Polypeptide pka15 with function of inhibiting tumor cell proliferation and application of polypeptide pka15

Abstract

The invention discloses a polypeptide pka15 with a function of inhibiting tumor cell proliferation and application of the polypeptide pka15. The amino acid sequence of the polypeptide pka15 with the function of inhibiting tumor cell proliferation is shown as SEQ ID NO: 1, the nucleotide sequence of the polypeptide pka15 is shown as SEQ ID NO: 2, and the polypeptide pka15 shows good tumor cell proliferation resistance and can be used for preparing drugs or reagents for inhibiting tumor cell proliferation. The polypeptide pka15 disclosed by the invention is simple to synthesize, easy to prepare on a large scale, low in immunogenicity, low in cost, remarkable in effect and convenient for subsequent clinical application and popularization, thereby having a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of polypeptides, and particularly to a polypeptide pka15 with the function of inhibiting the proliferation of tumor cells and its application. Background Art

[0002] Cancer has always been a major challenge to global public health and one of the main causes of high mortality. According to the data of the World Health Organization, cancer causes millions of deaths every year, imposing a huge burden on the social and economic development of countries around the world. The occurrence of cancer involves abnormalities in the processes of cell proliferation, differentiation, and death. Its complexity and diversity make treatment extremely difficult. Cancer not only seriously threatens the life and health of patients, but also brings great economic and psychological pressure to patients and their families. With the acceleration of the global population aging, it is expected that the incidence and mortality of cancer will further increase. Although the current treatment methods for cancer are constantly improving, including surgery, radiotherapy, chemotherapy, and targeted therapy, etc., these methods often have limitations. For example, surgery is not applicable to all types or stages of cancer, and chemotherapy and radiotherapy may cause significant damage to healthy cells, resulting in serious side effects and easy recurrence. Therefore, there is an urgent need in the field of tumor treatment to explore tumor-targeted therapeutic drugs with low side effects and high safety and effectiveness.

[0003] Polypeptide preparations have become a research hotspot due to their unique biological activities, regulatability, and low immunogenicity. A polypeptide is a biomolecule composed of short-chain amino acids that can precisely bind to specific proteins or receptors, thereby regulating the functions of cells. Compared with traditional drugs, polypeptide drugs usually have higher specificity and lower toxicity, giving them potential advantages in cancer treatment. In addition, the application fields of polypeptide products are not limited to disease treatment, and their functions can be extended to the construction of drug delivery systems, the development of precision diagnostic tools, the assistance in the research and development of innovative drugs, and providing templates for the development of small molecule drugs, etc. Therefore, developing new polypeptides for the diagnosis and treatment of cancer has important value and application prospects. Summary of the Invention

[0004] In view of the deficiencies of the prior art and the actual needs, the inventors of the present invention have, through in-depth exploration and screening, developed a polypeptide molecule pka15 that can play the function of inhibiting the proliferation of tumor cells. The polypeptide pka15 is composed of 15 amino acids and has the function of inhibiting the proliferation of tumor cells.

[0005] The present invention provides the following technical solutions:

[0006] In the first aspect, the present invention provides a polypeptide pka15 with the function of inhibiting the proliferation of tumor cells, characterized in that the amino acid sequence of the polypeptide pka15 is as shown in SEQ ID NO: 1.

[0007] Furthermore, the nucleotide sequence of the polypeptide pka15 is as shown in SEQ ID NO: 2.

[0008] In a second aspect, the present invention provides a method for preparing the polypeptide pka15, which is synthesized by bioengineering or chemical synthesis methods.

[0009] In a third aspect, the present invention provides the use of the polypeptide pka15 in the preparation of a drug for inhibiting the proliferation of tumor cells.

[0010] Furthermore, the tumor cells include human non-small cell lung cancer cells and melanoma cells.

[0011] In a fourth aspect, the present invention provides a pharmaceutical composition for inhibiting the proliferation of tumor cells, which comprises the polypeptide pka15 and a pharmaceutically acceptable carrier and / or excipient.

[0012] In a fifth aspect, the present invention provides a reagent for inhibiting the proliferation of tumor cells, which comprises the polypeptide pka15 and an acceptable adjuvant.

[0013] In a sixth aspect, the present invention provides the use of the polypeptide pka15 in the preparation of a kit for detecting the proliferation ability of tumor cells.

