AuAgPt ternary alloy nano-frame, preparation method thereof and application of AuAgPt ternary alloy nano-frame in anti-tumor preparation

Abstract

The invention discloses an AuAgPt ternary alloy nano-framework, a preparation method thereof and application of the AuAgPt ternary alloy nano-framework in anti-tumor preparations, and belongs to the field of biomedical nano-materials. The AuAgPt ternary alloy nano frame is a hollow octahedral nano frame formed by 12 AuAgPt ternary alloy edges, and the nano frame has plasmon photothermal conversion performance, catalase activity and peroxidase-like activity, and can be used for preparing the nano frame. The aptamer has the characteristics that the aptamer can form a covalent bond with glutathione (GSH), the aptamer with the framework surface capable of being modified and specifically bound with tumor cells is used for tumor targeted delivery and the like, the aptamer can be bound in a targeted manner and internalized into the tumor cells, and after near-infrared laser irradiation, the cell temperature can be increased to 42 DEG C, reactive oxygen species (ROS) can be generated, GSH can be consumed, and the tumor targeting effect is achieved. In addition, the content change of small molecule metabolites in cells can be driven through a low-temperature photothermal effect, the metabolic state is disturbed, the redox balance in the cells is destroyed, the tumor cells are induced to generate ferroptosis and apoptosis, and the low-temperature photothermal treatment of tumors is realized.

Description

Technical Field

[0001] The present invention relates to a AuAgPt ternary alloy nano-framework and a preparation method thereof, and also relates to an application of the AuAgPt ternary alloy nano-framework in the preparation of an anti-tumor preparation. In particular, it relates to an application method of using the AuAgPt ternary alloy nano-framework as a plasmonic photothermal agent, a catalyst and a GSH depleting agent to induce ferroptosis and apoptosis of tumor cells by regulating the content of metabolites in tumor cells. The present invention belongs to the field of biomedical nanomaterials. Background Art

[0002] Malignant tumor is one of the major diseases threatening human life and health. Photothermal therapy refers to a treatment method that uses materials with high photothermal conversion efficiency to convert light energy into heat energy under the irradiation of near-infrared light to directly kill tumor cells. However, when using high temperature (50°C and above) to kill tumor tissues, it will also cause damage to surrounding normal tissues. Therefore, low-temperature photothermal therapy has emerged. Low-temperature photothermal therapy usually performs hyperthermia at a lower temperature (not higher than 42°C). However, due to its limited hyperthermia effect, other methods are needed to synergistically enhance the therapeutic effect.

[0003] Nanomaterials with catalytic activity can undergo chemical reactions (Fenton reaction, Fenton-like reaction) at the tumor site to promote the generation of ROS. High concentrations of ROS can damage the functions of proteins, lipids, and nucleic acids, prompting tumor cell apoptosis. In addition, by consuming reduced GSH in tumor cells with nanomaterials, the key factor glutathione peroxidase 4 (GPX4) that resists lipid oxidation in cells can be inactivated, inducing ferroptosis of cells. On the other hand, when low-temperature photothermal therapy increases the cell temperature, it also simultaneously accelerates the catalytic reaction rate of the nanomaterials and enhances their catalytic activity, and the two can play a synergistic anti-tumor role.

[0004] Noble metal nano-hollow frameworks are a new type of nanomaterials made of noble metals (such as gold, silver, platinum, etc.), which have advantages such as high surface area, high conductivity, and high catalytic activity, and have broad application prospects in the fields of catalysis, sensing, biomedicine, etc. The local surface plasmon resonance effect (LSPR) of noble metal nanostructures is beneficial to generate photothermal and catalytic effects. On the one hand, plasmonic nanomaterials can absorb light energy and convert it into heat energy under light irradiation. On the other hand, noble metals such as platinum have peroxidase and peroxidase-like activities and can catalyze H2O2 to generate ROS, such as hydroxyl radicals (·OH), singlet oxygen ( 1 O2) and superoxide radicals (·O 2-), etc. These free radicals have strong oxidizing properties and can damage the cell membranes, organelles, and DNA of tumor cells, thereby inducing apoptosis of tumor cells. In addition, plasmonic nanomaterials can be conjugated with ligands such as aptamers that specifically bind to tumor cells through Au-S interactions. Utilizing the targeting ability of aptamers, the materials can be enriched at the tumor site, reducing their distribution in other normal tissues. Under 808 nm near-infrared laser irradiation, plasmonic nanomaterials can locally heat the tumor tissue, accelerate the catalytic activity of the materials, generate ROS, and consume GSH, inducing ferroptosis and apoptosis of tumor cells.

[0005] The normal functions of cells rely on the dynamic interactions of metabolite molecules in the cytoplasm. In addition to chemodynamic therapy triggered by the catalytic reactions of photothermal agents, hollow nanostructures with plasmon excitation on the inner and outer surfaces can also cause local heat generation within cells and create temperature gradients, which drive self-organized convection within the cytoplasm. These convections affect the transport and subcellular localization of metabolite molecules and may disrupt the cellular metabolic balance, ultimately affecting cell functions. Existing literature has demonstrated that an increase in temperature can accelerate the transmembrane transport of intracellular molecules by enhancing the passive diffusion of substances and the permeability of cell membranes. In addition, higher temperatures can reduce the cytoplasmic viscosity, increase membrane fluidity by altering acyl chain dynamics, and increase the frequency of molecular interactions. These changes will alter metabolite distribution, substance transport, and the normal metabolic state, disrupt the cellular redox balance, cause cellular oxidative stress, and promote ferroptosis and apoptosis.

[0006] At present, there are still some technical bottlenecks in the preparation of noble metal nano-hollow frameworks and their application in tumor therapy, mainly including the following aspects:

[0007] 1. Complex preparation methods: Currently, the main preparation methods of noble metal nano-hollow frameworks include template methods, self-assembly methods, electrodeposition methods, etc. These methods usually require multiple-step reactions and complex operation processes. The preparation process is cumbersome and the cost is relatively high.

[0008] 2. Difficulties in controlling size and morphology: The size and morphology of noble metal nano-hollow frameworks have important effects on their properties. However, it is still relatively difficult to control the size and morphology during the current preparation process, and it is difficult to achieve precise regulation.

[0009] 3. Stability issues: Noble metal nano-hollow frameworks are easily affected by the external environment during use, such as temperature, humidity, acidity, etc., resulting in a decrease in their stability, which affects their performance and service life.

[0010] 4. Problem of single performance: Currently, most of the existing noble metal nano - frameworks are single - metal nano - frameworks, with relatively single performance, low photocatalytic activity and low photothermal conversion efficiency. The synthesis of bimetallic or multi - metallic alloy nano - frameworks is challenging and requires a reasonable synthesis strategy to control the occurrence of chemical reactions.

[0011] Based on the above technical bottlenecks, it is necessary to explore a simpler, more efficient and lower - cost preparation method to achieve precise control of the size and morphology of multi - alloy noble metal nano - frameworks, improve their photothermal performance, catalytic performance and stability, so as to promote their application in tumor treatment. Summary of the Invention

[0012] Aiming at the technical problems existing in the prior art, the first object of the present invention is to provide a AuAgPt ternary alloy nano - framework, which has good plasmonic photothermal conversion performance, catalytic activity and GSH - binding performance. It can be conjugated with an aptamer with tumor - targeting ability to specifically target tumor cells and enter the cytoplasm, and disrupt the cell metabolic state through local intracellular thermal effects.

[0013] The second object of the present invention is to provide a preparation method of the AuAgPt ternary alloy nano - framework. This preparation method has a simple operation process, mild reaction conditions and strong controllability, and can solve the technical problems such as the difficulty in controlling the size and morphology of existing plasmonic nanomaterials, single composition performance and low photothermal conversion efficiency.

