Spinal muscular atrophy quality control product as well as preparation method and application thereof

Abstract

The invention discloses a spinal muscular atrophy quality control product as well as a preparation method and application thereof. The invention provides a transformation culture medium and a method for constructing an immortalized spinal muscular atrophy lymphocyte by utilizing the transformation culture medium, aiming at the defect that the existing method for immortalizing the lymphocyte by utilizing EB (Epstein-Barr) virus cannot efficiently transform the spinal muscular atrophy lymphocyte into an immortalized cell. By utilizing the method disclosed by the invention, the immortalized spinal muscular atrophy lymphocyte strain can be constructed within 30 days, and the corresponding immortalized cell line can be obtained by subculturing the immortalized spinal muscular atrophy lymphocyte strain. When the method is used for constructing the immortalized spinal muscular atrophy lymphocyte, the required time is short, the success rate is high, and the obtained immortalized lymphocyte is stable in genetic background, high in intercommunity with a clinical sample, good in compatibility and capable of being stably stored, and can be used as a positive quality control material for gene detection of spinal muscular atrophy, so that the detection accuracy is ensured.

Description

Technical Field

[0001] The present invention belongs to the technical field of the construction of immortalized cells and gene detection. More specifically, it relates to a quality control product for spinal muscular atrophy, a preparation method thereof, and an application thereof. Background Art

[0002] Spinal Muscular Atrophy (SMA) is an autosomal recessive neuromuscular disease, which is mainly clinically characterized by muscle weakness and muscle atrophy caused by the degeneration of α - motor neurons in the anterior horn of the spinal cord. The survival motor neuron 1 (SMN1) gene on chromosome 5 (5q13.2) is the pathogenic gene of SMA. All SMA patients have bi - allelic mutations in the SMN1 gene. The main mutation forms are exon 7 (SMN1 - 7, E7) or exon 7 and exon 8 (SMN1 - 8, E8) deletion mutations, accounting for about 96% of the mutation types. In addition, there are also mutation types such as p.Ser8Lysfs*23 point mutation. In addition to the SMN1 gene, there is also a survival motor neuron 2 (SMN2) gene that is highly homologous to the SMN1 gene. This gene is a modifier gene for SMA, affecting the severity and progression of the disease. The increase in the copy number of the SMN2 gene is negatively correlated with the severity of SMA symptoms.

[0003] Currently, the diagnosis of SMA mainly relies on gene detection, and the main diagnostic basis is the pathogenic variation of bi - allelic genes in the SMN1 gene. Gene detection is a highly complex detection item. To ensure the accuracy of detection, positive quality control products are required for quality control. An ideal quality control product should be close to the actual clinical sample in terms of matrix, concentration, and composition, and should remain stable under the recommended storage and use conditions to ensure that its composition and concentration do not change significantly. Existing SMA gene detection quality control products are mostly limited to construction plasmids containing specific mutations. Such quality control products usually do not directly participate in the sample extraction process and cannot effectively monitor the extraction process. Compared with construction plasmids, immortalized cell lines / cell lines containing specific gene variations can be further made into quality control products such as paraffin - embedded tissues that simulate clinical samples. Therefore, they are more suitable for internal quality control and inter - laboratory quality assessment.

[0004] An immortalized cell line refers to a cell line that can proliferate indefinitely through subculture and survive continuously after successful primary culture. Epstein-Barr virus (EBV) can specifically infect B lymphocytes, thereby immortalizing B lymphocytes. Establishing an immortalized cell line by transforming B lymphocytes with EBV is the most commonly used method for cell immortalization. However, when constructing immortalized cells from B lymphocytes of different disease patients, due to reasons such as different cell states and genes carried (including gene size and mutant type), there are significant differences in the success rate of constructing immortalized cell lines using EBV. For example, an immortalized cell line A can be successfully constructed using the conventional EBV transformation method, but using the same or similar method cannot successfully construct immortalized cell line B, or there are problems such as a long time-consuming process, low success rate, and poor stability of the constructed immortalized cell line. Currently, there is no report on how to construct an immortalized cell line containing mutations in genes related to spinal muscular atrophy. Summary of the Invention

[0005] In view of the above problems existing in the prior art, the present invention provides a transformation medium, and also provides a method for culturing immortalized spinal muscular atrophy lymphocytes using the said transformation medium. The constructed immortalized spinal muscular atrophy lymphocytes can be used as quality control products for spinal muscular atrophy.