[0014] Furthermore, the tumor cells include human non-small cell lung cancer cells and melanoma cells.

[0015] In a seventh aspect, the present invention provides a kit for detecting the proliferation ability of tumor cells, which comprises the polypeptide pka15 and an instruction manual.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] Through in-depth exploration, the present invention screened and obtained the novel polypeptide pka15. Through experiments, it was found that it can significantly inhibit the proliferation of tumor cells such as human non-small cell lung cancer cells or melanoma cells, and has the potential for preparing drugs or reagents for inhibiting the proliferation of tumor cells.

[0018] The polypeptide pka15 of the present invention can be synthesized by bioengineering technology or by chemical methods such as solid-phase synthesis method and liquid-phase synthesis method. It is easy to prepare in large quantities, its synthesis is simple and it can be prepared into polypeptide preparations, which is convenient for subsequent clinical application and promotion. It has no toxic and side effects, remarkable effects and good stability; as a polypeptide preparation, it has better safety compared with glucocorticoid and non-steroidal immunomodulatory drugs, and has lower drug costs and better curative effects.

[0019] In addition, the polypeptide pka15 with the function of inhibiting tumor cell proliferation of the present invention can also be used as a reagent for tumor medical research, providing a model for better understanding the treatment mechanism of tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The drawings described herein are used to provide a further understanding of the present application and form a part of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute a limitation to the present application.

[0021] In the drawings:

[0022] Figure 1 It is a mass spectrometry analysis chart of polypeptide pka15 (polypeptide 15aa) and amidated polypeptide pka15 (polypeptide 15aa-amidation) in Example 2 of the present invention.

[0023] Figure 2 It is an HPLC purity analysis chart of polypeptide pka15 (polypeptide 15aa) and amidated polypeptide pka15 (polypeptide 15aa-amidation) in Example 2 of the present invention.

[0024] Figure 3 It shows the analysis results of the effects of polypeptide pka15 (polypeptide 15aa) and amidated polypeptide pka15 (polypeptide 15aa-amidation) samples on the proliferation of human non-small cell lung cancer cells in Example 3 of the present invention.

[0025] Figure 4 It shows the analysis results of the effects of polypeptide pka15 (polypeptide 15aa) and amidated polypeptide pka15 (polypeptide 15aa-amidation) samples on the proliferation of mouse melanoma cells in Example 3 of the present invention.

[0026] It should be noted that these drawings and textual descriptions are not intended to limit the scope of the concept of the present invention in any way, but to illustrate the concept of the present invention to those skilled in the art through specific embodiments. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0027] In order to more clearly illustrate the overall concept of the present application, the following will be described in detail by way of examples in conjunction with the drawings of the specification. In the following description, a large number of specific details are given to provide a more thorough understanding of the present invention. However, it is obvious to those skilled in the art that the present invention can be implemented without one or more of these details. In other examples, in order to avoid confusion with the present invention, some technical features well known in the art are not described.

[0028] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art.

[0029] Unless otherwise indicated, the practice of the present invention will employ conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of those skilled in the art. Such techniques are well explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Animal Cell Culture (R.I. Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D.M. Weir and C.C. Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987); Current Protocols in Molecular Biology (F.M. Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (Mullis et al., eds., 1994); and Current Protocols in Immunology (J.E. Coligan et al., eds., 1991), each of which is hereby incorporated by reference in its entirety.

[0030] For those embodiments in which specific techniques or conditions are not indicated, the conventional techniques or conditions described in the literature within the art or according to the product specifications are followed.

[0031] Unless otherwise specified, in the following embodiments, for reagents or instruments whose manufacturers are not indicated, they are all conventional products that can be obtained through regular commercial channels.

[0032] In the first aspect of the present invention, a novel polypeptide pka15 with immunomodulatory efficacy is provided. The polypeptide is composed of 15 amino acids, so it is named pka15, and its amino acid sequence is shown in SEQ ID NO: 1, which is: N-terminal-LYILEEEEENTKRKD-C-terminal. In the present invention, the C-terminal and / or N-terminal of the polypeptide pka15 preferably also has an amide modification, specifically: LYILEEEEENTKRKD-NH2; the amide modification is used to ensure the stability of the polypeptide and does not affect the activity of the polypeptide.