[0014] The third object of the present invention is to provide an application of the AuAgPt ternary alloy nano - framework in the preparation of anti - tumor preparations. The AuAgPt ternary alloy nano - framework simultaneously has good plasmonic photothermal conversion performance, catalytic activity (catalase and peroxidase - like activity) and GSH - binding performance. Conjugating it with an aptamer with tumor - targeting ability can form a specific anti - tumor preparation, which can target and treat tumors through low - temperature photothermal, catalytic activity and metabolic regulation ability, and induce ferroptosis and apoptosis of tumor cells.

[0015] To achieve the above technical objectives, the present invention provides a AuAgPt ternary alloy nano - framework, which is a hollow octahedral nano - framework composed of 12 AuAgPt ternary alloy edges.

[0016] The nano-framework of the present invention is composed of an AuAgPt ternary alloy. Generally, Au and Ag have excellent local surface plasmon resonance (LSPR) characteristics in the near-infrared region and are suitable for tumor photothermal therapy, but their catalytic activity in the tumor microenvironment is low. While Pt has excellent plasmon catalytic performance and enzyme-like activity in the tumor microenvironment. Therefore, constructing an AuAgPt ternary alloy and combining the advantages of each metal can, on the one hand, increase the active sites, regulate the electronic structure, and improve the mass transfer performance, thereby enhancing the catalytic activity; on the other hand, it can enhance light absorption and improve the photothermal conversion efficiency, thus endowing it with excellent photothermal performance. At the same time, the nano-framework is designed as a hollow nano-structure, enabling LSPR excitation on both its inner and outer surfaces, which can not only enhance the optical performance, promote heat diffusion, and improve molecular adsorption, but also increase the catalytic efficiency. In summary, the AuAgPt ternary alloy nano-framework obtained through the comprehensive design of the alloy composition and structure has excellent photothermal and catalytic properties. As a preferred embodiment, the edges of the AuAgPt ternary alloy are composed of Au, Ag, and Pt in an atomic ratio of 0.3~0.7:0.1~0.3:0.2~0.5. This metal ratio can fully exert the performance of each metal and synergistically enhance the photothermal and catalytic properties. At the same time, this ratio can prevent the collapse of the framework edges and ensure the stability and uniformity of the framework structure.

[0017] As a preferred embodiment, the length of the edges of the AuAgPt ternary alloy is 20~60 nm.

[0018] As a preferred embodiment, the edges of the AuAgPt ternary alloy form a nano-framework structure with a particle size of 30~90 nm.

[0019] As a preferred embodiment, the intersection of the vertices of the edges of the AuAgPt ternary alloy is a circular plane with a plane diameter of about 5~20 nm.

[0020] The present invention also provides a preparation method for the AuAgPt ternary alloy nano-framework, which includes the following steps:

[0021] 1) Synthesize gold octahedral nanoparticles using the gold seed growth method;

[0022] 2) Deposit platinum on the edges of the gold octahedral nanoparticles to form gold octahedral nanoparticles with platinum loaded on the edges;

[0023] 3) Etch the gold octahedral nanoparticles with platinum loaded on the edges to form a hollow shape, obtaining an AuPt binary alloy nano-framework;

[0024] 4) Deposit silver and gold on the edges of the AuPt binary alloy nano-framework simultaneously to obtain the AuAgPt ternary alloy nano-framework.

[0025] The preparation method of the AuAgPt ternary alloy nanoframe provided by the present invention is a wet chemical synthesis method. The operation process is simple and the reaction conditions are mild. The prepared AuAgPt ternary alloy nanoframe has a particle size of 30-90 nm, which is an alloy doped with gold, silver and platinum. The interior of the frame is hollow. The frame is composed of 12 edges, and the length of each edge is 20-60 nm. The intersection of the vertices of the edges is a circular plane with a diameter of 5-20 nm. It has excellent characteristics such as high yield, uniform morphology, and easy control of size and morphology.

[0026] As a preferred solution, the preparation process of the gold octahedral nanoparticles is as follows:

[0027] a) First, add 60-100 μL of chloroauric acid solution with a concentration of 15-30 mM to 6-10 mL of cetyltrimethylammonium bromide solution with a concentration of 60-100 mM, and then quickly add 400-800 μL of sodium borohydride solution with a concentration of 5-20 mM, and stir and react for 2-5 h to form a gold seed solution; the gold seeds prepared by the preferred solution have a particle size of 1-10 nm;

[0028] b) Sequentially add 0.1-1 mL of chloroauric acid solution with a concentration of 20-40 mM, 5-10 mL of ascorbic acid solution with a concentration of 0.1-0.5 M, and 5-10 mL of gold seed solution diluted 50-100 times to 400-600 mL of cetyltrimethylammonium bromide solution with a concentration of 10-20 mM, and stir and react for more than 12 h to form a first-stage growth product solution;

[0029] c) Sequentially add 1-3 mL of chloroauric acid solution with a concentration of 10-25 mM, 5-10 mL of ascorbic acid solution with a concentration of 0.05-0.2 M, and 135-150 mL of the first-stage growth product solution to 200-250 mL of cetyltrimethylammonium bromide solution with a concentration of 10-20 mM, stir and react at 25-35 °C for 3-6 h, and then perform centrifugal separation to obtain gold octahedral nanoparticles. The optical density value (OD value) of the gold octahedral nanoparticles is adjusted to 1.0 by an ultraviolet-visible spectrophotometer.

[0030] As a preferred embodiment, the preparation process of the edge platinum-loaded gold octahedron nanoparticles is as follows: Add 6-10 μL of a sodium iodide solution with a concentration of 0.05-0.2 M to 10-20 mL of a cetyltrimethylammonium bromide solution with a concentration of 40-60 mM, mix well, then add 4-10 mL of the gold octahedron nanoparticles, mix and let stand for more than 3 min. Then add 10-20 μL of a silver nitrate solution with a concentration of 1-10 mM and 400-800 μL of an ascorbic acid solution with a concentration of 0.05-0.2 M, and react at a temperature above 60 °C for more than 1 h. Then add 400-800 μL of a dilute hydrochloric acid solution with a concentration of 0.05-0.2 M and 100-200 μL of a chloroplatinic acid solution with a concentration of 3-8 mM, and react in an environment with a temperature above 70 °C for more than 2 h to obtain an edge platinum-loaded gold octahedron nanoparticle solution. Due to the lattice mismatch between gold and platinum, to enable platinum to selectively grow on the 12 edges of the gold octahedron nanoparticles, a thin Ag layer needs to be first loaded on the surface of the gold octahedron particles. The silver transition layer is used to achieve the displacement reaction between Ag and Pt under special acidic conditions. The Ag located at the edge, i.e., the edge, is preferentially deposited by Pt, thereby realizing the alloying of AuPt.

[0031] As a preferred embodiment, the preparation process of the AuPt binary alloy nanoframe is as follows: Add 4-10 μL of a sodium iodide solution with a concentration of 0.05-0.2 M to 10-20 mL of a cetyltrimethylammonium bromide solution with a concentration of 40-100 mM, mix well, then add 4-10 mL of the edge platinum-loaded gold octahedron nanoparticle solution, mix and let stand for more than 3 min. Then add 300-800 μL of a chloroplatinic acid solution with a concentration of 1-10 mM, react in an environment with a temperature above 40 °C for more than 1 h, then centrifuge to collect the AuPt binary alloy nanoframe and disperse it in 4-10 mL of water to form an AuPt binary alloy nanoframe dispersion. The AuPt binary alloy nanoframe is generated by selectively etching the edge platinum-loaded gold octahedron nanoparticles. Most of the gold inside the nanoparticles is selectively etched using Au 3+ to make the interior hollow, and the remaining edges are composed of gold and platinum.