[0006] The first object of the present invention is to provide a transformation medium.

[0007] The second object of the present invention is to provide the application of the said transformation medium and Epstein-Barr virus in constructing immortalized lymphocytes or in preparing preparations for constructing immortalized lymphocytes.

[0008] The third object of the present invention is to provide a method for constructing immortalized spinal muscular atrophy lymphocytes.

[0009] The fourth object of the present invention is to provide the immortalized spinal muscular atrophy lymphocytes constructed by the said construction method.

[0010] The fifth object of the present invention is to provide the application of the said cells in preparing positive quality control products for immortalized spinal muscular atrophy gene detection.

[0011] The sixth object of the present invention is to provide the application of the said cells in preparing spinal muscular atrophy gene detection products.

[0012] The above objects of the present invention are achieved by the following technical solutions:

[0013] In the process of constructing an immortalized cell line using peripheral blood mononuclear cells of spinal muscular atrophy patients, the present invention found that the lymphocytes of SMA patients showed weakened cell brightness under the microscope, slow cell growth rate, and rarely formed clusters or formed very few clusters. When using Epstein-Barr virus and a cell culture medium containing cyclosporine A to transform them, not only was the success rate low (less than 50%), but also the transformation time was long (more than 50 days). That is, the existing method of immortalizing lymphocytes using Epstein-Barr virus cannot efficiently transform spinal muscular atrophy lymphocytes into immortalized cells. In response to this, the present invention provides a transformation medium, and also provides a method for constructing immortalized spinal muscular atrophy lymphocytes using the said medium. Using the said method, immortalized spinal muscular atrophy lymphocyte strains can be constructed within 30 days. Therefore, the present invention claims the said transformation medium and method.

[0014] The present invention provides a transformation medium.

[0015] Specifically, the transformation medium consists of a basic animal cell culture medium and added components; the added components include 15% - 25% (v / v) fetal bovine serum, 1 - 3 μg / mL cyclosporine A, 8.5 - 11.5 μg / mL phytohemagglutinin, and 1.5 - 3.5 μg / mL CpG ODN; the nucleotide sequence of the CpG ODN is as shown in SEQ ID NO.1.

[0016] Specifically, the transformation medium also contains 0.8% - 1.2% (v / v) penicillin-streptomycin mixture.

[0017] Specifically, in the penicillin-streptomycin mixture, the content of penicillin is 10 kU / mL, and the content of streptomycin is 10 mg / mL.

[0018] Optionally, the basic culture medium is 1640-GlutaMAX medium.

[0019] In a specific embodiment of the present invention, the transformation medium consists of a basic culture medium and added components; the basic culture medium is 1640-GlutaMAX medium; the added components are fetal bovine serum, penicillin-streptomycin mixture, cyclosporine A, phytohemagglutinin, and CpG ODN with the nucleotide sequence as shown in SEQ ID NO.1; wherein, the volume fraction of the fetal bovine serum is 15% - 25%, the volume fraction of the penicillin-streptomycin mixture is 0.8% - 1.2%, the concentration of cyclosporine A is 1 - 3 μg / mL, the concentration of phytohemagglutinin is 8.5 - 11.5 μg / mL, and the concentration of CpG ODN is 1.5 - 3.5 μg / mL.

[0020] More specifically, in the transformation medium, the volume fraction of fetal bovine serum is 18% - 22%, the volume fraction of penicillin-streptomycin mixture is 0.9% - 1.1%, the concentration of cyclosporine A is 1.5 - 2.5 μg / mL, the concentration of phytohemagglutinin is 9 - 11 μg / mL, and the concentration of CpG ODN is 2 - 3 μg / mL.