[0033] The present invention also includes fragments, derivatives and analogs of polypeptide pka15. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to polypeptides that substantially retain the same biological function or activity as polypeptide pka15 of the present invention. A fragment, derivative or analog of polypeptide pka15 may be:

[0034] (1) a polypeptide having 1 or 2 conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, wherein the substituted amino acid residues may or may not be encoded by the genetic code, or

[0035] (2) a polypeptide having a substitution group in one or more amino acid residues, or

[0036] (3) a polypeptide formed by fusion of a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or

[0037] (4) A polypeptide formed by fusion of an additional amino acid sequence to the polypeptide sequence (such as a leader sequence or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein). According to the definition of the present invention, these fragments, derivatives and analogs fall within the scope known to those skilled in the art.

[0038] In the present invention, polypeptide pka15 may refer to a polypeptide having a sequence as shown in SEQ ID NO: 1. The term also includes polypeptides having the same function as polypeptide pka15 with one or more amino acids added to the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids having similar or similar properties generally does not change the function of the protein. For another example, adding one or more amino acids to the C-terminus and / or N-terminus generally does not change the function of the protein. The term also includes active fragments and active derivatives of polypeptide pka15.

[0039] In the present invention, it also includes a modified form of polypeptide formed by modifying one or several amino acids to increase the stability, half-life, and promote the efficacy of the polypeptide (usually without changing the primary structure), including: chemical derivatives of the polypeptide in vivo or in vitro, such as amidation or carboxylation. The modification also includes glycosylation. The modified form also includes a sequence having phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, phosphothreonine). It also includes polypeptides that are modified to improve the anti-hydrolysis performance or optimize the solubility performance.

[0040] The polypeptide of the present invention can also form a complex with other functional molecules, and the complex includes: the polypeptide described in the present invention, and a functional molecule connected to the polypeptide.

[0041] In some embodiments, the functional molecule is a marker with a tracing function, including but not limited to fluorescent dyes, MRI contrast agents, radioactive imaging agents, magnetic particles, or chemical reagents with a coloring function. For example, the marker with a tracing function or the functional small molecule can be fluorescein isothiocyanate (FITC).

[0042] In some embodiments, the functional molecule is a functional small molecule, including inorganic small molecules and organic small molecules, with a molecular weight less than 1000 daltons.

[0043] In some embodiments, the functional molecule is a functional macromolecule, such as a functional polypeptide (such as an antibody), a functional nucleic acid; preferably, the functional nucleic acid includes but not limited to: plasmid, siRNA, DNA, oligonucleotide, miRNA, antisense nucleic acid, etc.

[0044] The present invention also provides a nucleic acid molecule encoding the polypeptide pka15, and its nucleotide sequence is as shown in SEQ ID NO: 2, which is:

[0045] CTGTACATCCTGGAAGAAGAAGAAGAAAACACCAAACGTAAAGAC.

[0046] In the second aspect, a preparation method of the polypeptide pka15 is provided, including chemical synthesis (solid-phase synthesis or liquid-phase synthesis) and synthesis by biological engineering methods. Under the conditions allowing the expression of the polypeptide pka15, the host cells of the present invention are cultured, and the polypeptide or its variant is recovered from the cultured host cell culture.

[0047] In the third aspect, an application of the polypeptide pka15 in the preparation of a drug for inhibiting the proliferation of tumor cells is provided.

[0048] Furthermore, the tumor cells include human non-small cell lung cancer cells, melanoma cells.

[0049] In a fourth aspect, the present invention provides a pharmaceutical composition for inhibiting the proliferation of tumor cells, which comprises the polypeptide pka15 as described above and a pharmaceutically acceptable carrier and / or excipient.

[0050] In a fifth aspect, the present invention provides a reagent for inhibiting the proliferation of tumor cells, which comprises the polypeptide pka15 as described above and an acceptable adjuvant.

[0051] The polypeptide (or its variant) or the pharmaceutical composition of the present invention can be formulated into any dosage form known in the medical field, for example, tablets, pills, suspensions, emulsions, solutions, gels, capsules, powders, granules, elixirs, lozenges, suppositories, injections (including injection solutions, lyophilized powders), etc. In some embodiments, the polypeptide (or its variant) or the pharmaceutical composition of the present invention can be formulated into an injection solution or a lyophilized powder.

[0052] In addition, the polypeptide or its variant of the present invention can be present in the pharmaceutical composition in unit dosage form for ease of administration.

