Application of 1, 3-butanediol in treatment of idiopathic pulmonary fibrosis

Abstract

The invention relates to the technical field of biological medicines, in particular to application of 1, 3-butanediol in treatment of idiopathic pulmonary fibrosis. 1, 3-butanediol inhibits pulmonary fibrosis and promotes lung function recovery by regulating AT2 cell proliferation, inhibiting differentiation of fibroblasts to myofibroblasts, inhibiting polarization of macrophages to M2 macrophages and regulating lipid metabolism.

Description

Technical Field

[0001] The present invention relates to the field of biopharmaceutical technologies, and particularly to the use of 1,3-butanediol in the treatment of idiopathic pulmonary fibrosis. Background Art

[0002] Pulmonary fibrosis (ILD) is a common outcome of chronic diseases caused by various internal and external pathogens. Its pathological process is an imbalance in the repair of lung tissue damage, leading to massive extracellular matrix remodeling and excessive deposition, ultimately resulting in changes in the lung tissue structure and loss of function, which is not conducive to alveolar gas exchange and causes dyspnea. Idiopathic Pulmonary Fibrosis (IPF) is a chronic, progressive, fibrotic interstitial lung disease with unknown etiology. Its pathogenesis has not been fully elucidated, and it is generally believed to be closely related to the interaction of multiple factors such as genetic susceptibility, environmental exposure (such as smoking, metal dust, organic dust), and aging. Its characteristic pathological change is usual interstitial pneumonia (UIP), which is manifested as subpleural area-dominant interstitial fibrosis, formation of fibroblast foci, and heterogeneity in the pathological stages of lung tissue in different regions. The clinical course of IPF shows chronic and slow progression, and its main manifestations are progressive dyspnea, often accompanied by dry cough and fine moist rales at the bases of both lungs. The course of the disease usually lasts from the onset of symptoms to significant decline in lung function for several months to several years. Some patients will experience acute exacerbation after the stable period, significantly increasing the risk of death. It should be particularly noted that pulmonary fibrosis is completely different from acute infectious pneumonia in terms of etiology, pathogenesis, histological manifestations, and treatment strategies. Infectious pneumonia is mainly an acute inflammatory response caused by the invasion of a clear pathogen, with the characteristics of rapid onset and short-term progression, and is usually treated with antibiotics; while IPF is a non-infectious disease, and its pathogenesis involves the abnormal repair process after micro-injury of alveolar epithelial cells, manifested as chronic and irreversible interstitial fibrosis, and is non-responsive to antibiotics.

[0003] Currently, there is still no radical treatment for IPF. Only pirfenidone and nintedanib have been approved internationally for delaying its course, but the efficacy is limited. Therefore, in view of the clinical characteristics of IPF as a chronic progressive and lethal lung disease, and the severe lack of treatment options, the development of new and effective intervention strategies has important clinical value and practical significance. Summary of the Invention

[0004] The present application clearly reveals the multiple mechanism of action of 1,3-butanediol in anti-fibrosis, improving pulmonary inflammation, promoting alveolar repair, and regulating lipid metabolism by systematically integrating evidence at the tissue, cell, molecular, and metabolic levels.

[0005] Specifically, through Examples 1-6 of this application, the potential therapeutic effect of 1,3-butanediol in the treatment of pulmonary fibrosis was comprehensively evaluated. The mice with pulmonary fibrosis model showed typical pathological changes, including decreased lung compliance, increased airway and tissue resistance, reduced lung volume, as well as damaged alveolar structure and excessive collagen deposition. At the same time, targeted lipidomics analysis showed that there was a significant abnormal accumulation of pro-inflammatory lipids and cholesterol esters in fibrotic lung tissue, suggesting that lipid metabolism disorder might be an important mechanism for the progression of fibrosis.

[0006] The intervention of 1,3-butanediol significantly improved the above phenotypes, showing good protective effects at multiple levels such as lung function, tissue structure, and molecular expression. It not only significantly increased the lung tissue compliance, reduced the respiratory system resistance and tissue elastic burden, and improved the lung ventilation ability, but also alleviated fibrotic lesions and collagen deposition at the pathological level and maintained the integrity of the lung structure. In addition, 1,3-butanediol effectively inhibited the abnormal accumulation of pro-inflammatory lipids and cholesterol esters in fibrotic lung tissue, revealing its potential mechanism of alleviating pulmonary fibrosis by regulating lipid metabolism.

[0007] Combined with the results of single-cell transcriptome sequencing, the key mechanism of 1,3-butanediol in the intervention of pulmonary fibrosis was further revealed at the cellular level. In macrophages, 1,3-butanediol significantly activated genes related to fatty acid oxidation and cholesterol synthesis (such as Prkaa1 , Cpt1a , Acox1 , Srebf2 , Hmgcr ), inhibited the pro-inflammatory and immune response pathways, and effectively weakened the excessive polarization of M1 to pro-fibrotic M2 phenotype, reducing extracellular matrix deposition, thereby inhibiting macrophage-mediated inflammation amplification and pro-fibrotic tissue remodeling at the source. In epithelial cells, 1,3-butanediol significantly promoted the proliferation of AT2 cells and restored their number, activated multiple key pathways including cholesterol metabolism, lipid homeostasis, and cell regeneration (such as Zbtb20 , Soat1 , Acsl4 ), and at the same time down-regulated the pro-fibrotic genes S100a8 and S100a9 , enhancing the epithelial repair ability. In fibroblasts, 1,3-butanediol not only effectively prevented their abnormal differentiation into myofibroblasts, but also down-regulated pro-fibrotic genes such as Tgfbi , Tgfbr3 , Spp1 , etc., and up-regulated anti-fibrotic and epithelial support factors such as Bmp4 and Rcn3 , etc., and at the same time activated cholesterol synthesis and fatty acid oxidation pathways such as Srebf2 , Hmgcr , Cpt1a , etc., promoting the restoration of interstitial homeostasis from the dual dimensions of metabolism and differentiation.

[0008] These comprehensive research results consistently confirm from multiple dimensions, including cell lineage, signaling pathways, metabolic characteristics, and lung function phenotypes: 1,3-butanediol precisely intervenes in the functional states and fate decisions of macrophages, epithelial stem cells AT2, and fibroblasts by regulating lipid metabolism across cell types, especially cholesterol metabolism, and synergistically inhibits the progression of pulmonary fibrosis and promotes the restoration of alveolar structure and function.

[0009] In the first aspect of the present invention, there is provided the use of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof in the preparation of a drug for preventing and / or treating pulmonary fibrosis.

[0010] In the second aspect of the present invention, there is provided the use of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof as the sole active ingredient in the preparation of a drug for preventing and / or treating pulmonary fibrosis.

[0011] The above-mentioned 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof achieves the prevention and / or treatment of pulmonary fibrosis through any one or a combination of the following two or more pathways: A) Inhibiting the polarization of macrophages into M2 macrophages; preferably, including inhibiting the polarization of M1 macrophages into M2 macrophages.

[0012] B) Enhancing the proliferation of AT2 cells to promote alveolar repair.

[0013] C) Restoring the number of AT1 cells.

[0014] D) Regulating lipid metabolism.

[0015] E) Inhibiting the differentiation of fibroblasts into myofibroblasts.

[0016] F) Reducing the level of FN1 protein.

[0017] Preferably, the above-mentioned D) includes: a) Reducing the level of one or more of ceramide, sphingomyelin, and / or lysophospholipid; and / or, b) Reducing the level of cholesterol and / or cholesterol ester.