[0021] Preferably, in the transformation medium of the present invention, the volume fraction of fetal bovine serum is 20%, the volume fraction of penicillin-streptomycin mixture is 1%, the concentration of cyclosporine A is 2 μg / mL, the concentration of phytohemagglutinin is 10 μg / mL, and the concentration of CpG ODN is 2.5 μg / mL. At this concentration, the success rate of immortalizing spinal muscular atrophy lymphocytes using the medium is 100%.

[0022] In a specific embodiment of the present invention, the phytohemagglutinin is phytohemagglutinin M (PHA-M).

[0023] In view of the fact that the transformation medium and Epstein-Barr virus of the present invention can immortalize lymphocytes. Therefore, the present invention also claims the application of the transformation medium and Epstein-Barr virus in constructing immortalized lymphocytes or in preparing a preparation for constructing immortalized lymphocytes.

[0024] Specifically, the immortalized lymphocytes are immortalized spinal muscular atrophy lymphocytes.

[0025] Specifically, the lymphocytes are B lymphocytes.

[0026] The present invention also provides a method for constructing immortalized spinal muscular atrophy lymphocytes, and the method is: isolating peripheral blood mononuclear cells from the whole blood of spinal muscular atrophy patients, and co-culturing the peripheral blood mononuclear cells with Epstein-Barr virus solution and the transformation medium until the immortalization of lymphocytes is successful.

[0027] Specifically, the construction method includes the following steps:

[0028] S1. Resuspending the isolated peripheral blood mononuclear cells with the transformation medium of the present invention and then adding Epstein-Barr virus solution to obtain a mixed system of Epstein-Barr virus and cells;

[0029] S2. Oscillating and culturing the mixed system obtained in S1 for 1.5 - 3 h, then collecting the cells, resuspending with an equal volume of the transformation medium and continuing the culture;

[0030] S3. When the cells are continuously cultured until 115 - 125 h, replace half of the culture medium and supplement with Epstein - Barr virus solution; continue to culture for 115 - 125 h, replace half of the culture medium, supplement with Epstein - Barr virus solution and then continue to culture; thereafter, replace half of the culture medium every 115 - 125 h of culture until the lymphocytes are successfully immortalized, and then the immortalized spinal muscular atrophy lymphocyte strain is obtained.

[0031] Specifically, the transformation media are all fresh transformation media, and it is recommended to prepare and use them immediately.

[0032] Specifically, in S1, for the cells extracted from every 5 - 10 mL of whole blood, add 0.25 - 0.5 mL of the transformation medium described in claim 1 and 0.25 - 0.5 mL of Epstein - Barr virus solution, and the concentration of the Epstein - Barr virus solution is 1×10^7 copies / mL - 3×10^7 copies / mL.

[0033] Specifically, the half - volume medium replacement in S3 means discarding 0.5 volume of the old culture medium and supplementing with 0.5 volume of fresh transformation medium.

[0034] Specifically, the volume of the Epstein - Barr virus solution supplemented in S3 is half of the Epstein - Barr virus solution used in S1. More specifically, the concentration of the Epstein - Barr virus solution is 2×10^7 copies / mL.

[0035] Based on the immortalized spinal muscular atrophy lymphocytes constructed by using the said method, sub - culturing them can obtain the corresponding immortalized cell line.

[0036] The present invention also claims the immortalized spinal muscular atrophy lymphocytes constructed by the said construction method.

[0037] Specifically, the immortalized lymphocytes include immortalized lymphocyte strains and immortalized lymphocyte lines.

[0038] Specifically, the lymphocytes are B lymphocytes.

[0039] The present invention also provides a method for constructing the corresponding immortalized lymphocyte line by using the obtained immortalized lymphocyte strain and a method for obtaining the raw material of the immortalized lymphocyte quality control product through long - term culture.