[0053] The polypeptide or its variant or the pharmaceutical composition of the present invention can be administered by any suitable method known in the art, including but not limited to oral, buccal, sublingual, ocular, topical, parenteral, rectal, intrathecal, intracisternal, inguinal, intravesical, topical (such as powders, ointments or drops), or nasal routes. However, for many therapeutic uses, the preferred route of administration / mode is parenteral administration (such as intravenous injection, subcutaneous injection, intraperitoneal injection, intramuscular injection). Those skilled in the art should understand that the route of administration and / or mode will vary according to the intended purpose. In a preferred embodiment, the polypeptide (or its variant) or the pharmaceutical composition of the present invention is administered by intravenous infusion or injection.

[0054] The polypeptide (or its variant) or the pharmaceutical composition provided by the present invention can be used alone or in combination, and can also be used in combination with another pharmaceutically active agent (such as an immunomodulator). Such another pharmaceutically active agent can be administered before, simultaneously or after the administration of the polypeptide (or its variant) or the pharmaceutical composition of the present invention.

[0055] As used herein, the term "pharmaceutically acceptable carrier and / or excipient" refers to a carrier and / or excipient that is pharmacologically and / or physiologically compatible with the subject and the active ingredient, which is well-known in the art (see, e.g., Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995), and includes but is not limited to: pH regulators, surfactants, ionic strength enhancers, osmotic pressure maintaining reagents, absorption delaying reagents, diluents, adjuvants, preservatives, stabilizers, etc. For example, pH regulators include but are not limited to phosphate buffers. Surfactants include but are not limited to cationic, anionic or non-ionic surfactants, such as Tween-80. Ionic strength enhancers include but are not limited to sodium chloride. Osmotic pressure maintaining reagents include but are not limited to sugars, NaCl and its analogs. Absorption delaying reagents include but are not limited to monostearate and gelatin. Diluents include but are not limited to water, aqueous buffers (such as buffered saline), alcohols and polyols (such as glycerol), etc. Adjuvants include but are not limited to aluminum adjuvants (such as aluminum hydroxide), Freund's adjuvants (such as complete Freund's adjuvant), etc. Preservatives include but are not limited to various antibacterial and antifungal reagents, such as thimerosal, 2-phenoxyethanol, parabens, chlorobutanol, phenol, sorbic acid, etc. Stabilizers have the meaning commonly understood by those skilled in the art, which can stabilize the desired activity of the active ingredient in the drug (such as the inhibitory activity against PSD-95 ubiquitination), and include but are not limited to sodium glutamate, gelatin, SPGA, saccharides (such as sorbitol, mannitol, starch, sucrose, lactose, dextran, or glucose), amino acids (such as glutamic acid, glycine), proteins (such as dried whey, albumin or casein) or their degradation products (such as lactalbumin hydrolysate), etc.

[0056] In use, a safe and effective amount of the polypeptide or polynucleotide encoding the same, or an expression vector containing the polynucleotide or a recombinant cell expressing the polypeptide according to the present invention is administered to an animal body (such as a human, a mouse, a zebrafish, etc.), wherein the safe and effective amount is usually at least about 1 g / kg body weight. Of course, the specific dose should also consider factors such as the administration route and the patient's health condition, which are within the scope of the skills of a skilled physician.

[0057] The precise effective amount for a particular subject depends on the subject's size and health condition, the nature and severity of the disorder, and the therapeutic agent and / or combination of therapeutic agents selected for administration. For a given condition, the effective amount can be determined by routine experimentation and can be judged by a clinician.

[0058] In a sixth aspect, the present invention provides the use of the polypeptide pka15 in the preparation of a kit for detecting the proliferative ability of tumor cells.

[0059] Further, the tumor cells include human non-small cell lung cancer cells and melanoma cells.

[0060] In a seventh aspect, the present invention provides a kit for detecting the proliferative ability of tumor cells, which includes the polypeptide pka15 and an instruction manual for use, and this instruction manual is for those skilled in the art to use in the correct manner.

[0061] The inventors of the present invention first discovered the polypeptide pka15, and its preparation can be based on any related techniques well-known in the art, such as synthesizing by solid / liquid phase synthesis method or expressing by genetic engineering technology through gene recombination and then purifying the protein to obtain.