[0018] Preferably, the above-mentioned 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof achieves the prevention and / or treatment of pulmonary fibrosis by enhancing the lipid metabolism activity of AT2 cells.

[0019] Preferably, the above-mentioned 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof achieves the prevention and / or treatment of pulmonary fibrosis by downregulating one or more of pro-fibrotic genes, upregulating anti-fibrotic genes, upregulating epithelial support factors, upregulating cholesterol synthesis-related genes, or upregulating fatty acid β-oxidation-related genes.

[0020] More preferably, the pro-fibrotic genes include Tgfbi , Tgfbr3 and Spp1 .

[0021] More preferably, the anti-fibrotic genes include Bmp4 .

[0022] More preferably, the cholesterol synthesis-related genes include Srebf2 and Hmgcr .

[0023] More preferably, the fatty acid β-oxidation-related genes include Cpt1a .

[0024] Preferably, the 1,3-butanediol or its pharmaceutically acceptable salt or solvate can increase the static compliance, inspiratory capacity, and forced vital capacity of the lung tissue.

[0025] Preferably, the 1,3-butanediol or its pharmaceutically acceptable salt or solvate can reduce airway resistance, respiratory system elasticity, tissue damping, and tissue elasticity.

[0026] Preferably, the 1,3-butanediol or its pharmaceutically acceptable salt or solvate can reduce lung density, shrink the consolidation range, and relieve the pathological thickening and inflammatory exudation of the lung parenchyma.

[0027] Preferably, the 1,3-butanediol or its pharmaceutically acceptable salt or solvate can reduce collagen deposition and alleviate alveolar structure damage and inflammatory cell aggregation.

[0028] Preferably, the 1,3-butanediol or its pharmaceutically acceptable salt or solvate can inhibit the expression level of fibronectin 1 (Fn1).

[0029] Preferably, the 1,3-butanediol or its pharmaceutically acceptable salt or solvate can upregulate pathways such as lipid metabolism regulation, fatty acid metabolism process, cholesterol metabolism regulation, and epithelial cell function maintenance.

[0030] Preferably, the 1,3-butanediol or its pharmaceutically acceptable salt or solvate can downregulate pathways such as extracellular matrix organization, collagen fiber formation, and inflammatory response regulation.

[0031] Preferably, the 1,3-butanediol or its pharmaceutically acceptable salt or solvate can inhibit the accumulation of pro-inflammatory lipids.

[0032] More preferably, the pro-inflammatory lipids include ceramide, sphingomyelin, and lysophospholipid.

[0033] Preferably, the 1,3 - butanediol or a pharmaceutically acceptable salt or solvate thereof can promote fatty acid oxidation, enhance the cholesterol biosynthesis pathway, and at the same time inhibit the accumulation of free cholesterol and cholesterol esters.

[0034] Preferably, the pharmaceutically acceptable salts include one or more of sodium salts, potassium salts, magnesium salts, or calcium salts.

[0035] Preferably, the pulmonary fibrosis includes primary pulmonary fibrosis, secondary pulmonary fibrosis, or idiopathic pulmonary fibrosis.

[0036] Preferably, the drug includes 1,3 - butanediol or a pharmaceutically acceptable salt or solvate thereof, and a pharmaceutically acceptable excipient.

[0037] The drug can be in any suitable dosage form, such as, but not limited to, tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, microemulsions, suspensions, injections, sprays, aerosols, powder aerosols, lotions, ointments, plasters, pastes, patches, eye drops, nasal drops, sublingual tablets, suppositories, effervescent tablets, dripping pills, gels, and so on.

[0038] The various dosage forms of the drug can be prepared according to the conventional production methods in the pharmaceutical field.

[0039] The drug can contain 0.01 - 99.5% by weight (specifically, 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%) of the 1,3 - butanediol or a pharmaceutically acceptable salt or solvate thereof.

[0040] More preferably, the pharmaceutically acceptable excipients include one or more of solvents, excipients, diluents, binders, lubricants, wetting agents, emulsifiers, preservatives, antioxidants, buffers, bacteriostatic agents, disintegrants, surfactants, suspending agents, solubilizers, thickeners, stabilizers, sweeteners, and fragrances.

[0041] In the third aspect of the present invention, there is provided a drug for preventing and / or treating pulmonary fibrosis, the drug including 1,3 - butanediol or a pharmaceutically acceptable salt or solvate thereof, and a pharmaceutically acceptable excipient.

[0042] In the fourth aspect of the present invention, there is provided a method for preventing and / or treating pulmonary fibrosis, the method including administering an effective amount of 1,3 - butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug described in the third aspect, to a subject in need.

[0043] The administration can be gastrointestinal administration or parenteral administration.

[0044] In a fifth aspect of the present invention, there is provided a method for inhibiting the polarization of M1 macrophages into M2 macrophages, the method comprising administering to a subject in need thereof an effective amount of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug described in the third aspect.

[0045] In a sixth aspect of the present invention, there is provided a method for enhancing the proliferation of AT2 cells and / or restoring the number of AT1 cells, the method comprising administering to a subject in need thereof an effective amount of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug described in the third aspect.

[0046] In a seventh aspect of the present invention, there is provided a method for inhibiting the differentiation of fibroblasts into myofibroblasts, the method comprising administering to a subject in need thereof an effective amount of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug described in the third aspect.

[0047] In an eighth aspect of the present invention, there is provided a method for improving lung function, the method comprising administering to a subject in need thereof an effective amount of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug described in the third aspect.

[0048] Preferably, the lung function includes a PV loop (Pressure-Volume Loop), inspiratory capacity (IC), respiratory resistance (Rrs), airway resistance (Rn), tissue damping (G), tissue elastance (H), elastic resistance of the respiratory system (Ers), static compliance (Crs), and forced vital capacity (FVC).

[0049] In a ninth aspect of the present invention, there is provided a method for regulating cholesterol homeostasis and reducing the accumulation of pro-inflammatory lipids, the method comprising administering to a subject in need thereof an effective amount of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug described in the third aspect.

[0050] The "method" described in the present invention can be for therapeutic purposes or for non-therapeutic purposes.

[0051] As used herein, the term "comprising" is an open-ended description that includes the specified components or steps described, as well as other specified components or steps that do not materially affect.

[0052] As used herein, the term "and / or" includes all combinations of the items connected by this term, and each combination should be regarded as having been separately listed in this application. For example, "A and / or B" includes "A", "A and B", and "B".

[0053] As used herein, the term "treat" means to slow down, interrupt, prevent, control, stop, alleviate, or reverse the progression or severity of a sign, symptom, disorder, disease condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, disease conditions, or disorders.

[0054] As used herein, the term "prevent" refers to all actions of inhibiting symptoms or delaying the progression of specific symptoms by administering the products described herein (such as the 1,3-butanediol or its pharmaceutically acceptable salts or solvates or drugs).

[0055] As used herein, the term "effective amount" refers to the amount or dose of the product described herein (such as the 1,3-butanediol or its pharmaceutically acceptable salts or solvates or drugs) that provides the desired treatment or prevention after being administered to a patient in a single or multiple doses.

[0056] As used herein, the term "subject" can be a human or a non-human animal (such as a non-human mammal), and the non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, a laboratory animal, etc. Preferably, the non-human mammals include, but are not limited to, pigs, cows, sheep, horses, donkeys, foxes, minks, jackals, camels, dogs, cats, rabbits, rats (such as rats, mice, hamsters, gerbils, chinchillas, squirrels), or monkeys, etc.

