure 1H 、 6A -6D). For example, the bone marrow and spleen transcriptomes showed reduced inflammatory signals and activation of immune clearance pathways( Figure 1H 、 6C and 6D). In summary, the findings demonstrate new possibilities for in vivo and ex vivo therapeutic interventions to restore bone marrow tissue function and thereby extend healthspan.
[0373] Example 5 - Reversal of human cell senescence in vitro
[0374] To further understand the fate of cells after senescence cell-specific OSK expression, human primary lung fibroblasts (IMR90) adapted to different senescence stages were used. During replicative senescence, the expression of human OSK (hOSK) under the control of the human CDKN2A promoter led to transcriptional reversal to a younger stage( Figure 7A 、 7B 、8A, 9A, and 9B). Interestingly, although hCDKN2A promoter-hOSK strongly and specifically reversed the inflammatory response during replicative senescence( Figure 7C 、 8F and 9C), CDKN2A promoter-hOSK had no substantial effect on cell cycle-related genes in senescent cells( Figure 7D 、 8C 、8D, and 9C) and only increased the cell cycle in young cells( Figure 8D)。In addition, after treating human IMR90 cells with hCDKN2A promoter-hOSK, the inflammatory response in the aging transcriptome was reversed, but the cell characteristics remained unchanged( Figure 8E )。
[0375] In addition, transcriptome analysis in senescent IMR90 cells transduced with hCDKN2A promoter-hOSK showed a reduction in stress response and energy-consuming anabolic pathways, while activating some extracellular matrix (ECM) compartments towards a healthier state. For example, it led to increased expression of elastin and collagen 1A1 (COL1A1) after transduction with hCDKN2A promoter-hOSK( Figure 9D and 9E )。
[0376] Similar transcriptional reversals indicating cellular regeneration were observed in DNA damage- and oncogene (RAS)-induced cellular senescence( Figure 7E 、 8A and 9F)。
[0377] Notably, a decrease in the expression of the p16 senescence marker was observed in CDKN2A promoter-OSK-treated INR90 cells, indicating a reduction in the senescent phenotype of the cells after CDKN2A promoter-OSK treatment( Figure 7A )。
[0378] Example 6 - Long-term effects of partial reprogramming on physiological aging of wild-type mice
[0379] To evaluate the role of CDKN2A promoter-OSK in the process of physiological aging, a single dose of CDKN2A promoter-OSK AAV-DJ or CDKN2A promoter-GFP AAV-DJ control was injected into 60-day-old wild-type mice, and 100% survival rate was observed at 300 days( Figure 10A )。In addition, a single dose of CDKN2A promoter-OSK AAV-DJ or CDKN2A promoter-GFP AAV-DJ control was injected into 18-month-old wild-type mice. Compared with the CDKN2A promoter-GFP AAV-DJ control mice, it was observed that the mice injected with CDKN2A promoter-OSK AAV-DJ maintained their body weight, increased their lifespan, and improved their overall physical fitness( Figure 10B 、 10C and 11B)。
[0380] In summary, the results of the above embodiments demonstrate the activation of repair and regeneration pathways in cells expressing p16 after partial reprogramming of the cells. No tumorigenesis was observed after long-term expression of CDKN2A promoter-OSK in young mice, and a tumor incidence similar to that of the control was observed after long-term expression of CDKN2A promoter-OSK in old wild-type mice( Figure 11A ).
[0381] The results described herein indicate that partial cellular reprogramming of senescent cells can have broad organismal regeneration effects without the risk of tumor induction or organ failure due to loss of cell number and characteristics.
[0382] The sequences described herein are shown in Table 3.
[0383] Table 3
[0384]
[0385]
[0386]
[0387]
[0388]
[0389]
[0390]
[0391]
[0392]
[0393]
[0394]
[0395]
[0396]
[0397]
[0398]
[0399]
[0400]
[0401]
[0402]
[0403]
[0404]
[0405]
[0406]
[0407]
[0408]
[0409]
[0410]
[0411] It should be understood that the detailed description is intended to be used to interpret the claims rather than the summary and the abstract. The summary and the abstract may illustrate one or more but not all exemplary embodiments of the invention as conceived by the inventor, and thus are not intended to limit the invention and the appended claims in any way.