[0062] The following combines specific examples and Figures 1 to 4 , and further elaborates the present invention, but the examples do not limit the present invention in any form.

[0063] Example 1 Biosynthesis of polypeptide pka15

[0064] Construction of recombinant vector

[0065] Synthesize the DNA sequence shown in SEQ ID NO: 2, introduce an NcoI restriction enzyme digestion site sequence CCATGG and an enterokinase cleavage site sequence DDDDK at the 5' end upstream of the synthesized sequence, and introduce a stop codon TAA and a BamHI restriction enzyme digestion site sequence GGATCC at the 3' end downstream of the sequence.

[0066] Use two restriction endonucleases, BamHI and NcoI, to digest the synthesized DNA sequence, and the digestion method is carried out according to the instruction manual of the restriction endonuclease. After digestion, perform agarose gel electrophoresis and cut and recover the band of the target size.

[0067] Use two restriction endonucleases, BamHI and NcoI, to digest the pET-28a(+) vector, and the digestion method is carried out according to the instruction manual of the restriction endonuclease. After digestion, perform agarose gel electrophoresis and cut and recover the band of the target size.

[0068] Use T4 DNA ligase to ligate the vector recovered after digestion with the DNA fragment. The ligation method is carried out with reference to the instruction manual of T4 DNA ligase.

[0069] The ligated product was transformed into Escherichia coli competent cells DH5α to obtain monoclonal strains. The monoclonal strains were verified by colony PCR using primers pka15F: GTAGAGGATCGAGATCTCGAT and pka15R: AAGGGT TATGCTAGTTATTGC.

[0070] The strains with positive colony PCR verification were cultured in LB liquid medium containing kanamycin, and then plasmids were extracted. The plasmid extraction method was carried out according to the instructions of the plasmid extraction kit.

[0071] The extracted plasmids were verified by sequencing using primer pka15F. After correct verification, the pET-28a-pka15 recombinant plasmid was obtained. After measuring the concentration of the plasmid using a ultra-micro ultraviolet spectrophotometer, it was stored in a -80 °C refrigerator.

[0072] Construction of host cells

[0073] The recombinant plasmid pET-28a-pka15 was transformed into the host cell Escherichia coli Rosetta(DE3) strain using the CaCl2 chemical transformation method. The transformation method was carried out according to "Molecular Cloning: A Laboratory Manual" to obtain monoclonal strains.

[0074] The monoclonal strains were verified by colony PCR using primers pka15F: GTAGAGGATCGAGATCTCGAT and pka15R: AAGGGT TATGCTAGTTATTGC. After correct verification, the host strain containing the pET-28a-pka15 recombinant plasmid was obtained.

[0075] The host strain containing the pET-28a-pka15 recombinant plasmid was cultured in LB liquid medium containing kanamycin, then sterile glycerol (final concentration 15%) was added, mixed well and aliquoted into cryotubes, labeled and stored in a -80 °C refrigerator.

[0076] The pka15 gene fragment with restriction enzyme site sequences at both ends was amplified by PCR using upstream and downstream primers containing restriction enzyme site sequences. The pka15 gene fragment and the pET-28a vector were respectively digested with restriction enzymes, and then the digested fragments were recovered. The vector and the gene fragment were ligated using T4 DNA ligase and transformed into Escherichia coli for positive clone screening. After verifying the plasmid sequencing of the positive clone single colonies, the pka15 gene was constructed into the pET-28a plasmid to obtain the first recombinant vector. The first recombinant vector was the pET-28a plasmid containing the pka15 gene, hereinafter referred to as pET-28a-pka15; the host cells used in each example and comparative example in this application were Escherichia coli.

[0077] a. Transform pET-28a-pka15 into Escherichia coli (for example, competent cell E. coli DH5α); pick monoclonal colonies of pET-28a-pka15 or inoculate the strain stored at -80°C into a small test tube containing 5 mL of LB liquid medium (Kan+, 100 μg / mL), and culture overnight at 37°C and 220 rpm as the seed solution.

[0078] b. Transfer the seed solution into 50 mL of LB liquid medium (Kan+, 100 μg / mL), and culture again at 37°C and 220 rpm on a shaker for activation.

[0079] c. Transfer the re-activated bacterial solution with an inoculation amount of 1% into 800 mL of 2YT liquid medium (Kan+, 100 μg / mL), and culture on a shaker at 37°C and 220 rpm until the OD600 is approximately 0.6 - 0.8.