[0057] As used herein, the term "pharmaceutically acceptable" means that it neither significantly stimulates the organism nor inhibits the biological activity and properties of the active substance of the administered product.

[0058] As used herein, the term "pharmaceutically acceptable salt" refers to a salt prepared from a pharmaceutically acceptable non-toxic acid or base, and the acid or base includes an inorganic acid or base or an organic acid or base. The inorganic acids are selected from hydrochloric acid, hydrobromic acid, phosphoric acid, hydroiodic acid, or sulfuric acid. The inorganic bases are selected from calcium, magnesium, lithium, sodium, zinc, aluminum, or potassium. The organic acids are selected from formic acid, glycolic acid, propionic acid, acetic acid, succinic acid, methanesulfonic acid, ethanesulfonic acid, maleic acid, glutamic acid, benzoic acid, stearic acid, alginic acid, benzenesulfonic acid, glucuronic acid, pamoic acid, or galacturonic acid. The organic bases are selected from diethanolamine, choline, procaine, lysine, or 1,2-ethylenediamine.

[0059] As used herein, the "solvate" of the present invention refers to the physical association of a compound of the present invention (i.e., 1,3-butanediol) with one or more solvent molecules. This physical association includes various degrees of ionic and covalent bonding, such as hydrogen bonding. In some cases, the solvate can be isolated, for example, when one or more solvent molecules are incorporated into the lattice of a crystalline solid. Solvates include solution-phase and isolable solvates. Representative solvates include ethanolates or methanolates or hydrates and the like.

[0060] Advantages of the present application: 1. It was found in the present application that 1,3-butanediol (1,3-BD) has significant anti-fibrotic effects at multiple levels. Compared with the control group, the mice in the model group showed a significant decrease in body weight and a reduced survival rate, suggesting a severe course of bleomycin-induced pulmonary fibrosis; while the intervention with 1,3-butanediol not only significantly alleviated these clinically relevant phenotypes but also showed a good overall improvement trend, indicating its potential clinical application value in the treatment of pulmonary fibrosis.

[0061] 2. In the present application, 1,3-butanediol was administered by drinking water, which is simple to operate and has strong compliance. The results of functional tests showed that 1,3-butanediol significantly improved pulmonary dysfunction, including the recovery of the pressure-volume (PV) loop, an increase in the inspiratory capacity (IC), an increase in the static compliance (Crs), a decrease in the respiratory system resistance (Rrs) and tissue elastance (Ers), and the recovery of the forced vital capacity (FVC), indicating that it can effectively relieve alveolar structural damage, improve lung compliance and ventilation function.

[0062] 3. At the molecular level, 1,3-butanediol inhibits the abnormal expression of key fibrosis genes (such as fibronectin FN1), reduces collagen deposition and extracellular matrix remodeling in lung tissue, thereby slowing down the progression of pulmonary fibrosis. At the same time, 1,3-butanediol can upregulate the pathways related to lipid metabolism, cholesterol transport, and alveolar epithelial cell repair, promote the proliferation of AT2 cells and the recovery of the number of AT1 cells, and significantly improve alveolar structure and tissue homeostasis.

[0063] 4. 1,3-butanediol also shows good effects in inflammation regulation. It can effectively inhibit the accumulation of pro-inflammatory lipids (such as cholesterol, ceramide Cer, sphingomyelin SM, and lysophosphatidylcholine LPC) and other inflammatory mediators, reduce the activation of the inflammatory response and immune cell recruitment pathways, and alleviate oxidative stress damage, inhibiting the pathological extracellular matrix deposition and chronic inflammation process from the triple network levels of metabolism-immunity-repair, thereby further slowing down the development of pulmonary fibrosis.

[0064] 5. As a compound with a simple structure and clear metabolism, 1,3-butanediol has good pharmacokinetic properties and safety. No obvious toxic and side effects were observed after long-term administration of 1,3-butanediol in animal experiments. It has a wide safe dose range and high absorption efficiency, showing good pharmacological basis and application prospects. In summary, 1,3-butanediol is a candidate for metabolic intervention with a clear targeting mechanism, good safety and therapeutic potential, and is expected to be applied in the clinical treatment and drug development of pulmonary fibrosis and related diseases in the future. Description of the Drawings

[0065] Hereinafter, embodiments of the present invention will be described in detail with reference to the drawings, wherein: Figure 1 : Statistics of body weight and survival rate. Among them, there are 16 mice in the normal control group, 12 mice in the model group, and 11 mice in the treatment group. The abscissa is the number of days after the start of modeling. Figure a: Statistical results of the body weight of mice in each group. The body weight of all mice is normalized with their own body weight on the first day of modeling as 1; Figure b: Statistical results of the survival rate of mice in each group, shown as the survival percentage.

[0066] Figure 2 : Analysis of pulmonary function indexes of mice in each group (n = 7 in each group), including pressure-volume loop (PV loop), inspiratory capacity, respiratory system resistance, large airway resistance, tissue damping, tissue elasticity, respiratory system elasticity, static compliance and forced vital capacity.

[0067] Figure 3 : Results of CT imaging of mouse lungs. Figure a shows representative scanning images of the coronal and axial lungs of three groups of mice; Figure b shows a three-dimensional reconstruction map of tissue density constructed based on the full-lung CT scan data, including ventral and dorsal structures.

[0068] Figure 4 : Representative pathological staining images of lung tissues of mice in each group. Among them, Figure a: Representative image of Masson trichrome staining (n = 6, scale bar 2.00 mm); Figure b: Representative image of hematoxylin-eosin staining (H&E) (n = 6, scale bar 500 μm); Figure c: Representative image of Sirius red staining (n = 6, scale bar 50 μm). Figure d: Statistical quantification of fibrosis degree. Quantitative analysis of the Ashcroft score of lung tissue sections (n = 6 mice in each group; ≥8 fields of view were taken from each mouse and averaged).

[0069] Figure 5: Representative immunofluorescence staining images of SPC, Ki67, and PDPN in lung tissue (n = 6, scale bar = 20 μm). In immunofluorescence staining, Ki67 serves as a marker of cell proliferation, pro-surfactant protein C (pro-SPC) specifically labels alveolar type II epithelial cells (AT2), and podoplanin (PDPN) is a characteristic molecule of alveolar type I epithelial cells (AT1). Among them, the first row shows DAPI (blue, labeling cell nuclei), Ki67 (green), and pro-SPC (red) signals in sequence. The double-positive cells co-expressing green and red (Ki67 + / pro-SPC + ) represent AT2 cells in a proliferative state. The second row shows DAPI, PDPN, and pro-SPC signals to clarify the distribution and quantitative changes of AT1 and AT2 cells in the tissue.

[0070] Figure 6 : Changes in the expression of key molecules related to pulmonary fibrosis in the lung tissues of mice in each group. Among them, the mRNA expression level of Fn1 (Figure a) in lung homogenates was detected by RT–qPCR (n = 5 per group). Figure b shows the immunoblot result image, and Figure c shows the relative abundance of FN1 (n = 4 per group).

[0071] Figure 7 : GO functional enrichment analysis of differentially expressed genes (DEGs) between the normal control group and the model group (Figure a) and between the model group and the treatment group (Figure b).