[0032] As a preferred embodiment, the preparation process of the AuAgPt ternary alloy nanoframework is as follows: Add 1-10 mL of the AuPt binary alloy nanoframework dispersion into 0.5-5 mL of a cetyltrimethylammonium chloride solution with a concentration of 0.05-0.5 M, mix well, and then successively add 40-100 μL of an AgNO3 solution with a concentration of 1-10 mM, 40-100 μL of an HAuCl4 solution with a concentration of 1-8 mM, and 40-100 μL of an ascorbic acid solution with a concentration of 5-20 mM. React at a temperature above 40 °C for more than 20 min. Through one-step reduction on the surface of the AuPt binary alloy nanoframework, gold and silver are co-deposited on the platinum surface to form an AuAgPt ternary alloy nano-octahedral hollow framework (AuAgPt NFs).

[0033] The preparation method of the AuAgPt ternary alloy nanoframework of the present invention specifically includes the following steps:

[0034] 1) Synthesize gold octahedral nanoparticles by the gold seed growth method:

[0035] The specific process is as follows:

[0036] a) Add 60-100 μL of a chloroauric acid solution (HAuCl4·3H2O) with a concentration of 15-30 mM to 6-10 mL of a cetyltrimethylammonium bromide (CTAB) solution with a concentration of 60-100 mM. Subsequently, quickly add 400-800 μL of a sodium borohydride (NaBH4) solution with a concentration of 5-20 mM to the above mixture, stir and react for 2-5 h to form a gold seed solution. The gold seed solution is diluted 50-100 times with deionized water for standby.

[0037] b) Sequentially add 0.1-1 mL of an HAuCl4 solution with a concentration of 20-40 mM, 5-10 mL of an ascorbic acid (AA) solution with a concentration of 0.1-0.5 M, and 5-10 mL of the diluted gold seed solution to 400-600 mL of a CTAB solution with a concentration of 10-20 mM, stir and react for more than 12 h to obtain a first-stage growth product solution.

[0038] c) Sequentially add 1-3 mL of an HAuCl4 solution with a concentration of 10-25 mM, 5-10 mL of an AA solution with a concentration of 0.05-0.2 M, and 135-150 mL of the first-stage growth product solution to 200-250 mL of a CTAB solution with a concentration of 10-20 mM, stir and react at 30 °C for 3-6 h. The generated gold octahedral nanoparticle product is collected by centrifugation and washed twice with water. Subsequently, use a UV-visible spectrophotometer to adjust the optical density value (OD value) of the gold octahedral nanoparticles to 1.0.

[0039] 2) Using octahedral gold nanoparticles as a template, platinum is deposited on the edges of the octahedral gold nanoparticles to prepare octahedral gold nanoparticles with platinum loaded on the edges:

[0040] The specific preparation process is as follows: Add 6 - 10 μL of a sodium iodide (NaI) solution with a concentration of 0.05 - 0.2 M to 10 - 20 mL of a CTAB solution with a concentration of 40 - 60 mM, gently shake and mix well. Subsequently, add 4 - 10 mL of octahedral gold nanoparticles with an OD value of 1.0, shake well and let stand for more than 3 min. Finally, add 10 - 20 μL of a silver nitrate (AgNO3) solution with a concentration of 1 - 10 mM and 400 - 800 μL of an AA solution with a concentration of 0.05 - 0.2 M, and react in an environment with a temperature higher than 60 °C for more than 1 h. Then, add 400 - 800 μL of dilute hydrochloric acid with a concentration of 0.05 - 0.2 M and 100 - 200 μL of a chloroplatinic acid (H2PtCl6) solution with a concentration of 3 - 8 mM to the reaction system, and react in an environment with a temperature higher than 70 °C for more than 2 h. After the reaction, centrifuge to collect Au - Pt OPs, wash with deionized water 2 - 3 times, and finally disperse in 4 - 10 mL of deionized water for use, where AgNO3 and AA are used as the silver precursor and reducing agent respectively.

[0041] 3) Etch away most of the gold in the octahedral gold nanoparticles with platinum loaded on the edges to create a hollow interior, and the edges are composed of gold and platinum to prepare an AuPt binary alloy nanoskeleton:

[0042] The specific preparation process is as follows: Add 4 - 10 μL of a sodium iodide (NaI) solution with a concentration of 0.05 - 0.2 M to 10 - 20 mL of a CTAB solution with a concentration of 40 - 100 mM, gently shake and mix well. Subsequently, add 4 - 10 mL of the dispersion of octahedral gold nanoparticles with platinum loaded on the edges, shake well and let stand for more than 3 min. Finally, add 300 - 800 μL of a HAuCl4 solution with a concentration of 1 - 10 mM, and react in an environment with a temperature higher than 40 °C for more than 1 h. After the reaction, centrifuge to collect the AuPt binary alloy nanoskeleton, wash with deionized water 2 - 3 times, and finally disperse in 4 - 10 mL of deionized water for use.

[0043] 4) Deposit silver on the edges of the AuPt binary alloy nanoskeleton to prepare an AuAgPt ternary alloy nanoskeleton (AuAgPt NFs):

[0044] The specific preparation process is as follows: 1 - 10 mL of AuPt binary alloy nanoframe dispersion is added to 0.5 - 5 mL of cetyltrimethylammonium chloride (CTAC) solution with a concentration of 0.05 - 0.5 M. Subsequently, 40 - 100 μL of AgNO3 solution with a concentration of 1 - 10 mM, HAuCl4 solution with a concentration of 1 - 8 mM, and AA solution with a concentration of 5 - 20 mM are added respectively. The reaction is carried out in an environment above 40 °C for more than 20 min. After the reaction, AuAgPt NFs are collected by centrifugation and washed 2 - 3 times with deionized water, and finally dispersed in deionized water.

[0045] 5) Using human liver cancer cells as a tumor cell model, a nucleic acid aptamer that can specifically target human liver cancer cells is modified on the surface of the AuAgPt ternary alloy nanoframe:

[0046] The SH-thiol modified AP613-1 nucleic acid aptamer (sequence: SH-TAACGCTGACCTTAGCTGCATGGCTTTACATGTTCCA) (100 μM, 10 μL) is mixed with the AuAgPt NFs solution (20 ng / mL, 100 μL) and incubated for 3 h. After incubation, it is centrifuged at 5500 rpm for 10 min, and the precipitated AuAgPt-AP NFs are dissolved in HEPES buffer (pH 7.40) for storage.

[0047] The present invention also provides an application of the AuAgPt ternary alloy nanoframe, which is applied to the preparation of an anti-tumor preparation.

[0048] As a preferred scheme, the AuAgPt ternary alloy nanoframe and a thiol-modified nucleic acid aptamer with tumor targeting ability are covalently bonded to form an anti-tumor preparation; the anti-tumor preparation has the functions of tumor targeting ability, plasmonic photothermal conversion performance, high catalytic activity (catalase and peroxidase-like activity), GSH consumption performance, and disrupting the content of intracellular metabolites, and can induce ferroptosis and apoptosis of tumor cells in a low-temperature photothermal manner to play an anti-tumor role.

[0049] The AuAgPt ternary alloy nanoframe of the present invention has excellent plasmonic photothermal conversion performance, and the photothermal conversion efficiency is 40% - 60% under the excitation of 808 nm laser.

[0050] The AuAgPt ternary alloy nanoframe of the present invention has catalase and peroxidase-like activity, and can catalyze the decomposition of H2O2 to produce •OH, O2 and 1 O2.