[0412] The present invention has been described above by means of functional building blocks that illustrate the implementation of specific functions and their relationships. For the sake of convenience in description, the boundaries of these functional building blocks have been arbitrarily defined herein. Alternative boundaries may be defined as long as the specified functions and their relationships are properly implemented.
[0413] The foregoing description of specific embodiments will fully disclose the general nature of the present invention, so that others may, without departing from the general concept of the present invention, readily modify and / or adapt such specific embodiments for various applications by applying knowledge within the scope of the art. Therefore, such adaptations and modifications are intended to be within the meaning and scope of the equivalents of the disclosed embodiments based on the teachings and guidance presented herein. It should be understood that the phrases or terms herein are for descriptive purposes rather than limiting, so that the terms or phrases of this specification will be interpreted by those skilled in the art according to the teachings and guidance.
[0414] The breadth and scope of the present invention should not be limited to the above exemplary embodiments, but should be defined only by the appended claims and their equivalents.
Claims
1. A polynucleotide comprising at least one CDKN2A promoter operably linked to a nucleic acid sequence encoding Oct4 protein, and / or a nucleic acid sequence encoding Sox2 protein, and / or a nucleic acid sequence encoding Klf4 protein.
2. The polynucleotide according to claim 1, wherein the CDKN2A promoter is operably linked to nucleic acid sequences encoding Oct4 protein, Sox2 protein and Klf4 protein.
3. The polynucleotide according to claim 1 or 2, wherein the CDKN2A promoter is a human or murine CDKN2A promoter.
4. The polynucleotide according to any one of claims 1-3, wherein the human CDKN2A promoter has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:
1.
5. The polynucleotide according to any one of claims 1-3, wherein the murine CDKN2A promoter has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:
2.
6. The polynucleotide according to any one of claims 1-5, wherein the polynucleotide encodes human Oct4 protein, and / or human Sox2 protein, and / or human Klf4 protein.
7. The polynucleotide according to any one of claims 1-6, wherein the nucleic acid sequence encoding Oct4 comprises SEQ ID NO:3, the nucleic acid sequence encoding Sox2 comprises SEQ ID NO:4, and the nucleic acid encoding Klf4 comprises SEQ ID NO:
5.
8. The polynucleotide according to any one of claims 1-7, further comprising at least one woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) sequence and at least one polyadenylation signal sequence.
9. The polynucleotide according to claim 8, wherein the at least one polyadenylation signal sequence is an SV40 polyadenylation signal sequence, a human growth hormone polyadenylation signal sequence or a bovine growth hormone polyadenylation signal sequence.
10. The polynucleotide according to any one of claims 1-9, wherein the polynucleotide further comprises at least one internal ribosome entry site (IRES).
11. The polynucleotide according to any one of claims 1-10, wherein the polynucleotide further comprises at least one proteolytic cleavage site.
12. The polynucleotide according to claim 11, wherein the at least one proteolytic cleavage site is a self-processing cleavage site or a furin protease cleavage site.
13. The polynucleotide according to claim 11 or 12, wherein the self-processing cleavage site is a P2A, E2A, F2A or T2A peptide.
14. The polynucleotide according to claim 12, wherein the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO:
6.
15. The polynucleotide according to any one of claims 1-14, wherein the polynucleotide further comprises a second CDKN2A promoter.
16. The polynucleotide according to claim 15, wherein the first promoter and the second promoter initiate transcription in the same direction.
17. The polynucleotide according to claim 15, wherein the first promoter and the second promoter initiate transcription in different directions.
18. A polynucleotide comprising the nucleic acid sequence of SEQ ID NO:
10.
19. A polynucleotide comprising a CDKN2A promoter operably linked to a nucleic acid sequence encoding a dominant negative nuclear factor κBIA (dnNKκBIA) protein.
20. The polynucleotide according to claim 19, wherein the CDKN2A promoter is a human or murine CDKN2A promoter.
21. The polynucleotide according to claim 19 or 20, wherein the human CDKN2A promoter has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:
1.