[0072] Figure 8 : Lipid metabolism changes in the lung tissues of mice in each group. Among them, Figure a: Absolute quantitative analysis of representative lipid molecules (including cholesterol, CE 18:2, CE 18:3, CE 19:0, Cer d17:1 / 26:0, Cer d18:2 / 26:0, SM d18:1 / 17:1, SM d18:1 / 20:2, SM d18:1 / 24:2, LPCe 15:0, LPCe 18:2, and LPC 26:2); Figure b: Heatmap showing significantly different lipids (P < 0.05) identified by targeted lipidomics in the lung tissues of normal control group, model group, and treatment group mice (n = 5 per group).

[0073] Figure 9: Single-cell transcriptome sequencing results. Among them, Figure a: The integrated UMAP plot shows the distribution of various cell types in all samples, colored by cell type; Figure b: The expression distribution of classical marker genes for cell type annotation in the UMAP plot, with the color gradient representing the normalized expression level; Figure c: The UMAP plot is colored by experimental group to distinguish the normal control group, model group, and treatment group; Figure d: The UMAP plot is colored by individual sample to reflect the differences between samples; Figure e: Shows the proportion distribution of different cell types in each sample, colored by cell type; Figure f: Displays the average proportion of different cell types in each experimental group, colored by cell type (n = 3 for each group).

[0074] Figure 10 : Analysis results of macrophages and monocytes. Among them, Figure a: The UMAP plot shows the clustering results of macrophages and monocytes, including alveolar macrophages (AM), interstitial macrophages (IM), and monocytes; Figure b: The expression distribution of classical marker genes in the UMAP plot is used to assist cell annotation, with the color gradient representing the normalized expression level; Figure c: The violin plot shows the expression levels of typical AM-related genes; Figure d: The UMAP plot shows the distribution of M1-like and M2-like gene signature scores in the macrophage / monocyte population, with the color intensity representing the gene set score; Figure e: Pseudotime trajectory analysis of the M1-like to M2-like polarization process. The first row is the comparison between the normal control group and the model group, and the second row is the comparison between the model group and the treatment group. The trajectories are colored by cell subset, pseudotime, and experimental group respectively; Figure f: Shows the expression dynamics of representative genes during the M1 to M2-like transformation process, with the color gradient representing the expression intensity. The first row is the comparison between the normal control group and the model group, and the second row is the comparison between the model group and the treatment group.

[0075] Figure 11 : Analysis results of epithelial cells. Among them, Figure a: The UMAP plot shows the clustering results of epithelial cells, which are divided into six subpopulations, including AT1 cells, AT2 cells, intermediate cells, club cells, ciliated cells, and neuroendocrine cells; Figure b: The expression distribution of classical marker genes in the UMAP plot is used for cell type annotation, with the color gradient representing the normalized expression level; Figure c: In AT2 cells, GO functional enrichment analysis was performed based on the differentially expressed genes (DEGs) between the model group and the treatment group (adjusted P value < 0.05, |logFC| > log1.5); Figure d: The violin plot shows the expression of representative AT2-related genes related to the enriched GO pathways in Figure c.

[0076] Figure 12:Analysis results of stromal cells. Among them, Figure a: UMAP plot showing the clustering results of stromal cells, which are divided into four subpopulations; Figure b: Expression distribution of classical marker genes for cell type annotation in the UMAP plot, where the color gradient represents the normalized gene expression level; Figure c: Statistical analysis of the proportions of fibroblasts and myofibroblasts in all stromal cells in each sample (n = 3); Figure d: GO functional enrichment analysis performed on the differentially expressed genes (DEGs) (adjusted P-value < 0.05, |logFC| > log1.5) between the model group and the treatment group in fibroblasts; Figure e: Pseudotime trajectory analysis of stromal cells, colored by cell subpopulation, pseudotime process, and experimental group respectively. The first row shows the comparison between the normal control group and the model group, and the second row shows the comparison between the model group and the treatment group; Figure f: Violin plot showing the expression of representative fibroblast genes related to the enriched GO pathways in Figure d. Detailed implementation manners

[0077] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0078] In the following embodiments, the experimental methods are conventional methods unless otherwise specified; the reagents and biological materials can be obtained from commercial channels unless otherwise specified.

[0079] 1,3-Butanediol used in the examples was purchased from sigma (309443), and its structure is shown in Formula I. Formula I.

[0080] The experimental materials and experimental methods involved in this application:

[0081] 1. Mice and feeding conditions The animals used in this application are 8-week-old male C57BL / 6J mice weighing 22-26 grams, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The mice were housed in an animal room (a well-ventilated and temperature-controlled rodent breeding system) and had free access to standard feed and water. All animal experimental protocols were approved by the Animal Use and Care Committee (Animal Protocol No. 23-CGQ) and complied with the relevant national regulations and standards for the use of experimental animals.

[0082] 2. Monitoring of mouse body weight and survival rate Starting from the first day of model establishment, the body weights of the mice were measured daily and the death situations were recorded for the analysis of body weight changes and survival rates.

[0083] 3. Pulmonary function test of mice The mice were deeply anesthetized and fixed to the pulmonary function test system (FlexiVent, SCIREQ, Canada) after tracheal intubation was established. Five test modes, namely snapshot, prime / quick prime, PV loop, NPFE, and deep inflation, were carried out, and each mode was tested three times. The test indicators included: PV loop (Pressure-Volume Loop), inspiratory capacity (IC), respiratory resistance (Rrs), airway resistance (Rn), tissue damping (G), tissue elastance (H), elastic resistance of the respiratory system (Ers), static compliance (Crs), and forced vital capacity (FVC).

[0084] 4. Lung CT scan of mice After the mice were deeply anesthetized, they were fixed in the scanning slot, and high-resolution rapid in vivo micro-CT (SkyScan 1276, Bruker, Germany) was used for lung imaging. The scanning parameters were: current 200 μA, voltage 80 kV, pixel size 7.999873 μm, exposure time 600 ms, and rotation step 0.400°. After scanning, DataViewer software was used for CT data analysis and display.

[0085] 5. Masson trichrome staining of mouse lung tissue After dewaxing and hydrating the paraffin sections, for samples fixed with Bouin, post-treatment with Bouin solution was required. The sections were stained with Weigert iron hematoxylin for nuclei, differentiated with 1% hydrochloric acid alcohol, stained with acid fuchsin for cytoplasm, treated with phosphomolybdic acid and then counterstained with aniline blue, and finally rinsed with 1% glacial acetic acid, dehydrated, cleared, and sealed. In the staining results, collagen fibers were blue, cytoplasm and red blood cells were red, and cell nuclei were purple-black.

[0086] 6. Pathological HE staining of mouse lung tissue The fixed lung tissue was dehydrated, cleared and then embedded in paraffin. The section thickness was 5 μm. After dewaxing and rehydrating the sections, hematoxylin-eosin (HE) staining was performed, including nuclear staining (hematoxylin), differentiation (1% hydrochloric acid alcohol), blueing and cytoplasmic staining (eosin) in sequence. After dehydration with gradient ethanol and clearing with xylene, the sections were sealed with neutral balsam.

[0087] 7. Sirius Red staining of mouse lung tissue After staining the paraffin sections with Sirius Red staining solution, the characteristic birefringence signal of collagen fibers was observed under a polarized light microscope (BX51, Olympus, Japan).