[0051] The AuAgPt ternary alloy nanoframework of the present invention can form covalent bonds with GSH, thereby consuming free GSH in the solution.

[0052] The AuAgPt ternary alloy nanoframework of the present invention generates a photothermal effect under 808 nm laser excitation, promotes cytoplasmic convection through local intracellular thermal effects, changes metabolite content, disrupts metabolic balance, and induces cell death.

[0053] The AuAgPt ternary alloy nanoframework of the present invention can interact with thiol-modified nucleic acid aptamers to form covalent bonds, and nucleic acid aptamers with tumor targeting ability can be modified on the surface of the framework. Through the specific recognition and cellular internalization of nucleic acid aptamers, the AuAgPt ternary alloy nanoframework is targeted and delivered to the cytoplasm of tumor cells, generating intracellular photothermal heat under 808nm laser excitation, accelerating the catalytic decomposition of H2O2 to produce •OH, O2 and 1 O2, accelerating the consumption of intracellular GSH, disrupting the steady state of cellular metabolic balance, thereby inducing ferroptosis and apoptosis of cells for killing tumor cells.

[0054] The AuAgPt ternary alloy nanoframework of the present invention is injected through the tail vein in a tumor-bearing model animal. The nanoframework can be targeted to the tumor site through nucleic acid aptamers. After irradiation with 808 nm laser, it induces ferroptosis and apoptosis of tumor cells and exerts an anti-tumor effect.

[0055] The AuAgPt ternary alloy nanoframework of the present invention is used as a photothermal agent, catalyst, and GSH depleting agent to kill tumor cells and can be used for the treatment of human tumor diseases. The applications include one or more of the following: 1) Conjugating AuAgPtNFs with the thiol-containing nucleic acid aptamer AP613-1 to endow AuAgPt NFs with tumor targeting ability. 2) Having plasmonic photothermal conversion performance and being used as an efficient photothermal conversion agent. 3) Having catalase and peroxidase-like activities and being able to catalyze H2O2 to produce •OH, O2 and 1 O2. 4) Being able to form covalent bonds with GSH and serving as a GSH depleting agent. 5) Being able to regulate changes in intracellular metabolites and disrupt cellular metabolic homeostasis. 6) Inducing apoptosis and ferroptosis of tumor cells through photothermal, catalytic, GSH depletion, and disruption of metabolism.

[0056] Compared with the prior art, the beneficial technical effects brought by the technical solution of the present invention:

[0057] At present, existing plasmonic nanomaterials have defects such as difficult control of size and morphology, single composition and performance, and low photothermal conversion efficiency. The present invention prepares an AuAgPt ternary alloy nanoframework by a wet chemical synthesis method. The nanoframework contains a gold, silver, and platinum three-metal doped alloy, has a high yield, uniform morphology, and is easy to regulate size and morphology, and has a high plasmonic photothermal conversion efficiency, good catalytic activity, and GSH consumption ability. After modifying a ligand with tumor targeting ability such as an aptamer on the nanoframework, it can target and internalize into tumor cells. Under 808 nm laser irradiation, it can cause the temperature of tumor cells containing the nanoframework to rise to 42 °C, accelerate the catalytic decomposition of intracellular H2O2 to generate •OH, O2 and 1 O2, consume intracellular GSH, disrupt metabolic homeostasis, thereby inducing ferroptosis and apoptosis of tumor cells, and finally exerting an anti-tumor effect.

[0058] In summary, the described AuAgPt ternary alloy nanoframework has good photothermal conversion performance, catalytic activity, GSH consumption ability, and the ability to disrupt cell metabolism, can specifically induce ferroptosis and apoptosis of tumor cells, which is a novel low-temperature photothermal therapy strategy with good application potential and prospects. Brief Description of the Drawings

[0059] Figure 1 It is a schematic diagram of the synthesis route of the AuAgPt ternary alloy nanoframework (AuAgPt NFs).

[0060] Figure 2 It is a scanning electron microscope image (SEM) of the synthesized gold octahedron in Example 1.

[0061] Figure 3 It is a scanning electron microscope image (SEM) of the gold octahedron with platinum loaded on the edge synthesized in Example 1.

[0062] Figure 4 It is a scanning electron microscope image (SEM) of the synthesized AuPt binary alloy nanoframework in Example 1.

[0063] Figure 5 It is a scanning electron microscope image (SEM) of the synthesized AuAgPt ternary alloy nanoframework in Example 1.

[0064] Figure 6 It is the photothermal conversion efficiency of AuAgPt NFs.

[0065] Figure 7 It is the performance of AuAgPt NFs to generate •OH under 808 nm laser irradiation.

[0066] Figure 8The performance of AuAgPt NFs in generating O2 under 808 nm laser irradiation.

[0067] Figure 9 The performance of AuAgPt NFs in generating 1 O2 under 808 nm laser irradiation.

[0068] Figure 10 The performance of AuAgPt NFs in adsorbing and consuming GSH.

[0069] Figure 11 To detect the specific binding ability of AuAgPt-AP NFs conjugated with nucleic acid aptamer AP613-1 to liver cancer cells by flow cytometry.

[0070] Figure 12 To detect the ability of AuAgPt-AP NFs to internalize into liver cancer cells using a microscope

[0071] Figure 13 The change curve of cell temperature under 808 nm laser irradiation after AuAgPt-AP NFs internalize into liver cancer cells.

[0072] Figure 14 The effect of AuAgPt-AP NFs on the intracellular metabolic mimic rhodamine 6G under laser irradiation conditions.

[0073] Figure 15 To analyze the regulatory effect of AuAgPt-AP NFs on intracellular metabolites in liver cancer cells under laser irradiation conditions by metabolomics.

[0074] Figure 16 The detection results of cell viability of liver cancer cells with and without laser irradiation after AuAgPt-AP NFs internalize into liver cancer cells.

[0075] Figure 17 The ability of liver cancer cells to generate ROS with and without laser irradiation after AuAgPt-AP NFs internalize into liver cancer cells.

[0076] Figure 18 The ability of AuAgPt-AP NFs to consume GSH in liver cancer cells.

[0077] Figure 19 To detect the effect of AuAgPt-AP NFs on the expression of GPX4 protein in liver cancer cells by Western blot.

[0078] Figure 20 The ability of AuAgPt-AP NFs to induce liver cancer cells to produce MDA.

[0079] Figure 21 The ability of AuAgPt-AP NFs to induce apoptosis in liver cancer cells.

[0080] Figure 22 The tumor treatment effect of AuAgPt-AP NFs on tumor-bearing mice by means of low-temperature photothermal therapy.

[0081] Figure 23 The photothermal conversion performance of the gold octahedron, gold octahedron with platinum loaded on the edge, AuPt binary alloy nanoskeleton, and AuAgPt NFs in Example 1. Detailed implementation mode

[0082] The following further elaborates on the content of the present invention in conjunction with examples, without limiting the protection scope of the claims of the present invention.

[0083] Example 1

[0084] Preparation of AuAgPt ternary alloy nanoskeleton:

[0085] Figure 1 A synthesis route diagram of the AuAgPt ternary alloy nanoskeleton is given. The specific preparation method is divided into the following steps:

[0086] (1) Preparation of gold octahedron nanoparticles (Au OPs):

[0087] ① Preparation of gold seeds: 87.5 μL of 20 mM chloroauric acid solution (HAuCl4·3H2O) was added to 7 mL of 75 mM cetyltrimethylammonium bromide (CTAB) solution, and then 600 μL of 10 mM sodium borohydride (NaBH4) solution was quickly added to the above mixture. Stir at 600 rpm and react at 30 °C for 3 h.