22. The polynucleotide according to claim 19 or 20, wherein the murine CDKN2A promoter has a nucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:
2.
23. The polynucleotide according to any one of claims 19-22, wherein the nucleic acid sequence encodes a human dnNKκBIA protein.
24. The polynucleotide according to any one of claims 19-22, wherein the nucleic acid sequence encoding the dnNKκBIA protein comprises SEQ ID NO:
7.
25. The polynucleotide according to any one of claims 19-22, wherein the polynucleotide further comprises a WPRE sequence and a polyadenylation signal sequence.
26. The polynucleotide according to claim 25, wherein the polyadenylation signal sequence is an SV40 polyadenylation signal sequence, a human growth hormone polyadenylation signal sequence or a bovine growth hormone polyadenylation signal sequence.
27. The polynucleotide according to any one of claims 19-26, wherein the polynucleotide further comprises an IRES.
28. The polynucleotide according to any one of claims 19-27, wherein the polynucleotide further comprises a proteolytic cleavage site.
29. The polynucleotide according to claim 28, wherein the proteolytic cleavage site is selected from the group consisting of a self-processing cleavage site and a furin cleavage site.
30. The polynucleotide according to claim 28 or 29, wherein the self-processing cleavage site is a P2A, E2A, F2A or T2A peptide.
31. The polynucleotide according to claim 29, wherein the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO:
6.
32. The polynucleotide according to any one of claims 19-31, wherein the polynucleotide further comprises a reporter gene.
33. A polynucleotide comprising the nucleic acid sequence of SEQ ID NO:
11.
34. A polynucleotide comprising the nucleic acid sequence of SEQ ID NO:
12.
35. A vector comprising the polynucleotide according to any one of claims 1-18.
36. A vector comprising the polynucleotide according to any one of claims 19-34.
37. The vector according to claim 35 or 36, wherein the vector is a viral vector, a non-viral vector or a polymer.
38. The vector according to claim 37, wherein the viral vector is an adeno-associated virus (AAV) vector, an adenovirus vector, a lentivirus vector or a retrovirus vector.
39. The vector according to claim 38, wherein the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVRH8, AAVrh9, AAV9, AAVrh10, AAV10, AVRH10, AAV11, AAV12 or AAV-DJ vector.
40. The vector according to claim 38 or 39, wherein the AAV vector is an AAV-DJ vector.
41. The vector according to claim 37, wherein the non-viral vector is a plasmid.
42. The vector according to claim 37, wherein the polymer is a cationic polymer comprising a polyethyleneimine (PEI) backbone linked to a lipid or polyethylene glycol (PEG).
43. A cell comprising the polynucleotide according to any one of claims 1-34 or the vector according to any one of claims 35-42.
44. The cell according to claim 43, wherein the cell is a bacterial cell, an insect cell or an animal cell.
45. The cell according to claim 44, wherein the cell is a mammalian cell.
46. A composition comprising the polynucleotide according to any one of claims 1-34 or the vector according to claims 35-42 and a carrier.
47. A recombinant adeno-associated vector (rAAV) virus comprising the polynucleotide according to any one of claims 1-34 and an AAV capsid protein.
48. The rAAV according to claim 47, which comprises an AAV-DJ capsid.
49. A pharmaceutical composition comprising the polynucleotide according to any one of claims 1-34, the vector according to any one of claims 35-42, the cell according to any one of claims 43-45, the composition according to claim 46 or the rAAV according to claim 47 or 48, and a pharmaceutically acceptable carrier.
50. A kit, which comprises the polynucleotide according to any one of claims 1-34, the vector according to any one of claims 35-42, the cell according to any one of claims 43-45, the composition according to claim 46 or the rAAV according to claim 47 or 48.
51. A method for preparing rAAV, which comprises: (i) providing to a cell an adeno-associated virus (AAV) rep gene, an AAV cap gene, a nucleic acid comprising the polynucleotide according to any one of claims 1-34, the vector according to any one of claims 35-42, and at least one AAV serotype 2 inverted terminal repeat, (ii) providing an auxiliary function for generating effective AAV infection; (ii) allowing the AAV to assemble; and (iii) collecting the rAAV.