[0088] 8. Immunofluorescence staining After dewaxing, antigen retrieval and membrane permeabilization with Triton X-100, the tissue sections were blocked with serum and incubated with primary and secondary antibodies. The nuclei were stained with DAPI. The main antibodies and fluorescent secondary antibodies used were as follows: SPC (Abcam, AB211326) and secondary antibody Anti-rabbit594 (Invitrogen, A21207), Ki67 (eBioscience, 14-5698-82) and secondary antibody Anti-rat488 (Invitrogen, A21208), PDPN (Invitrogen, 14-5381-85) and secondary antibody Anti-hamster488 (Invitrogen, A21110).

[0089] 9. RNA extraction The lung tissue was lysed in TRIzol (Invitrogen, USA). Proteins and RNA were separated by chloroform treatment. RNA was precipitated with isopropanol, washed with 75% ethanol, and dissolved in RNase-free water. The RNA concentration and purity (A260 / A280) were measured using a NanoDrop micro-spectrophotometer (Thermo Scientific, USA).

[0090] 10. Real-time fluorescence quantitative PCR (qPCR) The extracted RNA was reverse transcribed into cDNA. The reaction system was prepared using qPCR Master Mix, and the qPCR program (denaturation, annealing, extension) was set according to the enzyme characteristics. The primer sequences were as follows: Fibronectin1-F: ATGTGGACCCCTCCTGATAGT (SEQ ID NO: 1); Fibronectin1-R: GCCCAGTGATTTCAGCAAAGG (SEQ ID NO: 2); Housekeeping gene 18S-F: CCAGAGCGAAAGCATTTGCCAAGA (SEQ ID NO: 3); Housekeeping gene 18S -R: TCGGCATCGTTTATGGTCGGAACT (SEQ ID NO: 4).

[0091] 11. Protein extraction and Western blot Cells or tissues were lysed with pre-chilled RIPA lysis buffer containing inhibitors, and total proteins were collected by centrifugation and quantified by BCA method (Thermo Scientific, USA). After heating and denaturing the samples with loading buffer, electrophoresis was performed using a 4%-12% gradient gel (NuPAGE, USA), transferred to a PVDF membrane, blocked, and then incubated with primary and secondary antibodies respectively, and detected by chemiluminescence method. Antibody information is as follows: recombinant Anti-Fibronectin antibody (abcam, ab199056), Anti-alpha Tubulin antibody (abcam, ab7291).

[0092] 12. Bulk RNA sequencing analysis In Bulk RNA sequencing analysis, the screening criteria for differentially expressed genes (DEGs) were adjusted P value (Padj) < 0.05 and absolute log2 fold change (|log2FC|) > 1. Functional enrichment analysis of DEGs was evaluated by Gene Ontology (GO) analysis through the DAVID database (https: / / david.ncifcrf.gov). Significantly enriched pathways were defined as P value < 0.05.

[0093] 13. Lipidomics analysis Lung tissues of 5 model mice in each group were taken to prepare lipidomics samples following a standardized operation procedure. After recording the weight of each lung tissue sample, it was homogenized thoroughly using a tissue grinder. Chloroform / methanol extraction solution containing internal standard was added to the samples, followed by shaking, ultrasonic fragmentation, and centrifugation in sequence to separate the organic phase and aqueous phase. The supernatant was carefully transferred to a new tube, and the remaining precipitate was further treated with chloroform and KCl solution, shaken again and centrifuged to extract lipids. Finally, the obtained supernatants were combined and concentrated at low temperature. One blank sample was set in every 10–20 test samples to monitor the background signal. All samples were processed according to the preset standardized procedure to ensure consistency between the experimental group and the normal control group and minimize batch effects as much as possible. Lipid profiling was performed using an Agilent G6495C triple quadrupole liquid chromatography-mass spectrometry system, which is equipped with iFunnel technology to improve ion transmission efficiency and combined with SWARM-assisted optimization to achieve high-throughput and accurate lipid quantification.

[0094] 14. Single-cell transcriptomics data analysis The single-cell transcriptome (scRNA) analysis method is as follows: The original sequencing data was processed using CellRanger (version 4.0.8), reads were aligned to the mouse reference genome mm10 (Mus musculus), and cells in each sample were identified according to the default parameters. Preliminary quality control, dataset integration, and cell clustering analysis were all performed through Scanpy (version 1.10.2). Cells with fewer than 200 expressed genes, cells with a mitochondrial gene proportion exceeding 20%, and genes detected in fewer than 3 cells were excluded. Doublets were identified and removed using the default parameters of Scrublet. After preprocessing to remove low-quality cells and doublets, Harmony was used for batch effect correction and sample integration. Subsequently, the top 2,000 genes with the greatest variability were selected for principal component analysis (PCA), and clustering was completed using the Leiden algorithm (resolution = 0.2) based on the construction of the neighborhood graph. Cell subsets included epithelial cells, endothelial cells, immune cells, stromal cells, and mesothelial cells. Macrophage / monocyte clusters were functionally classified into M1 type (pro-inflammatory) and M2 type (pro-fibrotic). Module scores were calculated using the score genes function. Differential expression gene (DEG) analysis was performed using the FindMarkers function in Seurat, with the screening criteria of Padj < 0.05, |log2FC| > 1.5, and the gene expression proportion exceeding 25% in any one group. Significant DEGs were further subjected to pathway enrichment analysis in the GO and KEGG databases using the clusterProfiler R package (version 4.10.1). To show the expression changes between conditions, first, the NormalizeData function was used for normalization, then the average expression level of each sample was calculated using the AverageExpression function and log-transformed. In pathway enrichment visualization, genes were sorted by log2FC and input into clusterProfiler for GSEA analysis, and finally, it was displayed through the GseaVis package.

[0095] 15. Statistical analysis All data were expressed as mean ± SD. Student's t-test was used for comparison between groups, and a p-value less than 0.05 was considered statistically significant, where, represented P < 0.05, represented P < 0.01, represented P < 0.001, represented P < 0.0001.

[0096] Example 1: 1,3 - Butanediol extends the survival time of mice with pulmonary fibrosis 1. Grouping of mice and establishment of animal model of pulmonary fibrosis The mice were randomly divided into a normal control group, a model group and a 1,3 - butanediol treatment group (i.e., the treatment group).

[0097] Among them, the mice in the 1,3 - butanediol treatment group were administered the drug 7 days before modeling until the 21st day after BLM injection. The drug was dissolved in drinking water at a ratio of 10% (v / v) and freely available for drinking. At the same time, the general condition of the mice was observed and recorded daily.

[0098] Modeling: After the mice were anesthetized, the trachea was exposed. A 25 - gauge needle was used to inject 2 U / kg bleomycin (abbreviated as BLM) into the trachea through the gap between the tracheal cartilage rings. The mice in the normal control group and the 1,3 - butanediol treatment group were injected with an equal amount of PBS solution. After the operation, the tracheotomy site was sutured and the mice were allowed to recover. The mice were sacrificed on the 21st day after BLM injection, and the lung tissues were collected for subsequent experiments.

[0099] 2. Results The monitoring results of the body weight and survival rate of the mice in each group showed that, compared with the normal control group, the body weight of the model group decreased significantly after model establishment. The 1,3 - butanediol treatment group effectively alleviated the decrease in body weight. Moreover, mice in the model group began to die from the 7th day, and the survival rate also decreased significantly. However, the treatment group effectively extended the survival time of the mice and alleviated the decrease in the survival rate (see Figure 1 ).