[0040] Specifically, the method for constructing the immortalized lymphocyte line is as follows:

[0041] The immortalized successful cell line is used as the P0 primary cells; for P1 - P2 generations: when the cell density reaches 1 - 2×10^6 cells / mL, add 1 - 2 times the volume of the original culture medium of 1640 complete medium with 20% FBS (containing 2.5 μg / mL CpG ODN) for subculture for 3 - 5 days, and centrifuge and subculture into a T75 culture flask; for P3 - P4 generations: when the cell density reaches 1 - 2×10^6 cells / mL, add 1 - 2 times the volume of the original culture medium of 1640 complete medium with 20% FBS (containing 2.5 μg / mL CpG ODN) for subculture, and according to the cell growth rate, subculture into a T175 culture flask every 3 - 5 days; for P5 - P6 generations: the same as the previous (P3 - P4 generations); after the culture is completed, centrifuge the cell suspension, add serum-free cryopreservation solution for cryopreservation, and store it in liquid nitrogen permanently.

[0042] Specifically, the method for obtaining the immortalized lymphocyte quality control product through long-term culture is as follows:

[0043] Take the cryopreserved immortalized cell line, transfer the cell suspension to a centrifuge tube after a 37°C water bath, centrifuge at 800 rpm for 5 min, discard the supernatant, resuspend the precipitate with 1640 complete medium with 15% FBS (containing 1.25 μg / mL CpG ODN) to 5×10^5 - 7.5×10^5 cells / mL, culture under the conditions of 37°C and 5% CO2 for 3 - 4 days, and subculture at a ratio of 1:3 (v / v) after the cell density reaches 1×10^6 - 2×10^6 cells / mL; the subsequent culture is the same as before until the cells reach the required quantity.

[0044] In a specific embodiment of the present invention, the immortalized lymphocytes are immortalized spinal muscular atrophy lymphocyte strains or immortalized spinal muscular atrophy lymphocyte lines.

[0045] In a specific embodiment of the present invention, the genotypes of the immortalized spinal muscular atrophy lymphocytes include SMN1 / SMN2 = 0 / 3, SMN1 / SMN2 = 1 / 2, SMN1 / SMN2 = 0 / 2. That is, regardless of the genotype of the spinal muscular atrophy lymphocytes, the corresponding immortalized cells can be constructed using the construction method described in the present invention. Therefore, immortalized spinal muscular atrophy lymphocytes with other genotypes can be constructed using the construction method described in the present invention.

[0046] In addition to the above genotypes, the genotypes of the immortalized spinal muscular atrophy lymphocytes also include SMA micropoint mutations: c.22dupA, c.683T>A, c.689C>T, c.863G>T, c.400G>A, c.463_464delAA, c.835 - 5T>G.

[0047] The immortalized spinal muscular atrophy lymphocytes constructed in the present invention have a stable genetic background, high interoperability with clinical samples, strong compatibility, and can be stably preserved. Therefore, the present invention also claims the use of the immortalized spinal muscular atrophy lymphocytes in the preparation of a positive control product for the detection of spinal muscular atrophy genes.

[0048] The present invention also claims the use of immortalized spinal muscular atrophy lymphocytes in the preparation of spinal muscular atrophy gene detection products.

[0049] Specifically, the cells are used as a positive control product for the detection of spinal muscular atrophy genes.

[0050] The present invention has the following beneficial effects:

[0051] In view of the deficiency that the existing method of immortalizing lymphocytes with Epstein-Barr virus cannot efficiently transform spinal muscular atrophy lymphocytes into immortalized cells, the present invention provides a transformation medium and a method for constructing immortalized spinal muscular atrophy lymphocytes using the medium. Using the method of the present invention, immortalized spinal muscular atrophy lymphocyte strains can be constructed within 30 days, and the corresponding immortalized cell lines can be obtained by subculturing them. When constructing immortalized spinal muscular atrophy lymphocytes using the method, not only is the required time short and the success rate high, but the genetic background of the obtained immortalized cells is stable, the interoperability with clinical samples is high, the compatibility is good, they can be stably preserved, and can be used as positive control products in the gene detection of spinal muscular atrophy to ensure the accuracy of the detection. Description of the Drawings

[0052] Figure 1 Microscopic images of cells at different days after transfection during the construction of immortalized spinal muscular atrophy lymphocytes in Example 1; in the figure, Figure a is at 0 days after transfection, Figure b is at 10 days after transfection, and Figure c is at 20 days after transfection.