52. The method according to claim 51, wherein the AAV rep gene and the AAV cap gene are provided by a plasmid.
53. The method according to claim 51, wherein the AAV rep gene and the AAV cap gene are provided by an adenovirus vector.
54. The method according to claim 51, wherein the AAV rep gene and the AAV cap gene are stably integrated into the genome of the cell.
55. The method according to any one of claims 51-54, wherein the auxiliary function is provided by a plasmid.
56. The method according to any one of claims 51-54, wherein the auxiliary function is provided by an adenovirus vector.
57. An rAAV produced by the method according to any one of claims 51-56.
58. A method for reprogramming senescent cells into a non-senescent stage phenotype, the method comprising contacting the senescent cells with an amount of the polynucleotide according to any one of claims 1-34, the vector according to any one of claims 35-42, the cell according to any one of claims 43-45, the composition according to claim 46, the rAAV according to claim 47 or 48, or the pharmaceutical composition according to claim 49 that is effective for partially reprogramming the senescent cells into a non-senescent stage phenotype.
59. A method for reprogramming senescent cells of a subject into a non-senescent stage phenotype, the method comprising: (i) administering to a subject in need a therapeutically effective amount of the polynucleotide according to any one of claims 1-34, the vector according to any one of claims 35-42, the cell according to any one of claims 43-45, the composition according to claim 46, the rAAV according to claim 47 or 48, or the pharmaceutical composition according to claim 49, and (ii) partially reprogramming the senescent cells of the subject into a non-senescent stage phenotype.
60. The method according to claim 59, wherein the administration is by systemic administration.
61. A method for partially or completely reversing immune senescence of a subject, the method comprising: Administer to a subject in need thereof a polynucleotide according to any one of claims 1-34, a vector according to any one of claims 35-42, a cell according to any one of claims 43-45, a composition according to claim 46, an rAAV according to claim 47 or 48, or a pharmaceutical composition according to claim 49, in an amount effective to partially or completely reverse the immunosenescence of said subject.
62. The method according to claim 61, wherein the immunosenescence is characterized by a reduced homing ability of hematopoietic stem cells (HSCs), and the amount effective to partially or completely reverse the immunosenescence of said subject is an amount effective to increase the homing ability of said HSCs to the level of HSC homing ability found in HSCs of non-senescent subjects.
63. The method according to claim 61, wherein the immunosenescence is characterized by a reduced regenerative self-renewal activity per cell of HSCs, and the amount effective to partially or completely reverse the immunosenescence of the subject is an amount effective to increase the regenerative self-renewal activity per cell of HSCs to the level of regenerative self-renewal activity per cell of HSCs found in HSCs of non-senescent subjects.
64. The method according to claim 61, wherein the immunosenescence is characterized by a myeloid differentiation bias of HSCs, and the amount effective to partially or completely reverse the immunosenescence of the subject is an amount effective to reduce the myeloid differentiation bias of HSCs to the level of myeloid differentiation bias found in HSCs of non-senescent subjects.
65. The method according to claim 61, wherein the immunosenescence is characterized by increased apoptosis of HSCs after stress stimulation, and the amount effective to partially or completely reverse the immunosenescence of the subject is an amount effective to reduce the apoptosis of HSCs after stress stimulation to the level of apoptosis after stress stimulation found in HSCs of non-senescent subjects.
66. The method according to claim 61, wherein the administration is by systemic administration.
67. A method for reducing the number of senescent cells in a subject, the method comprising: Administer to a subject in need thereof a polynucleotide according to any one of claims 1-34, a vector according to any one of claims 35-42, a cell according to any one of claims 43-45, a composition according to claim 46, an rAAV according to claim 47 or 48, or a pharmaceutical composition according to claim 49, in an amount effective to reduce the number of senescent cells in the subject.