[0100] Example 2: 1,3 - Butanediol inhibits the phenotype of pulmonary fibrosis According to the same grouping, modeling and drug - administration protocol as in Example 1, in this example, pulmonary function tests, imaging and histopathological observations were further carried out on the 21st day after modeling to confirm the therapeutic effect of 1,3 - butanediol on pulmonary fibrosis. The specific results are as follows: Figure 2The pulmonary function test results are shown, comprehensively characterizing the pulmonary physiological states of mice in different treatment groups. The results of the PV loop pressure-volume control stepwise curve show that compared with the normal control group, the lung volume of the model group is significantly decreased at the same airway pressure, suggesting impaired lung compliance; while the curve of the treatment group is shifted upward as a whole, indicating that it has a significant effect on improving lung compliance. Further analysis of multiple pulmonary function parameters shows that there are obvious increases in airway resistance (including large airway resistance and respiratory system resistance), elevated tissue damping, elevated tissue elasticity, elevated respiratory system elasticity, decreased compliance (such as static compliance), decreased inspiratory capacity, and decreased forced vital capacity in the model group, presenting a typical state of impaired pulmonary function. In contrast, the treatment group has significant improvements in key indicators such as static compliance, inspiratory capacity, and forced vital capacity, and at the same time, airway resistance, respiratory system elasticity, tissue damping, and tissue elasticity are all significantly decreased, suggesting that 1,3-butanediol intervention significantly alleviates the mechanical disorders of the airway and lung parenchyma and improves pulmonary ventilation and compliance performance. In summary, it is further confirmed from the functional level that 1,3-butanediol plays a role in improving lung tissue structure and inhibiting pulmonary fibrosis.

[0101] Figure 3 showed the pulmonary imaging changes of mice in different treatment groups. As Figure 3 seen in a, the lung tissue of the normal control group has good transparency and clear structure, and there are no abnormal shadows in the open airway; while the model group shows obvious increased density of the lung parenchyma, large patchy ground-glass-like shadows, and disordered lung markings, suggesting extensive pathological changes such as pulmonary fibrosis, alveolar structure collapse, and interstitial hyperplasia. In contrast, the treatment group (i.e., the 1,3-butanediol treatment group) shows significantly reduced lung density, clearer lung markings, and reduced consolidation range, suggesting that it can effectively relieve the pathological thickening and inflammatory exudation of the lung parenchyma. Figure 3 The three-dimensional reconstruction diagram in b further verifies the above findings at the structural level. The contour of the lung tissue in the model group collapses, is irregular, and the solid area increases, and the lung volume is significantly reduced. While in the treatment group (i.e., the 1,3-butanediol treatment group), relatively complete and well-expanded lung lobe structures can be seen on both the ventral and dorsal sides, and the consolidated tissue decreases, suggesting the recovery of lung volume and gas exchange function. In summary, 1,3-butanediol significantly reduces pulmonary inflammation and fibrosis lesions at the imaging level, improves the structural integrity and functional state of the lungs, and further supports its potential therapeutic effect in the intervention of pulmonary fibrosis.

[0102] Figure 4Representative pathological staining images of the lung tissues of mice in the normal control group, model group, and treatment group are shown, including Masson trichrome staining, hematoxylin-eosin (H&E) staining, and Sirius red staining, which were used to evaluate the degree of pulmonary fibrosis, changes in tissue structure, and collagen deposition, respectively. The results of Masson staining showed that a large amount of blue collagen deposition appeared in the lung tissues of the model group, indicating significant fibrotic changes. After treatment with 1,3-butanediol, the blue area decreased significantly, and the lung tissue structure was more complete, indicating that the degree of fibrosis was significantly alleviated ( Figure 4 in a). The results of H&E staining showed that the alveolar wall in the model group was significantly thickened, the structure was disordered, and a large number of inflammatory cells infiltrated, showing severe inflammatory damage characteristics. However, 1,3-butanediol intervention significantly reduced the destruction of alveolar structure and the aggregation of inflammatory cells, and the lung tissue tended to return to a normal morphology ( Figure 4 in b). The results of Sirius red staining showed that the abnormal accumulation of type I and type III collagens was indicated by the deposition of a large amount of intertwined red and yellow collagens in the lung tissues of the model group. In the treatment group, both the deposition area and degree were significantly reduced, further verifying the inhibitory effect of 1,3-butanediol on pulmonary fibrosis ( Figure 4 in c). Figure 4 The quantitative analysis results in d showed that the Ashcroft fibrosis score of the control group was close to 0, and the score of the model group increased significantly, indicating obvious fibrotic changes in the lung tissues. In contrast, the Ashcroft score of the 1,3-butanediol treatment group was reduced by approximately 50% compared with the model group ( : P<0.0001), indicating that the degree of fibrosis was significantly alleviated, suggesting that 1,3-butanediol had a significant effect on reducing the pathological degree of pulmonary fibrosis. Figure 5 Representative immunofluorescence staining images of SPC, Ki67, and PDPN in the lung tissues of mice in the normal control group, model group, and 1,3-butanediol treatment group are shown (n = 6; scale bar, 20 μm), which were used to evaluate the regenerative repair status of alveolar epithelial cells. The results of immunofluorescence analysis showed that 1,3-butanediol treatment could significantly relieve the depletion of AT2 cells and promote alveolar repair. Specifically, the proportion of double-positive cells of Ki67 and pro-SPC in the total pro-SPC-positive cells in the 1,3-butanediol group was significantly higher than that in the model group, indicating that it significantly enhanced the proliferation ability of AT2 cells. At the same time, the number of PDPN-positive AT1 cells and pro-SPC-positive AT2 cells in the model group decreased significantly, while 1,3-butanediol treatment could partially restore it, further supporting its role in promoting the proliferation of AT2 cells and maintaining the stability of the AT1 cell population, which was helpful for the repair of alveolar structure and the improvement of lung function. The above results verified the positive effect of 1,3-butanediol on the regeneration of alveolar epithelial cells in improving pulmonary fibrosis at the cellular level.

[0103] Example 3: Molecular-level verification of the inhibitory effect of 1,3-butanediol on pulmonary fibrosis In this example, the changes in the expression of key molecules related to pulmonary fibrosis were detected at the molecular level on the 21st day after modeling. The specific results are as follows: Analysis at the molecular level was as follows Figure 6 As shown, the results of quantitative reverse transcription PCR (RT–qPCR) indicated that the mRNA expression level of fibronectin 1 (Fn1) in the model group was significantly increased compared with that of the housekeeping gene 18S, while the overexpression of the above gene was significantly inhibited by 1,3-butanediol treatment. Further immunoblot (Western blot) results showed that the protein expression level of FN1 in the lung tissue of mice in the model group was significantly increased on the 21st day, and 1,3-butanediol intervention could significantly reduce the fibrosis-induced upregulation of FN1 protein, suggesting its anti-fibrotic effect at the molecular level.

[0104] Example 4: Study on the gene pathway of the inhibitory effect of 1,3-butanediol on pulmonary fibrosis In this example, the changes in gene pathways were detected at the gene pathway level on the 21st day after modeling.