[0080] d. Lower the shaker temperature to 16°C - 18°C. After the temperature of the cultured bacterial solution drops, add Isopropylthio-β-D-galactoside (IPTG) to a final concentration of 0.5 mM, and induce expression for 14 - 16 h.

[0081] e. After the expression is completed, collect the above cultured bacterial solution into a bottle, pre-cool the centrifuge to 4°C, centrifuge at 5500 rpm for 10 min.

[0082] f. Remove the supernatant, add 30 mL of protein purification buffer, and resuspend the bacterial cells with a vortex oscillator.

[0083] g. Centrifuge the resuspended bacterial cells again at 5500 rpm for 10 min. Pour out the supernatant, add 30 mL of protein purification buffer, resuspend the bacterial cells with a vortex oscillator (no solid particles allowed), pour into a 50 mL centrifuge tube, and store in a -80°C refrigerator.

[0084] Purification of polypeptide pka15

[0085] a. Preparation of crude enzyme solution: Resuspend 1.0 g of wet bacterial cells collected in 20 mL of equilibration buffer, and break the resuspended cells using a cell disruptor. The parameters of the cell disruptor are set to 300 W to prevent the influence of excessive temperature on enzyme activity. The disruption program is set to work for 1 s and pause for 3 s. At the same time, the disruption solution needs to be cooled with an ice-water mixture all the time. Stop the disruption when the suspension becomes clear and transparent. Centrifuge the disruption solution at 4°C and 12,000 rpm for 10 min, collect the supernatant, and filter through a 0.22 μm filter membrane to obtain the crude enzyme solution. All proteins used in this study have no tags, and the predicted isoelectric point of the protein is PI = 6.35. Therefore, a weakly basic anion group is selected for purification.

[0086] b. Ion exchange chromatography column regeneration and equilibration: For protein purification using a DEAE Sepharose Fast Flow anion exchange column, rinse with a buffer solution of high salt concentration (containing 1 - 2 M NaCl) at a flow rate of 1 mL / min for 3 - 5 column volumes, then rinse with 0.1 M NaOH for 3 - 5 column volumes, then rinse with the elution buffer for 3 - 5 column volumes, and then rinse with the equilibration solution until the parameters such as OD280, conductivity, and pH value of the detector are stable.

[0087] c. Loading and elution of the crude enzyme solution: Load the prepared crude enzyme solution at a loading rate of 0.5 mL / min, with a loading volume of 20 mL. After loading, rinse with the equilibration buffer for 3 - 5 column volumes, then elute using an increasing salt concentration gradient elution method with the elution buffer, collect each fraction, and confirm with protein electrophoresis. If the purification effect is not good, this step can be repeated, or further purification can be carried out using Sephadex G75 FF.

[0088] d. Protein concentration: Concentrate the target protein collected using the ultrafiltration membrane concentration method, use a 1 kDa protein concentration tube for concentration, centrifuge at 4°C and 5000 rpm for 30 min.

[0089] e. Protein desalting: Add an appropriate amount of PBS buffer (20 mM, pH 7.0) to dilute the concentrated protein, and place it in a dialysis bag (cut-off molecular weight 8 - 14 kDa), use 20 mM, pH 7.0 PBS dialysis solution, and let it stand in a 4°C refrigerator overnight, and change the dialysis solution once in the middle.

[0090] f. Storage of the ion exchange chromatography column: After use, rinse the ion exchange chromatography column with 1 M NaOH for 3 - 5 column volumes, and then rinse with 20% ethanol, and store it in a 4°C refrigerator.

[0091] Electrophoresis analysis of polypeptide pka15

[0092] a. Treatment of protein samples: Add the purified protein solution and 5× loading buffer in a ratio of 1:4 (v / v), heat in boiling water for 10 min, and set aside after completion.

[0093] b. Loading and electrophoresis: Place the precast protein gel (Genscript, SurePAGE, 4% - 20%) in the electrophoresis tank, and add the protein sample and Marker to the protein gel loading wells using a pipette.

[0094] c. Staining and decolorization: Remove the outer shell of the precast gel after electrophoresis, and automatically decolorize and stain it using a protein staining and decolorization instrument, with the staining time set to 15 min.