68. The method according to claim 67, wherein the administration is by systemic administration.
69. A method for extending the biological lifespan of a subject, the method comprising: Administer to a subject in need thereof a polynucleotide according to any one of claims 1-34, a vector according to any one of claims 35-42, a cell according to any one of claims 43-45, a composition according to claim 46, an rAAV according to claim 47 or 48, or a pharmaceutical composition according to claim 49, in an amount effective to extend the lifespan of the organism of said subject.
70. The method according to claim 69, wherein the administration is by systemic administration.
71. A method for reducing progressive weight loss in aging subjects, the method comprising: Administering to a subject in need thereof a polynucleotide according to any one of claims 1-34, a vector according to any one of claims 35-42, a cell according to any one of claims 43-45, a composition according to claim 46, an rAAV according to claim 47 or 48, or a pharmaceutical composition according to claim 49, in an amount effective to reduce the amount of progressive weight loss in the aging subject.
72. The method according to claim 71, wherein the administration is by systemic administration.
73. A method for enhancing physical ability in an aging subject, the method comprising: Administering to a subject in need thereof a polynucleotide according to any one of claims 1-34, a vector according to any one of claims 35-42, a cell according to any one of claims 43-45, a composition according to claim 46, an rAAV according to claim 47 or 48, or a pharmaceutical composition according to claim 49, in an amount effective to enhance the physical ability of the aging subject.
74. The method according to claim 73, wherein the administration is by systemic administration.
75. A method of reducing an inflammatory response in a subject, the method comprising: Administering to a subject in need thereof a polynucleotide according to any one of claims 1-34, a vector according to any one of claims 35-42, a cell according to any one of claims 43-45, a composition according to claim 46, an rAAV according to claim 47 or 48, or a pharmaceutical composition according to claim 49, in an amount effective to reduce the amount of inflammatory response in the subject.
76. The method according to claim 75, wherein the administration is by systemic administration.
77. A method for reducing replicative senescence in a subject, the method comprising: Administering to a subject in need thereof a polynucleotide according to any one of claims 1-34, a vector according to any one of claims 35-42, a cell according to any one of claims 43-45, a composition according to claim 46, an rAAV according to claim 47 or 48, or a pharmaceutical composition according to claim 49, in an amount effective to reduce the amount of replicative senescence in the subject.
78. The method according to claim 77, wherein the administration is by systemic administration.
79. A method for reducing DNA damage-induced senescence in a subject, the method comprising: Administering to a subject in need thereof a polynucleotide according to any one of claims 1-34, a vector according to any one of claims 35-42, a cell according to any one of claims 43-45, a composition according to claim 46, an rAAV according to claim 47 or 48, or a pharmaceutical composition according to claim 49, in an amount effective to reduce the amount of DNA damage-induced senescence in the subject.
80. The method according to claim 79, wherein the administration is by systemic administration.
81. A method for reducing oncogene-induced senescence in a subject, the method comprising: Administering to a subject in need thereof a polynucleotide according to any one of claims 1-34, a vector according to any one of claims 35-42, a cell according to any one of claims 43-45, a composition according to claim 46, an rAAV according to claim 47 or 48, or a pharmaceutical composition according to claim 49, in an amount effective to reduce the amount of oncogene-induced senescence in the subject.
82. The method according to claim 81, wherein the administration is by systemic administration.
83. A method for inhibiting the activity of senescence-associated secretory phenotype (SASP) in cells, the method comprising contacting the cells with an amount of the polynucleotide according to any one of claims 19 - 32, the vector according to any one of claims 36 - 42, the cell according to any one of claims 43 - 45, the composition according to claim 46, the rAAV according to claim 47 or 48, or the pharmaceutical composition according to claim 49, which is effective for inhibiting the SASP activity in the cells.
84. A method for regenerating senescent cells into a non-senescent stage phenotype, the method comprising: (i) contacting the senescent cells with an amount of the polynucleotide according to any one of claims 1 - 18, the vector according to any one of claims 35 or 37 - 42, the cell according to any one of claims 43 - 45, the composition according to claim 46, the rAAV according to claim 47 or 48, or the pharmaceutical composition according to claim 49, which is effective for partially reprogramming the senescent cells; and (ii) contacting the senescent cells with an amount of the polynucleotide according to any one of claims 19 - 34 or the vector according to any one of claims 36 or 37 - 42, which is effective for inhibiting the SASP activity in the senescent cells.