[0105] Figure 7 showed the results of GO enrichment analysis, comparing the biological processes involved in differentially expressed genes (DEGs) between the normal control group and the pulmonary fibrosis model group (a) and between the pulmonary fibrosis model group and the 1,3-butanediol treatment group (b) respectively. The screening criteria were adjusted P value < 0.05 and |logFC| > log2. Figure 7 Panel a in showed that during the process of fibrosis, the upregulated GO pathways were mainly involved in cell–matrix adhesion, tissue remodeling, collagen metabolism, regulation of inflammatory response, and organization of the outer capsule structure, etc., suggesting the abnormal activation of genes related to extracellular matrix remodeling, signal transduction, and cell motility during fibrosis; while the downregulated GO pathways were enriched in respiratory system development, lung epithelial development, and epithelial cell proliferation, etc., reflecting the significant impairment of the regeneration and repair ability of lung tissue in the fibrotic state. Figure 7 Panel b in showed that the significantly upregulated GO pathways after 1,3-butanediol treatment included lipid metabolism and transport regulation, fatty acid metabolism process, and epithelial cell proliferation, etc., suggesting that it could promote metabolic reprogramming and support lung epithelial repair; while the downregulated pathways were involved in extracellular matrix organization, collagen fiber formation, regulation of inflammatory response, etc., which were consistent with the anti-fibrotic and anti-inflammatory mechanisms. In summary, this GO analysis revealed the potential mechanism of 1,3-butanediol in exerting anti-fibrotic effects by regulating lipid metabolism, inhibiting matrix deposition, and restoring alveolar epithelial function at the transcriptional level.

[0106] Example 5: Metabolic-level study of the inhibitory effect of 1,3-butanediol on pulmonary fibrosis In this example, lipid metabolism changes in lung tissue were detected at the metabolic level on the 21st day after modeling.

[0107] Figure 8 It shows the lipid metabolism changes in the lung tissues of mice in the normal control group, model group, and 1,3-butanediol treatment group, further revealing its potential anti-fibrotic mechanism. Figure 8 In a, the results of absolute quantification analysis of representative lipids are shown, covering various lipid subtypes closely related to inflammation and fibrosis, such as cholesterol, cholesterol esters (CE 18:2, CE 18:3, CE 19:0), ceramides (Cer d17:1 / 26:0, Cer d18:2 / 26:0), sphingomyelins (SM d18:1 / 17:1, SM d18:1 / 20:2, SM d18:1 / 24:2), and lysophospholipids (LPCe 15:0, LPCe 18:2, LPC 26:2). Figure 8 In b, it is a heat map of differentially expressed lipids identified by targeted lipidomics (n = 5), showing that in the pulmonary fibrosis model, the levels of multiple pro-inflammatory lipids (including ceramides, sphingomyelins, and lysophospholipids) are significantly increased, suggesting that they may accelerate lung tissue injury and fibrosis progression by promoting alveolar epithelial cell apoptosis, enhancing vascular permeability, and activating fibroblast migration. And 1,3-butanediol treatment significantly inhibited the accumulation of these lipids, reduced the burden of pro-inflammatory mediators, and had a clear anti-fibrotic effect. Further analysis also found that cholesterol esters, as a form of cholesterol storage, were significantly increased in the fibrosis group, while 1,3-butanediol could reduce total cholesterol and its esterification products (such as CE 18:2, CE 18:3, CE 19:0, etc.) by about 30%, suggesting that it can promote fatty acid oxidation, enhance the downstream pathway of cholesterol biosynthesis, and at the same time inhibit the abnormal accumulation of free cholesterol and cholesterol esters. In summary, 1,3-butanediol inhibits the activation of fibrosis-related pathways at the metabolic level by regulating cholesterol homeostasis and reducing the accumulation of pro-inflammatory lipids, thereby playing a role in alleviating the process of pulmonary fibrosis.

[0108] Example 6: Mechanism study of 1,3-butanediol in inhibiting pulmonary fibrosis To clarify the inhibitory effect and potential mechanism of 1,3-butanediol in pulmonary fibrosis (PF), single-cell transcriptome sequencing (scRNA-seq) was performed on the whole lung tissue samples of mice in the normal control group, model group (21 days after modeling), and treatment group (21 days after modeling) in this example.

[0109] After quality control and doublet removal, scRNA-seq data from 104,802 cells were obtained (a). Based on classical cell lineage markers, a total of seven major cell populations were identified: 18,419 NK / T cells ( Cd3d 、 Cd3eand Nkg7 ), 12,164 stromal cells ( Col1a1 ), 3,181 epithelial cells ( Epcam ), 6,551 endothelial cells ( Pecam1 ), 28,335 macrophages / monocytes ( Ear1 , Cx3cr1 , C1qa and Flt3 ), 19,038 B cells ( Cd79a ), and 17,114 neutrophils ( Csf3r ) ( Figure 9 in a, b). Each group contained three biological replicates ( Figure 9 in c, d), and the relative abundances of the above cell populations in different groups and disease stages were presented ( Figure 9 in e, f).

[0110] In idiopathic pulmonary fibrosis (IPF), alveolar epithelial cells are repeatedly damaged, leading to impaired regenerative capacity of alveolar type II epithelial cells (AT2), thereby disrupting the structural integrity and barrier function of the alveolar epithelium. Fibroblasts are abnormally activated during fibrosis and differentiate into myofibroblasts, which in turn leads to excessive deposition of extracellular matrix (ECM) and fibrotic remodeling of lung tissue. Macrophages shape the inflammatory and fibrotic microenvironment by polarizing into classical (M1) and alternative (M2) types. Therefore, AT2 cells, fibroblasts, and macrophages, as three types of cells that play key roles in the occurrence and progression of IPF, have become the core focus of research and therapeutic intervention for this disease. In this example, further analysis of epithelial cells (AT2), stromal cells (fibroblasts), and macrophages was performed, and the results are as Figures 10 - 12 shown. Specifically: Figure 10 The results revealed the potential mechanism of 1,3 - butanediol in regulating the composition and functional state of macrophage subsets during pulmonary fibrosis. The UMAP clustering results showed that among 28,335 macrophages and monocytes, they could be clearly divided into functional subsets such as alveolar macrophages (AM), interstitial macrophages (IM), and monocytes ( Figure 10 in a, b). Further functional subtype analysis showed that in AM, 1,3 - butanediol significantly upregulated lipid and cholesterol metabolism - related pathways, including key genes for fatty acid oxidation (such as Prkaa1 , Cpt1a , Acox1 , Acox3 ) and genes in the cholesterol synthesis pathway (such as Srebf2 , Hmgcr , Fdps ) ( Figure 10In c), it simultaneously inhibited the pathways related to inflammation and immune response, suggesting that it slowed down the pro-inflammatory phenotype of AM by improving metabolic homeostasis.

[0111] In addition to being anatomically divided into AM and IM, lung macrophages can also be polarized according to their functional states during pulmonary fibrosis, differentiating into classically activated (M1 type) or alternatively activated (M2 type) macrophages. M1 macrophages enhance the immune response by secreting pro-inflammatory cytokines and chemokines, presenting a pro-inflammatory phenotype, while M2 macrophages show a typical pro-fibrotic phenotype by activating fibroblasts and promoting extracellular matrix (ECM) deposition. These two functional subtypes play a key role in maintaining pulmonary homeostasis and regulating tissue remodeling. Therefore, the study further constructed an M1 / M2 scoring system based on a representative gene set ( Figure 10 In d), and performed a pseudotime trajectory analysis ( Figure 10 In e). The results showed that there was an obvious trend of M1 to M2-like polarization in the fibrosis group, accompanied by increased expression of pro-fibrotic genes (such as Spp1 , Fn1 , Ctsd ) and lipid metabolism regulators (such as Lpl ) ( Figure 10 In f). In the 1,3-butanediol intervention group, this conversion process was significantly weakened, suggesting that it may slow down the progression of pulmonary fibrosis by inhibiting excessive M2-like polarization and reducing excessive ECM deposition. In summary, the results indicate that 1,3-butanediol effectively intervenes in the macrophage-driven pro-fibrotic process by regulating the metabolic state and functional polarization direction of AM, and plays a significant anti-fibrotic role at the cellular level.