[0088] ② First-stage growth: The above gold seeds were diluted 100 times with deionized water and reserved. 0.2 mL of 20 mM HAuCl4·3H2O solution, 6 mL of 0.1 M ascorbic acid (AA) solution, and 6 mL of the above gold seeds diluted 100 times were successively added to 480 mL of 16 mM CTAB solution, and grown overnight at 30 °C (12 h).

[0089] ③Second-stage growth: 1.4 mL of 20 mM HAuCl4·3H2O solution, 6.53 mL of 0.1 M AA solution and 140.5 mL of the above-mentioned gold octahedron first-stage growth solution were successively added to 210.8 mL of 16 mM CTAB solution, and the reaction was carried out at 30 °C for 4 h. After the reaction was completed, the obtained purple-red colloidal solution was centrifuged and washed twice under the conditions of 4800 rpm for 20 min, and then the OD value (optical density value) of the material was adjusted to 1.0 using a UV-visible spectrophotometer. Figure 2 is the SEM image of the synthesized gold octahedrons.

[0090] (2)Synthesis of platinum-edge-loaded gold octahedrons (Au@Pt OPs): Since the crystal lattices of Au and Pt do not match, to achieve the selective growth of Pt on the 12 edges of the gold octahedron, a thin Ag layer needs to be loaded on the surface of the gold octahedron before Pt loading, that is, AuAg octahedrons. Therefore, the synthesis of platinum-edge-loaded gold octahedrons is completed in two steps:

[0091] ①Synthesis of AuAg octahedrons: First, 7.5 μL of 0.1 M sodium iodide (NaI) solution was added to 15 mL of 50 mM CTAB solution, gently shaken and mixed evenly, then 5 mL of the prepared gold octahedron colloid with an OD value of 1.0 was added, shaken well and left to stand for 3 min. Finally, 14 μL of 2 mM silver nitrate (AgNO3) solution and 600 μL of 0.1 M AA solution were added, and the reaction was carried out at 70 °C for 1 h. Among them, AgNO3 and AA are used as silver precursor and reducing agent respectively.

[0092] ②Synthesis of platinum-edge-loaded gold octahedrons: This step is achieved by the point displacement reaction of Ag and Pt under acidic conditions, and Ag located at the edge part is preferentially deposited by Pt. Specific synthesis steps: After the synthesis reaction of the above AuAg octahedrons is completed, 600 μL of 0.1 M dilute hydrochloric acid and 160 μL of 2 mM chloroplatinic acid (H2PtCl6) solution are added to the original reaction system, and the reaction is carried out at 70 °C for 3 h. After the reaction is completed, it is centrifuged and washed twice under the conditions of 4800 rpm for 15 min, and then dispersed with 5 mL of deionized water. Figure 3 is the SEM image of the platinum-edge-loaded gold octahedrons.

[0093] (3)Preparation of AuPt binary alloy nanoframes (AuPt NFs): The AuPt binary alloy nanoframes are generated by selectively etching the platinum-edge-loaded gold octahedrons. Use Au 3+ to selectively etch the gold octahedron core inside the nanoparticles, leaving a complete platinum octahedron framework. However, after the selective etching is completed, Au is not completely etched away, and a small part will remain at the inner edge or vertex of the platinum framework. The specific steps are as follows:

[0094] 7.5 μL of 0.1 M sodium iodide (NaI) solution was added to 15 mL of 50 mM CTAB solution, and the mixture was gently shaken and mixed evenly. Subsequently, 5 mL of the above-mentioned gold octahedra with platinum loaded on the edge was added, shaken well and left standing for 3 min. Finally, 400 μL of 2 mM HAuCl4·3H2O solution was added, and the reaction was carried out at 50 °C for 1 h. After the reaction was completed, it was centrifuged and washed twice under the conditions of 8000 rpm for 15 min, and dispersed with 5 mL of deionized water. Figure 4 It is the SEM image of the synthesized AuPt binary alloy nanoframework.

[0095] (4)Preparation of AuAgPt ternary alloy nanoframework (AuAgPt NFs): Based on the above AuPt binary alloy nanoframework, gold and silver precursors were added, and through one-step reduction, gold and silver were co-deposited on the surface of the wave framework to form an alloy nanoframework. Specific steps:

[0096] 5 mL of Au / Pt NFs was added to 1 mL of 0.2 M cetyltrimethylammonium chloride (CTAC) solution, and then 80 μL of 2 mM AgNO3 solution, 2 mM HAuCl4·3H2O solution and 10 mM AA solution were added respectively, and the reaction was carried out at 50 °C for 30 min. After the reaction was completed, it was centrifuged and washed twice under the conditions of 2000 rpm for 30 min, and dispersed with deionized water. Figure 5 It is the SEM image of the synthesized AuAgPt NFs.

[0097] The photothermal conversion properties of the materials Au OPs, Au@Pt OPs, AuPt NFs and AuAgPt NFs prepared in different steps in Example 1 are as Figure 23 shown. It can be seen from the temperature change under 808 nm laser irradiation that the photothermal conversion performance of AuAgPt NFs is significantly better than that of other materials.

[0098] Example 2

[0099] Investigation on the plasmonic photothermal properties of AuAgPt ternary alloy nanoframework (AuAgPt NFs):

[0100] In order to investigate the photothermal conversion efficiency of AuAgPt NFs, 0.5 mL of AuAgPt NFs solution (40 ng / mL) was exposed to an 808 nm laser (1.0 W·cm -2 ) for 10 minutes. Then the solution was cooled to ambient temperature by turning off the laser, and the solution temperature corresponding to each time point was recorded.

[0101] Figure 6For the experimental results, according to calculations, the photothermal conversion efficiency of AuAgPt NFs is 44.6%.

[0102] Example 3

[0103] Investigation of the catalytic activity of AuAgPt ternary alloy nanoframes:

[0104] Investigation of the performance of generating hydroxyl radicals (•OH): The TMB (3,3',5,5'-tetramethylbenzidine) colorimetric method was used. To 200 μL of 2 μg / mL AuAgPt NFs solution (HEPES buffer, pH = 5.5), 10 μL of TMB solution (dissolved in DMSO, 4 mM) and 2 μL of H2O2 (wt%, 30%) were added in sequence, so that the final concentration of TMB in the reaction system was 1 mM and the final concentration of H2O2 was 10 mM; different treatments were carried out on different experimental groups (such as 808 nm laser irradiation or no irradiation, etc.), and the total reaction was 8 h, among which the light irradiation group was irradiated for 4 h (irradiated once every 1 h, each time for 1 h), after the reaction was completed, centrifuged at 3000 rpm for 10 min, and 150 μL of the supernatant was taken to detect the peak change at 652 nm. TMB turns blue after being oxidized and has a maximum absorption peak at 652 nm, while unoxidized TMB is colorless and has no maximum absorption peak.

[0105] Figure 7 For the experimental result graph, AuAgPt NFs can generate more •OH under 808 nm laser irradiation.

[0106] Investigation of the performance of generating O2: The oxygen probe RDPP [tris(4,7-diphenyl-1,10-phenanthroline) ruthenium dichloride Ru(dpp)3]Cl2] was used to detect the generation of oxygen. To 200 μL of 2 μg / mL AuAgPt NFs solution (HEPES buffer, pH = 7.4), 4 μL of H2O2 (wt%, 30%) was added, so that the final concentration of H2O2 in the reaction system was 20 mM, different treatments were carried out on different experimental groups (such as 808 nm laser irradiation or no irradiation, etc.), and the total reaction was 8 h, among which the light irradiation group was irradiated for 4 h (irradiated once every 1 h, each time for 1 h), after the reaction was completed, centrifuged at 3000 rpm for 10 min, 100 μL of the supernatant was taken, 5 μL of RDPP solution (dissolved in ethanol, 1 mg / mL) was added and reacted in the dark for 20 min, and then the fluorescence intensity change of RDPP (excitation wavelength 490 nm) was detected. The RDPP probe itself has fluorescence, and its fluorescence will be quenched when there is oxygen in the reaction system. The generation of oxygen is judged by the fluorescence quenching of RDPP.