[0095] d. Protein gel analysis: After staining and decolorization, the protein gel was photographed and saved by a gel imager.

[0096] Example 2 Chemical synthesis of polypeptide pka15

[0097] In this example, solid-phase peptide synthesis (SPPS) method was used to produce polypeptide pka15. SPPS is to couple amino acids to the resin in sequence to form a peptide chain; after the sequence synthesis is completed, first deprotect the N-terminal Fmoc protecting group (or after completing the N-terminal modification), and then deprotect the side-chain protecting groups, and cleave the peptide segment from the resin:

[0098] 1) Coupling the first amino acid: Take an appropriate amount of modified resin, add the pre-prepared amino acid solution and coupling reagent to the resin, and react for a period of time;

[0099] 2) Removal of Fmoc: After adding the Pip / DMF solution for a period of time, filter the solvent under vacuum;

[0100] 3) Washing: Add DMF to the resin (washing step), and filter the solvent under vacuum;

[0101] 4) Resin detection: Put reagent A, B and a little resin into a test tube. Then put the test tube into a metal bath for a few seconds, and check whether the color of the resin has changed. If the color of the resin changes, the Fmoc group has been successfully removed;

[0102] 5) Amino acid condensation: Add the pre-prepared amino acid solution to the resin. Then add the coupling reagent, shake well for a period of time, and filter the solvent under vacuum;

[0103] 6) Repeat steps 2-5 until the synthesis of the last amino acid is completed.

[0104] In this example, a conventional solid-phase peptide synthesis method was used to synthesize the polypeptide according to the amino acid sequence of SEQ ID NO:2, and the correctness and purity of the obtained polypeptide were analyzed by mass spectrometry detection and HPLC detection. The results are as shown in Figure 1 and 2 respectively. Mass spectrometry analysis confirmed the correct amino acids, and the molecular weight of the obtained polypeptide pka15 was 1909.0 ( Figure 1 a), and the molecular weight of the obtained amidated polypeptide pka15 was 1907.8 ( Figure 1 b); the purity of the obtained polypeptide pka15 detected by HPLC was 95.04% ( Figure 2 a), and the purity of the obtained amidated polypeptide pka15 was 98.05%.

[0105] Effect of Polypeptide pka15 on Proliferation Inhibition Activity of Human Non-Small Cell Lung Cancer Cell Line A549 and Mouse Melanoma Cell Line B16

[0106] 1 Materials: Human non-small cell lung cancer cells (A549) and mouse melanoma cells (B16), RPMI 1640 medium, high-glucose DMEM, FBS, penicillin-streptomycin, PBS, two polypeptides pka15 and amidated polypeptide pka-15 (pka15-amidation).

[0107] 2 Methods: Take polypeptide solutions at 4 concentrations (0.125 mg / ml, 0.25 mg / ml, 0.5 mg / ml, 1 mg / ml) and a control without polypeptide, add them to A549 or B16 cells in a 96-well plate, and observe the proliferation status of the cells.

[0108] 3 Steps:

[0109] 3.1: Preparation of polypeptide samples and stock solutions at each concentration

[0110] The original polypeptide is bottled at 5 mg / vial. Directly pipette 1 ml of PBS into the polypeptide vial, and then vortex to dissolve and mix evenly. Label it as stock solution A with a concentration of 5 mg / ml.

[0111] Take 150 μl of stock solution A and add it to 150 μl of PBS in a new EP tube and mix well. The solution concentration is 2.5 mg / ml, labeled as stock solution B;

[0112] Take 150 μl of stock solution B and add it to 150 μl of PBS in a new EP tube and mix well. The solution concentration is 1.25 mg / ml, labeled as stock solution C;

[0113] Take 150 μl of stock solution C and add it to 150 μl of PBS in a new EP tube and mix well. The solution concentration is 0.625 mg / ml, labeled as stock solution D;

[0114] 3.2: Inoculating cells in 96-well plates

[0115] Take human non-small cell lung cancer cells and inoculate them into a 96-well plate, 2×10 3 cells per well. 100 μl / well. Each group of cells has 5 replicates per well, and a total of 25 wells are inoculated. Place them in a CO2 incubator for culture, and add two polypeptide reagents respectively the next morning.

[0116] 3.3: Before adding polypeptides to the 96-well plate, replace the fresh cell culture medium in advance at 80 μl / well.