[0112] Figure 11 The results demonstrated the key role of 1,3-butanediol in improving the recovery and functional regulation of epithelial cells, especially AT2 cells, in pulmonary fibrosis. In the UMAP clustering analysis, a total of six epithelial cell subsets were identified, including AT1 cells, AT2 cells, intermediate cells expressing both AT1 and AT2 markers, as well as club cells, ciliated cells, and neuroendocrine cells ( Figure 11 In a, b). Further analysis found that the proportion of AT2 cells decreased significantly in the model group and recovered significantly in the 1,3-butanediol intervention group, suggesting its potential role in promoting alveolar repair.

[0113] GO functional enrichment analysis showed that the differentially expressed genes in AT2 cells of the treatment group were significantly enriched in pathways such as cholesterol metabolism, lipid synthesis, and lipid homeostasis, while downregulating the pathways related to epithelial cell apoptosis and inhibited proliferation ( Figure 11 In c). The representative genes related to these pathways were significantly upregulated in the treatment group, including the cholesterol biosynthesis gene Zbtb20, cholesterol esterification genes Soat1 , as well as genes related to fatty acid oxidation Acsl4 and Acox1 , suggesting that 1,3-butanediol can enhance the lipid metabolism activity of AT2 cells. In addition, the profibrotic genes S100a8 and S100a9 that are significantly upregulated in the state of pulmonary fibrosis were significantly inhibited in the treatment group, further supporting its anti-fibrotic effect at the cellular level ( Figure 11 d).

[0114] Combining the above results with immunofluorescence analysis ( Figure 7 ), it shows that 1,3-butanediol promotes the regeneration and functional recovery of the alveolar structure at the cellular level by enhancing the proliferation ability and lipid metabolism activity of AT2 cells and partially restoring the number of AT1 cells, thus playing an important protective role in the intervention of pulmonary fibrosis.

[0115] Figure 12 The results revealed the important role of 1,3-butanediol in regulating the fate transition of fibroblasts, inhibiting the progression of fibrosis, and promoting lung repair. In the UMAP clustering analysis of 12,164 stromal cells, a total of four major subpopulations were identified, including fibroblasts ( Col13a1 , Col14a1 ), myofibroblasts ( Acta2 , Tagln ), mesothelial cells ( Msln ), and smooth muscle cells ( Smpx ) ( Figure 12 a, b). In the pulmonary fibrosis model, the proportion of fibroblasts decreased significantly by about 47%, while the myofibroblasts increased significantly, suggesting that the fibrosis process is accompanied by the phenotypic transformation of fibroblasts into myofibroblasts ( Figure 12 c). After 1,3-butanediol intervention, the proportion of fibroblasts increased by about 70% compared with the fibrosis group, returning to near the basal level, suggesting its role in inhibiting the expansion of myofibroblasts and promoting interstitial remodeling ( Figure 12 c).

[0116] GO functional enrichment analysis showed that the differentially expressed genes in the fibroblasts of the treatment group were significantly enriched in pathways such as epithelial repair, lipid metabolism, and cholesterol biosynthesis, suggesting that 1,3-butanediol can activate the tissue repair function of fibroblasts through metabolic reprogramming ( Figure 12 d). Pseudotime trajectory analysis showed that fibrosis significantly promoted the transformation of fibroblasts into myofibroblasts, while 1,3-butanediol intervention effectively retained the fibroblast state and inhibited its differentiation into myofibroblasts, suggesting that it can slow down the progression of fibrosis by intervening in the cell fate trajectory ( Figure 12 e).

[0117] Expression analysis of representative genes further supported the above mechanism ( Figure 12 in f): profibrotic genes Tgfbi , Tgfbr3 and Spp1 were significantly downregulated in the treatment group. These genes promote the proliferation, activation, and ECM deposition of fibroblasts in fibrosis; while the antifibrotic genes Bmp4 (inhibiting fibroblast differentiation) and Rcn3 that support the survival of AT2 cells were inhibited in the fibrosis group but were restored after treatment with 1,3-butanediol. In addition, the treatment group also significantly upregulated cholesterol synthesis-related genes Srebf2 , Hmgcr and fatty acid β-oxidation-related genes Cpt1a , suggesting that 1,3-butanediol plays multiple roles in promoting metabolic homeostasis and inhibiting the progression of fibrosis.

[0118] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0119] In addition, it should be noted that, in the case of no contradiction, the various specific technical features described in the above specific embodiments can be combined in any suitable manner. To avoid unnecessary repetition, the present invention will not separately describe various possible combination methods.

Claims

1. The use of 1,3 - butanediol or a pharmaceutically acceptable salt or solvate thereof in the preparation of a drug for preventing and / or treating pulmonary fibrosis.

2. The use of 1,3 - butanediol or a pharmaceutically acceptable salt or solvate thereof as the sole active ingredient in the preparation of a drug for preventing and / or treating pulmonary fibrosis.

3. The application according to claim 1 or 2, characterized in that, The 1,3 - butanediol or a pharmaceutically acceptable salt or solvate thereof achieves the prevention and / or treatment of pulmonary fibrosis through any one or a combination of two or more of the following pathways: A) Inhibiting the polarization of macrophages into M2 - type macrophages; B) Enhancing the proliferation of AT2 cells to promote alveolar repair; C) Restoring the number of AT1 cells; D) Regulating lipid metabolism; E) Inhibiting the differentiation of fibroblasts into myofibroblasts; F) Reducing the level of FN1 protein.

4. The application according to claim 3, characterized in that The item A) includes inhibiting the polarization of M1 - type macrophages into M2 - type macrophages.

5. The application according to claim 3, characterized in that, The item D) of regulating lipid metabolism includes: a) Reducing the level of one or more of ceramide, sphingomyelin, and / or lysophospholipid; and / or, b) Reducing the level of cholesterol and / or cholesterol ester.

6. The application according to claim 1 or 2, characterized in that, The 1,3 - butanediol or a pharmaceutically acceptable salt or solvate thereof achieves the prevention and / or treatment of pulmonary fibrosis by enhancing the lipid - metabolism activity of AT2 cells.

7. The application according to claim 1 or 2, characterized in that, The pharmaceutically acceptable salts include one or more of sodium salt, potassium salt, magnesium salt, or calcium salt.

8. The application according to claim 1 or 2, characterized in that, The pulmonary fibrosis includes idiopathic pulmonary fibrosis, secondary pulmonary fibrosis, or primary pulmonary fibrosis.

9. The application according to claim 1 or 2, characterized in that The drug includes 1,3 - butanediol or a pharmaceutically acceptable salt or solvate thereof, and pharmaceutically acceptable excipients.

10. The application according to claim 9, wherein, The pharmaceutically acceptable excipients include one or more of solvents, excipients, diluents, binders, lubricants, humectants, emulsifiers, preservatives, antioxidants, buffers, bacteriostatic agents, disintegrants, surfactants, suspending agents, solubilizers, thickeners, stabilizers, sweeteners, or fragrances.

Images