[0053] Figure 2 Results of genotyping the immortalized spinal muscular atrophy lymphocytes constructed in Example 1 using time-of-flight mass spectrometry; in the figure, Figure a is the detection result of SMN1-E7 and SMN2-E7 genes, and Figure b is the detection result of SMN1-E8 and SMN2-E8 genes.

[0054] Figure 3 Detection results of the immortalized spinal muscular atrophy lymphocytes constructed in Example 1 using the Wuseshi SMN1 exon deletion detection kit; in the figure, Figure a is the detection result of SMN1-E7 gene, and Figure b is the detection result of SMN1-E8 gene; the green curve in the figure is the amplification curve of the internal standard gene, and the blue curve is the amplification curve of the target gene.

[0055] Figure 4 The detection results of using the SMN1 detection kit independently developed by Kip to detect the immortalized spinal muscular atrophy lymphocytes constructed in Example 1; in the figure, the red curve is the amplification curve of the internal reference gene, the blue curve is the amplification curve of the SMN1-E7 gene, and the green curve is the detection result of the SMN1-E8 gene.

[0056] Figure 5 The detection results of using the SMN1 detection kit of Huizhong Biology to detect the SMN1-E7 gene of the immortalized spinal muscular atrophy lymphocytes constructed in Example 1; in the figure, the red curve is the amplification curve of the internal reference gene, and the green curve is the amplification curve of the target gene.

[0057] Figure 6 The detection results of using the multiplex ligation-dependent probe amplification (MLPA) detection kit of MRC to detect the immortalized spinal muscular atrophy lymphocytes constructed in Example 1. Detailed implementation manners

[0058] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific embodiments, but the embodiments do not impose any form of limitation on the present invention. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.

[0059] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0060] The Epstein-Barr virus used in the embodiments of the present invention is derived from B95-8 cells, which are derived from the white blood cells of rhesus monkeys exposed to Epstein-Barr virus extracted from human white blood cells, and the Epstein-Barr virus is Epstein-Barr virus type I.

[0061] The 1640 basal medium described in the embodiments of the present invention refers to RPMI-1640 medium without adding FBS (fetal bovine serum) and double antibodies (penicillin-streptomycin mixture); the 1640 complete medium refers to RPMI-1640 medium supplemented with a certain proportion of FBS and 1% (v / v) double antibodies, such as 1640 complete medium containing 20% FBS; the manufacturer of the penicillin-streptomycin mixture is Abbexa, and the product number is abs9244.

[0062] The nucleotide sequence of the CpG ODN described in the embodiments of the present invention is TCGTCGTTTTGTCGTTTTGT CGTT, as shown in SEQ ID NO.1.

[0063] Example 1 Construction of immortalized spinal muscular atrophy lymphocytes

[0064] This example takes peripheral blood mononuclear cells (PBMCs; containing lymphocytes and monocytes, mainly lymphocytes) extracted from the blood (5 mL whole blood) of an SMA patient with a genotype of SMN1 / SMN2 = 1 / 2 (SMN(1:2)) as an example to illustrate the method for constructing immortalized spinal muscular atrophy lymphocytes.

[0065] 1. Construction of immortalized cell line

[0066] It includes the following steps:

[0067] S1. In a 12-well plate, resuspend the peripheral blood mononuclear cells obtained from 5 mL of whole blood with 0.25 mL of transformation medium, and then add 0.25 mL of EBV working solution with a concentration of 2×10^7 copies / mL to obtain a mixed system of EBV and cells.