[0107] Figure 8This is the experimental result graph. Under 808 nm laser irradiation, AuAgPt NFs can generate O2.

[0108] Production 1 Performance investigation of O2 production: The DPBF (1,3-diphenylisobenzofuran) degradation method was adopted. Add 5 μL of H2O2 (wt%, 30%) to 250 μL of 2 μg / mL AuAgPt NFs solution (HEPES buffer, pH = 6.5) to make the final concentration of H2O2 in the reaction system 20 mM. Different treatments were carried out on different experimental groups (such as 808 nm laser irradiation or not), and the total reaction time was 8 h. Among them, the light irradiation group was irradiated for 4 h (irradiated once every 1 h, each irradiation for 1 h). After the reaction, centrifuge at 3000 rpm for 10 min, take 200 μL of the supernatant, add 20 μL of DPBF solution (dissolved in ethanol, 4 mg / mL), and react in the dark for 20 min. Then, detect the change in the ultraviolet-visible light spectrum of DPBF. DPBF will be oxidized by singlet oxygen, resulting in a decrease in the intensity of its ultraviolet-visible light spectrum.

[0109] Figure 9 This is the experimental result graph. Under 808 nm laser irradiation, AuAgPt NFs can generate more 1 O2.

[0110] Example 4

[0111] Performance investigation of the consumption of GSH by AuAgPt ternary alloy nanorods:

[0112] Add 2 μL of GSH (reduced glutathione, 0.1 mol / L) solution to 200 μL of AuAgPt NFs dispersions with different concentrations (0 μg / mL, 0.3 μg / mL, 0.6 μg / mL, 1.2 μg / mL) (HEPES buffer, pH = 7.4) to make the final concentration of GSH in the reaction system 1 mM, and react for 12 h, shaking once every 4 h; after the reaction, centrifuge at 3000 rpm for 10 min, take 10 μL of the supernatant and add it to 200 μL of HEPES buffer (pH = 6.5), then add 20 μL of DTNB solution (4 mM), and react in the dark for 30 min. Use an ultraviolet-visible spectrophotometer to detect the absorbance change at 412 nm. The lower the absorbance at 412 nm, the lower the content of free GSH.

[0113] Figure 10 This is the experimental result graph. AuAgPt NFs can adsorb and consume GSH.

[0114] Example 5

[0115] Flow cytometry was used to detect the specific targeting ability of AuAgPt-AP NFs modified with nucleic acid aptamers to tumor cells:

[0116] Nucleic acid aptamers refer to single-stranded DNA oligonucleotides with high affinity and high specific binding ability to designated targets such as proteins, which are screened from artificial nucleic acid libraries. The literature has shown that the nucleic acid aptamer AP613-1 can specifically bind to liver cancer cells. Therefore, in this invention, liver cancer cells were used as a tumor cell model, and AP613-1 was used as the nucleic acid aptamer targeting liver cancer cells.

[0117] The sequence of the nucleic acid aptamer AP613-1 is: TAACGCTGACCTTAGCTGCATGGCTTTA CATGT TCCA-SH.

[0118] Take 10 mL of well-washed and dispersed AuAgPt NFs (20 ng / ml), centrifuge and concentrate it 100 times at a speed of 2000 rpm for 30 min. Try to remove the supernatant as much as possible, and then add 100 μL of pure water for dispersion. Add 100 μL of concentrated AuAgPt NFs and 100 μM of the nucleic acid aptamer AP613-1 in a ratio of 10:1, mix well, incubate at room temperature for 6 hours, and then centrifuge at 2000 rpm to remove the uncoupled nucleic acid aptamers to form AuAgPt-AP NFs.

[0119] Since AuAgPt NFs can quench the fluorescence molecular signal on their surface, a competitive method was used to detect the targeting effect of AuAgPt-AP NFs conjugated with nucleic acid aptamers on tumor cells. The liver cancer cells HepG2 were cultured to a density of about 80%, digested with 0.2% EDTA, and after cell counting, 1×10 6 cells were taken and evenly divided into 5 groups. The first group was used as the blank control group. In the second to fifth groups, FAM-fluorescently modified random nucleic acid library Library (Lib), FAM-modified nucleic acid aptamer AP613-1 (Apt), FAM-modified nucleic acid aptamer AP613-1 + AuAgPt NFs without aptamer modification, and FAM-modified nucleic acid aptamer AP613-1 + AuAgPt-AP NFs were added respectively. Incubate at 4°C for 0.5 hours, then centrifuge to remove the supernatant, wash the cells 3 times with washing buffer, and detect the fluorescence value of the cells by flow cytometry; The human normal liver cells L-02 were cultured to a density of about 80%, digested with 0.2% EDTA, and after cell counting, 2×10 5Cells were evenly divided into three groups. The first group served as the blank control group, the second group was added with a random nucleic acid library Library (Lib) modified with FAM fluorescence, and the third group was added with a nucleic acid aptamer modified with FAM. Incubate at 4°C for 0.5 hours, then centrifuge to remove the supernatant, wash the cells three times with the washing buffer, and detect the fluorescence value of the cells by flow cytometry. The result graph is shown in Figure 11 . The results in the figure show that the nucleic acid aptamer Apt can specifically bind to the liver cancer cell HepG2, but not to the normal liver cell L02. At the same time, the AuAgPt-AP NFs modified with the nucleic acid aptamer can weaken the binding strength of the nucleic acid aptamer Apt to the cells, indicating that competitive binding has occurred between the two, which also indirectly shows that the AuAgPt-AP NFs with nucleic acid aptamers can specifically target and bind to tumor cells.

[0120] Example 6

[0121] Investigate the uptake effect of tumor cells on AuAgPt-AP NFs:

[0122] Seed HepG2 cells in two optical culture dishes. When the cell density reaches 80%, add AuAgPt-AP NFs to one of the dishes. After incubating for 3 hours, wash three times, observe and take cell pictures with a microscope. The result graph is shown in Figure 12 , and the results in the figure show that the black AuAgPt-AP NFs can be taken up by the cells into the cytoplasm.

[0123] Example 7

[0124] Detect the photothermal performance of AuAgPt-AP NFs in tumor cells:

[0125] Seed HepG2 cells in five 12-well plates. When the cell density reaches 80%, add AuAgPt-AP NFs to 5 ng / ml, 10 ng / ml, 15 ng / ml, and 20 ng / ml respectively in four of the wells. After incubating for 3 hours, wash three times, and irradiate with a near-infrared laser at 808 nm (2.0 W / cm 2 ) for 20 min. Use a thermometer gun to detect the cell temperature and draw a temperature change curve. The results are shown in Figure 13 , and the results in the figure show that AuAgPt-AP NFs can effectively and gradually increase the cell temperature.