85. A method for regenerating senescent cells of a subject into a non-senescent stage phenotype, the method comprising: (i) administering to a subject in need thereof a therapeutically effective amount of the polynucleotide according to any one of claims 1 - 34, the vector according to any one of claims 35 or 37 - 42, the cell according to any one of claims 43 - 45, the composition according to claim 46, the rAAV according to claim 47 or 48, or the pharmaceutical composition according to claim 49 to partially reprogram the senescent cells; and (ii) administering to the subject a therapeutically effective amount of the polynucleotide according to any one of claims 19 - 34 or the vector according to any one of claims 36 - 42 to inhibit the SASP activity.
86. The method according to claim 85, wherein the administration is by systemic administration.
87. A method for increasing the age-related survival rate of a subject, the method comprising: (i) administering to a subject in need thereof a therapeutically effective amount of the polynucleotide according to any one of claims 1 - 34, the vector according to any one of claims 35 - 42, the cell according to any one of claims 43 - 45, the composition according to claim 46, the rAAV according to claim 47 or 48, or the pharmaceutical composition according to claim 49, and (ii) reprogramming the senescent cells of the subject so as to increase the age-related survival rate of the subject.
88. The method according to claim 87, wherein the administration is by systemic administration.
89. A method for treating cell senescence-related aging in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide according to any one of claims 1-34, the vector according to any one of claims 35-42, the cell according to any one of claims 43-45, the composition according to claim 46, the rAAV according to claim 47 or 48, or the pharmaceutical composition according to claim 49.
90. The method according to claim 89, wherein the administration is by systemic administration.
91. A method for treating Hutchinson-Gilford progeria syndrome in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the polynucleotide according to any one of claims 1-34, the vector according to any one of claims 35-42, the cell according to any one of claims 43-45, the composition according to claim 46, the rAAV according to claim 47 or 48, or the pharmaceutical composition according to claim 49.
92. The method according to claim 91, wherein the administration is by systemic administration.
93. The method according to claim 91 or 92, wherein the subject is a human.
94. The method according to any one of claims 91-93, wherein the administration induces an increase in epidermal thickness in the subject, a decrease in glomerular membrane area in the kidney, an increase in the structural arrangement of hepatocytes in the liver, a rescue of lymphocyte depletion in the germinal center of the spleen, a decrease in the level of inflammatory markers, an increase in the number of hematopoietic stem cells, a restoration of bone marrow tissue, and / or an increase in the activation of DNA repair pathways.
95. The method according to claim 94, wherein the decrease in the level of the inflammatory marker includes a decrease in neutrophil invasion in the liver and a decrease in inflammatory characteristics in the spleen.
96. Use of the polynucleotide according to any one of claims 1-34, the vector according to any one of claims 35-42, the cell according to any one of claims 43-45, the composition according to claim 46, the rAAV according to claim 47 or 48, or the pharmaceutical composition according to claim 49 for treating cell senescence-related aging.
97. Use of the polynucleotide according to any one of claims 1-34, the vector according to any one of claims 35-42, the cell according to any one of claims 43-45, the composition according to claim 46, the rAAV according to claim 47 or 48, or the pharmaceutical composition according to claim 49 in the manufacture of a medicament for treating cell senescence-related aging.
98. An article of manufacture comprising the polynucleotide according to any one of claims 1-34, the vector according to any one of claims 35-42, the cell according to any one of claims 43-45, the composition according to claim 46, the rAAV according to claim 47 or 48, or the pharmaceutical composition according to claim 49.
Citation Information
Patent Citations
Inclusion resins of cyclodextrin and methods of use
US3420788A
Cyclodextrins with anionic properties
US3426011A
Cyclodextrin with cationic properties
US3453257A
Cyclodextrin polyol ethers and their oxidation products
US3453259A
Cyclodextrin polyethers and their production
US3459731A