[0068] S2. Pipette and resuspend the cells in the mixed system, place them on a cell shaker, and culture them under the conditions of 70 rmp, 37 °C, and 5% CO2. After culturing for 2 h, centrifuge to obtain the precipitate, resuspend it with 0.5 mL of fresh transformation medium, and continue to culture the resuspended cells under the conditions of 37 °C and 5% CO2.

[0069] S3. When the cells are cultured until the 5th day, change half of the culture medium, and simultaneously supplement 0.25 mL of EBV working solution with a concentration of 2×10^7 copies / mL; when continuing to culture until the 10th day, change half of the culture medium, and simultaneously supplement 0.25 mL of EBV working solution with a concentration of 2×10^7 copies / mL; during the subsequent culture process, change half of the culture medium three times every 2 weeks, that is, change half of the culture medium every 5 days until immortalization is successful. At this time, the obtained cells are the immortalized cell line; the sign of successful immortalization is that the cells aggregate into clusters and proliferate rapidly, and under the microscope, it is found that the outer wall of the cells has irregular burr-like protrusions.

[0070] The transformation medium is based on 1640-GlutaMAX medium (manufacturer: gibco; product number: 72400047) containing 20% (v / v) FBS and 1% (v / v) penicillin-streptomycin mixture, and additionally add PHA-M (phytohemagglutinin M type; manufacturer: Yeasen Biotech; product number: 40110ES08) with a final concentration of 10 μg / mL, cyclosporin A (cyclosporine A; manufacturer: Sangon Biotech; product number: A600352-0005) with a final concentration of 2 μg / mL, and CpG ODN with a final concentration of 2.5 μg / mL.

[0071] During the process of constructing immortalized spinal muscular atrophy lymphocytes in this example, the microscopic images of the cells at different days after transfection are as Figure 1 shown; Figure 1In Figure a, it was 0 days after transfection; in Figure b, it was 10 days after transfection; in Figure c, it was 20 days after transfection. Combining Figure 1 It can be seen that when co-culturing with the transformation medium and Epstein-Barr virus for 20 days, a large number of cells have aggregated into clusters, the cell morphology has become larger and there are burr-like structures formed around, indicating the successful immortalization of the cells.

[0072] 2. Construction of immortalized cell line

[0073] Based on the obtained immortalized cell strain, expanding and subculturing it can obtain the corresponding immortalized cell line.

[0074] The method for constructing the immortalized cell line is as follows:

[0075] Using the successfully immortalized cell strain as the P0 primary cells;

[0076] For P1 - P2 generations: When the cell density reaches 1 - 2×10^6 cells / mL, supplement 1 - 2 times the volume of the original culture medium with 20% FBS in 1640 complete medium (containing 2.5 μg / mL CpG ODN) and subculture for 3 - 5 days, then centrifuge and subculture into a T75 culture flask;

[0077] For P3 - P4 generations: When the cell density reaches 1 - 2×10^6 cells / mL, supplement 1 - 2 times the volume of the original culture medium with 20% FBS in 1640 complete medium (containing 2.5 μg / mL CpG ODN) for subculture, and according to the cell growth rate, subculture into a T175 culture flask every 3 - 5 days;

[0078] For P5 - P6 generations: The same as the previous (P3 - P4 generations);

[0079] After the culture is completed, centrifuge the cell suspension, add serum-free cryopreservation solution for cryopreservation, and store it permanently in liquid nitrogen.

[0080] In addition, the preparation methods of the EBV working solution, B lymphocytes and transformation medium are as follows.