[0126] Example 8

[0127] Detect the regulatory effect of AuAgPt-AP NFs on rhodamine 6G in tumor cells under laser irradiation conditions:

[0128] Using rhodamine 6G to simulate small molecule metabolites in cells, the effect of AuAgPt-AP NFs on intracellular rhodamine 6G under laser irradiation conditions was detected. HepG2 cells were seeded in an optical culture dish. When the cell density reached 80%, AuAgPt-AP NFs were added to the dish to a concentration of 10 ng / ml. After incubation for 3 hours, the cells were washed 3 times, and then rhodamine 6G was added and incubated for 1 hour and washed 3 times. At this time (t = 0 min), the fluorescence signal of rhodamine 6G in the cells was photographed and recorded using a confocal microscope. Then, the cells were irradiated with a near-infrared laser at 808 nm (2.0 W / cm 2 ) for 20 min, and the fluorescence signal of rhodamine 6G in the cells was recorded again using a confocal microscope (t = 20 min). The intensity of the signal before and after irradiation was compared. The results are shown in Figure 14 . The results showed that the signal of intracellular rhodamine 6G was significantly weakened under the treatment of AuAgPt-AP NFs plus NIR laser, indicating that the molecular movement and convection of rhodamine 6G might be increased through the local heating effect in cells, enabling it to diffuse out of the cells by free diffusion.

[0129] Example 9

[0130] Regulatory effect of AuAgPt-AP NFs on intracellular metabolites in hepatoma cells under NIR laser irradiation conditions was analyzed by metabolomics:

[0131] HepG2 cells were seeded in a dish. When the cell density was approximately 80%, AuAgPt-AP NFs were added to a final concentration of 10 ng / mL. Half of the dishes of cells were irradiated with NIR (2.0 W / cm 2 ) for 20 min, and the other half of the cells were not irradiated. Then, the cells were collected for untargeted metabolomics to analyze the relative content of intracellular metabolites. The differences in intracellular metabolites between the two groups of cells were analyzed using metaboanalyst software. The results are shown in Figure 15 . Orthogonal partial least squares discriminant analysis (OPLS-DA) showed that there were significant differences in the metabolite content between the two groups of cells ( Figure 15 A in Figure 15 ), and based on the VIP value (Variable Importance in the Projection) > 1 and P < 0.05, significantly different metabolites were analyzed. It was found that 56 metabolites were up-regulated and 24 metabolites were down-regulated, which were shown in a volcano plot ( Figure 15 B in Figure 15In C), the analysis of metabolites in the pathway revealed that a variety of metabolites related to ferroptosis and apoptosis, such as glutamate, glutamine, methionine, tryptophan, leucine, proline, threonine, serine, pyruvate, and vitamin B6, were downregulated, while uric acid, valine, and adenine were upregulated. Figure 15 In D), the changes in these metabolites may all affect the intracellular redox balance state, promote the production of ROS, inhibit the antioxidant response, and induce ferroptosis and apoptosis in tumor cells.

[0132] Example 10

[0133] Efficacy of MTT assay to detect the ability of AuAgPt-AP NFs to inhibit tumor cell proliferation:

[0134] HepG2 cells were seeded in 10 24-well plates. When the cell density reached approximately 80%, AuAgPt-AP NFs were added to 4 of the wells at final concentrations of 5 ng / mL, 10 ng / mL, 15 ng / mL, and 20 ng / mL, respectively. At the same time, the same concentration of nanoframes was added to another 4 wells and irradiated with a near-infrared laser at 808 nm (2.0 W / cm 2 2) for 20 min. After 24 hours, the proliferation activity of the cells was detected by MTT staining method. The results are shown in Figure 16 , AuAgPt-AP NFs had a mild tumor suppression effect, while the treatment of cells with AuAgPt-AP NFs plus near-infrared laser irradiation could significantly inhibit the proliferation activity of tumor cells.

[0135] Example 11

[0136] Ability of AuAgPt-AP NFs to induce the production of reactive oxygen species (ROS) in tumor cells detected by laser confocal microscopy:

[0137] HepG2 cells were seeded in 4 optical culture dishes. The first well was set as a blank control. The second well was irradiated with a near-infrared laser at 808 nm (2.0 W / cm 2 2) for 20 min. The third well was added with AuAgPt-AP NFs to a final concentration of 10 ng / mL. The fourth well was added with AuAgPt-AP NFs to a final concentration of 10 ng / mL and irradiated with a near-infrared laser at 808 nm (2.0 W / cm 2 2) for 20 min. The content of ROS in the cells was detected by Dihydroethidium (DHE) probe and photographed using a laser confocal microscope. The results are as shown in Figure 17 , AuAgPt-AP NFs could directly promote the increase of ROS in cells and further increase after near-infrared laser irradiation.

[0138] Example 12

[0139] Detect the effect of AuAgPt-AP NFs on the consumption of GSH in tumor cells:

[0140] Culture HepG2 cells in 4 six-well plates until they reach 80% density. Set the first well as the blank control. Irradiate the second well with near-infrared laser at 808 nm (2.0 W / cm 2 ) for 20 min. Add AuAgPt-AP NFs to the third well to a final concentration of 10 ng / mL. Add AuAgPt-AP NFs to the fourth well to a final concentration of 10 ng / mL and irradiate it with near-infrared laser at 808 nm (2.0 W / cm 2 ) for 20 min. Use the DTNB method to detect the content of reduced glutathione in the cells. The results are as Figure 18 shown. AuAgPt-AP NFs can effectively reduce the content of GSH, and this effect can be further aggravated after near-infrared laser irradiation.

[0141] Example 13

[0142] Detect the effect of AuAgPt-AP NFs on GPX4 in tumor cells by Western blotting:

[0143] Seed HepG2 cells in 4 six-well plates. When the cell density reaches about 80%, set the first well as the blank control. Irradiate the second well with near-infrared laser at 808 nm (2.0 W / cm 2 ) for 20 min. Add AuAgPt-AP NFs to the third well to a final concentration of 10 ng / mL. Add AuAgPt-AP NFs to the fourth well to a final concentration of 10 ng / mL and irradiate it with near-infrared laser at 808 nm (2.0 W / cm 2 ) for 20 min. After 24 hours, lyse the cells with RIPA lysis buffer to collect proteins, perform electrophoresis, transfer the membrane, and block it on an SDS-PAGE gel. Incubate with GPX4 and GAPDH antibodies and develop the image by chemiluminescence method. The result diagram is shown in Figure 19 . The treatment with AuAgPt-AP NFs can reduce the expression content of GPX4 in cells, and the content can be further reduced after light treatment.

[0144] Example 14

[0145] Detect the function of AuAgPt-AP NFs in inducing the production of malondialdehyde MDA in tumor cells:

[0146] Malondialdehyde (MDA) is the main product after lipid peroxidation decomposition. HepG2 cells were cultured to 80% density in 4 six-well plates. The first well was set as the blank control, and the second well was irradiated with near-infrared laser at 808 nm (2.0 W / cm 2 for 20 min. The third well was added with AuAgPt-AP NFs to a final concentration of 10 ng / mL, and the fourth well was added with AuAgPt-AP NFs to a final concentration of 10 ng / mL and irradiated with near-infrared laser at 808 nm (2.0 W / cm 2 for 20 min. After 24 hours, the cells were lysed with cell IP lysis buffer and the supernatant was collected. The MDA content was detected by the thiobarbituric acid colorimetric method. The result graph is shown in Figure 20 . After treatment with AuAgPt-AP NFs plus light irradiation, the MDA content in cells can be significantly increased.

[0147] Example 15

[0148] Detection of the effect of AuAgPt-AP NFs on inducing apoptosis of tumor cells by flow cytometry:

[0149] HepG2 cells were seeded in 4 twenty-four-well plates. When the density reached 80%, the first well was set as the blank control, and the second well was irradiated with near-infrared laser at 808 nm (2.0 W / cm 2 for 20 min. The third well was added with AuAgPt-AP NFs to a final concentration of 10 ng / mL, and the fourth well was added with AuAgPt-AP NFs to a final concentration of 10 ng / mL and irradiated with near-infrared laser at 808 nm (2.0 W / cm 2 for 20 min. After 24 hours, staining was performed by Annexin V-FITC / PI method and the fluorescence signal was detected by flow cytometry. The results are shown in Figure 21 . AuAgPt-AP NFs can slightly induce apoptosis of tumor cells. After near-infrared laser irradiation, apoptosis of cells can be significantly promoted, while there is no such effect with only infrared laser irradiation.