[0117] Experimental settings: control group (20 μl PBS + 80 μl medium), experimental groups (polypeptide concentration 0.125 mg / ml: polypeptide concentration), experimental groups (polypeptide concentration 0.25 mg / ml: 20 μl C stock solution + 80 μl medium), experimental groups (polypeptide concentration 0.5 mg / ml: 20 μl B stock solution + 80 μl medium), experimental groups (polypeptide concentration 1 mg / ml: 20 μl A stock solution + 80 μl medium).

[0118] 3.4: MTT proliferation assay

[0119] 48 h after adding the polypeptide, 10 μl of MTT reagent solution was added to each well of the 96-well plate, incubated in an incubator at 37 °C for 3 h, then the supernatant was discarded, and then 150 μl of formazan solubilization solution was added to each well and dissolved on a shaker at room temperature for 10 min, and then the OD value at 570 nm was measured using an enzyme-linked immunosorbent assay (ELISA) reader.

[0120] 3.5: Calculation of proliferation rate

[0121] Proliferation rate = (OD of measurement well - OD of zero adjustment well) / OD of control * 100%

[0122] 3.6: Statistical difference analysis

[0123] Five replicates were used to perform one-way ANOVA analysis on the results of five concentrations, and the Student-Newman-Keuls test was used. Different letters were used to represent the significant differences in cell proliferation caused by different concentrations.

[0124] 4 Results: The evaluation results showed that both polypeptides had significant inhibitory effects on the proliferation of human non-small cell lung cancer cells and mouse melanoma cells, as shown respectively in Figure 3 and Figure 4 where 0 represents the control group, other values on the abscissa represent the concentrations of the polypeptides used, and different letters on the bar graph represent the significant differences in cell proliferation caused by different concentrations, with a significance criterion of < 0.05.

[0125] In summary, through cell culture experiments, the present invention observed the inhibitory effects of different doses of polypeptides on tumor cell proliferation. The experimental results showed that the polypeptide pka15 provided by the present invention had an obvious inhibitory effect on the proliferation of human non-small cell lung cancer cells and mouse melanoma cells, indicating that the inhibitory effect of the polypeptide pka15 on tumor cell proliferation was tumor-specific, and it could also be used as a reagent for tumor medical research, providing a model for better understanding the treatment mechanism of tumors and developing anti-tumor drugs. The polypeptide pka15 of the present invention was simple to synthesize, easy to prepare in large quantities, had low immunogenicity and low cost with significant effects, and was convenient for subsequent clinical application and promotion, thus having broad application prospects.

[0126] It should be noted that the embodiments described above are only the preferred embodiments of the present invention. For those of ordinary skill in the art, without departing from the principle of the present invention, several modifications, improvements, and equivalent substitutions can be made to the present invention, and these modifications, improvements, and equivalent substitutions are also considered to fall within the protection scope of the claims of the present invention.

Claims

1. A polypeptide pka15 having the function of inhibiting tumor cell proliferation, characterized in that: The amino acid sequence of the polypeptide pka15 is shown in SEQ ID NO:

1.

2. The polypeptide pka15 according to claim 1, characterized in that The nucleotide sequence of the polypeptide pka15 is shown in SEQ ID NO:

2.

3. The method for preparing polypeptide pka15 according to claim 1, characterized in that: The polypeptide pka15 is synthesized by bioengineering or chemical synthesis.

4. Use of the polypeptide pka15 according to claim 1 in the preparation of a drug for inhibiting tumor cell proliferation.

5. The use according to claim 4, characterized in that: The tumor cells include human non-small cell lung cancer cells and melanoma cells.

6. A pharmaceutical composition for inhibiting tumor cell proliferation, characterized in that: It comprises the polypeptide pka15 according to claim 1 and a pharmaceutically acceptable carrier and / or excipient.

7. An agent for inhibiting tumor cell proliferation, characterized in that: It comprises the polypeptide pka15 according to claim 1 and acceptable excipients.

8. Use of the polypeptide pka15 according to claim 1 in preparing a kit for detecting the proliferation ability of tumor cells.

9. The use according to claim 8, characterized in that: The tumor cells include human non-small cell lung cancer cells and melanoma cells.

10. A kit for detecting the proliferation ability of tumor cells, characterized in that: It comprises the polypeptide pka15 according to claim 1 and instructions for use.

Images