[0150] Example 16

[0151] Detection of the anti-tumor function of AuAgPt-AP NFs in mice:

[0152] Four-week-old BALB / C nude mice were purchased. 5×10 6 cells were subcutaneously injected into the back of each mouse. When the cells grew to 1 cm 3Around, the mice were randomly divided into 4 groups. The first group served as the control group. The second group was irradiated with an 808 nm near-infrared laser at a power of 1.5 W for 20 min on the tumor mass. The third group was injected with 50 μl of AuAgPt-AP NFs with a concentration of 1 ng / μl. The fourth group was injected with 50 μl of AuAgPt-AP NFs with a concentration of 1 ng / μl and irradiated with an 808 nm near-infrared laser at a power of 1.5 W for 20 min on the tumor mass 2 hours after injection. After the first treatment, repeated treatment was carried out once every 2 days according to the above protocol. After a total of 5 treatments, the mice were euthanized, and the tumor masses were dissected for statistics. The results are shown in Figure 22 , compared with the control group and the NIR irradiation group, AuAgPt-AP NFs could slightly inhibit tumor growth, while the tumor mass in the AuAgPt-AP NFs plus NIR light treatment group was significantly reduced, indicating good anti-tumor efficacy.

Claims

1. A AuAgPt ternary alloy nanoscale framework, characterized in that: A hollow octahedral nanoscale framework composed of 12 AuAgPt ternary alloy edges.

2. The AuAgPt ternary alloy nanoframe according to claim 1, characterized in that: The AuAgPt ternary alloy edges are composed of Au, Ag, and Pt in an atomic ratio of 0.3 - 0.7:0.1 - 0.3:0.2 - 0.

5.

3. A AuAgPt ternary alloy nanoscale framework according to claim 1 or 2, characterized in that: The length of the AuAgPt ternary alloy edges is 20 - 60 nm; The AuAgPt ternary alloy edges form a nanoscale framework structure with a particle size of 30 - 90 nm; The vertex intersections of the AuAgPt ternary alloy edges are circular planes with a plane diameter of approximately 5 - 20 nm.

4. The preparation method of the AuAgPt ternary alloy nanoframe according to any one of claims 1 to 3, characterized in that: It includes the following steps: 1) Synthesize gold octahedral nanoparticles by the gold seed growth method; 2) Deposit platinum on the edges of the gold octahedral nanoparticles to form gold octahedral nanoparticles with platinum loaded on the edges; 3) Etch the gold octahedral nanoparticles with platinum loaded on the edges to form a hollow shape, obtaining an AuPt binary alloy nanoscale framework; 4) Deposit silver and gold simultaneously on the edges of the AuPt binary alloy nanoscale framework to obtain the AuAgPt ternary alloy nanoscale framework.

5. The preparation method of the AuAgPt ternary alloy nanoframe according to claim 4, characterized in that: The preparation process of the gold octahedral nanoparticles is as follows: a) First add 60 - 100 μL of chloroauric acid solution with a concentration of 15 - 30 mM to 6 - 10 mL of cetyltrimethylammonium bromide solution with a concentration of 60 - 100 mM, and then quickly add 400 - 800 μL of sodium borohydride solution with a concentration of 5 - 20 mM, and stir and react for 2 - 5 h to form a gold seed solution; b) Sequentially add 0.1 - 1 mL of chloroauric acid solution with a concentration of 20 - 40 mM, 5 - 10 mL of ascorbic acid solution with a concentration of 0.1 - 0.5 M, and 5 - 10 mL of gold seed solution diluted 50 - 100 times to 400 - 600 mL of cetyltrimethylammonium bromide solution with a concentration of 10 - 20 mM, and stir and react for more than 12 h to form a first-stage growth product solution; c) Sequentially add 1 - 3 mL of chloroauric acid solution with a concentration of 10 - 25 mM, 5 - 10 mL of ascorbic acid solution with a concentration of 0.05 - 0.2 M, and 135 - 150 mL of the first-stage growth product solution to 200 - 250 mL of cetyltrimethylammonium bromide solution with a concentration of 10 - 20 mM, stir and react at 25 - 35 °C for 3 - 6 h, and then perform centrifugal separation to obtain the gold octahedral nanoparticles.

6. The preparation method of the AuAgPt ternary alloy nanoframe according to claim 4 or 5, characterized in that: The preparation process of the edge-loaded platinum gold octahedron nanoparticles is as follows: Add 6 - 10 μL of a sodium iodide solution with a concentration of 0.05 - 0.2 M to 10 - 20 mL of a cetyltrimethylammonium bromide solution with a concentration of 40 - 60 mM, mix well, then add 4 - 10 mL of the above-mentioned gold octahedron nanoparticles, mix and let stand for more than 3 min. Then add 10 - 20 μL of a silver nitrate solution with a concentration of 1 - 10 mM and 400 - 800 μL of an ascorbic acid solution with a concentration of 0.05 - 0.2 M, react at a temperature above 60 °C for more than 1 h. Then add 400 - 800 μL of a dilute hydrochloric acid solution with a concentration of 0.05 - 0.2 M and 100 - 200 μL of a chloroplatinic acid solution with a concentration of 3 - 8 mM, react in an environment with a temperature not lower than 70 °C for more than 2 h to obtain an edge-loaded platinum gold octahedron nanoparticle solution.

7. The preparation method of the AuAgPt ternary alloy nanoframe according to claim 4, characterized in that: The preparation process of the AuPt binary alloy nanoframe is as follows: Add 4 - 10 μL of a sodium iodide solution with a concentration of 0.05 - 0.2 M to 10 - 20 mL of a cetyltrimethylammonium bromide solution with a concentration of 40 - 100 mM, mix well, then add 4 - 10 mL of the above-mentioned edge-loaded platinum gold octahedron nanoparticle solution, mix and let stand for more than 3 min. Then add 300 - 800 μL of a chloroplatinic acid solution with a concentration of 1 - 10 mM, react in an environment above 40 °C for more than 1 h, then centrifuge to collect the AuPt binary alloy nanoframe and disperse it in 4 - 10 mL of water to form an AuPt binary alloy nanoframe dispersion.

8. The preparation method of the AuAgPt ternary alloy nanoframe according to claim 4, characterized in that: The preparation process of the AuAgPt ternary alloy nanoframe is as follows: Add 1 - 10 mL of the AuPt binary alloy nanoframe dispersion to 0.5 - 5 mL of a cetyltrimethylammonium chloride solution with a concentration of 0.05 - 0.5 M, mix well, then successively add 40 - 100 μL of an AgNO3 solution with a concentration of 1 - 10 mM, 40 - 100 μL of an HAuCl4 solution with a concentration of 1 - 8 mM and 40 - 100 μL of an ascorbic acid solution with a concentration of 5 - 20 mM, react at a temperature above 40 °C for more than 20 min.

9. Use of a ternary alloy AuAgPt nanoscale framework according to any one of claims 1 to 8, characterized in that: It is applied to the preparation of anti-tumor preparations.

10. According to the application of an AuAgPt ternary alloy nanoframe as described in claim 9, wherein: The AuAgPt ternary alloy nanoframe and a thiol-modified nucleic acid aptamer with tumor targeting ability are covalently bonded to form a tumor-targeted preparation; The anti-tumor preparation has tumor targeting ability, plasmonic photothermal conversion performance, catalase and peroxidase-like activity, the ability to bind GSH, and the ability to drive changes in the content of intracellular small molecule metabolites.

Images