[0081] 3. Preparation of EBV working solution

[0082] It includes the following steps:

[0083] S1. Resuscitate B95-8 cells; Resuscitate and culture the B95-8 cell strain in a T75 culture flask with 1640 complete medium containing 20% FBS, culture at 37°C and 5% CO2 for 3 - 4 days, and replace half of the medium with 1640 complete medium containing 10% FBS every two days until the state of B95-8 cells returns to normal;

[0084] Batch culture of S2.B95-8 cells; Transfer the B95-8 cell suspension with normal state to a centrifuge tube, centrifuge at 800 rpm for 5 min, discard the supernatant, resuspend the precipitate with complete 1640 medium containing 10% FBS and add it to a T175 culture flask, and make up to 35 mL with complete 1640 medium containing 10% FBS, culture under the conditions of 37 °C and 5% CO2 for 3-4 days;

[0085] S3. Starvation culture of B95-8 cells; Collect the B95-8 cells cultured in batch in the T175 culture flask, blow and disperse to take a small amount of suspension for counting, adjust the concentration of B95-8 cells to 1×10 6 cells / mL with 1640 basal medium, and perform starvation culture for 7-10 days;

[0086] S4. Preparation of Epstein-Barr virus solution; Place the B95-8 cells and their culture medium after the end of starvation culture in an ultra-low temperature refrigerator until completely frozen, then place them at 37 °C to thaw until completely dissolved. After repeated freezing and thawing 3 times, centrifuge at 2500 rpm for 15 min, take the supernatant and filter it with a 0.22 μm needle filter to obtain the Epstein-Barr virus stock solution; Take a part (100 μL) of the virus stock solution for concentration determination, and dilute the Epstein-Barr virus stock solution with complete 1640 medium containing 20% FBS to obtain the EBV working solution.

[0087] 4. Isolation of peripheral blood mononuclear cells (PBMCs)

[0088] Including the following steps:

[0089] S1. Isolation of the buffy coat; Slowly add the whole blood of spinal muscular atrophy patients collected (collection time not exceeding 24 h) to lymphocyte separation medium (peripheral blood lymphocyte separation medium of Dakwo, product number 7922112), centrifuge at 20 °C and 800 g for 15 min; Slowly take out the centrifuge tube to keep the blood sample in a stratified state, discard the uppermost liquid, and aspirate all the middle buffy coat;

[0090] S2. Isolation of PBMC cells; Add 1640 basal medium to the isolated buffy coat, blow and wash the cells, centrifuge at 250 g for 10 min, repeat the washing once, discard the supernatant, then add 1640 basal medium and gently blow and mix evenly, centrifuge at 250 g for 5 min, and the obtained precipitate is the required PBMC cells.

[0091] 5. Preparation of transformation medium

[0092] Including the following steps:

[0093] S1. Take 1 tube of 100×CpG ODN mother liquor and 1 tube of 500×PHA-M mother liquor respectively. After they are completely melted, centrifuge briefly;

[0094] S2. Add 1 mL of pre-warmed (at 37 °C) 1640-GlutaMAX complete medium containing 20% FBS and 1% double antibody to the CpG ODN stock solution and the PHA-M stock solution respectively, and pipette and mix well.

[0095] S3. Take a sterilized 15 mL centrifuge tube, add all of the CpG working solution, 800 μL of the PHA-M working solution, and 20 μL of the 1000×cyclosporin A stock solution thereto, and make up to 10 mL with 20% FBS 1640-GlutaMAX complete medium (containing 1% penicillin-streptomycin mixture).

[0096] 6. Genotype identification

[0097] The present invention also identified the genotype of the immortalized spinal muscular atrophy lymphocytes prepared in this example.

[0098] Take out 200 μL of the cryopreserved immortalized cells, extract the cell DNA, and then perform genotype identification using the kit (time-of-flight mass spectrometry) independently developed by Kappe for detecting spinal muscular atrophy-related genes. The results are as Figure 2 shown; Figure 2 a in Figure 2 is the detection result of SMN1-E7 and SMN2-E7 genes, Figure 2 b in

[0099] is the detection result of SMN1-E8 and SMN2-E8 genes. Combining the results shown in

[0100] it can be seen that the genotype of the immortalized spinal muscular atrophy lymphocytes constructed in this example is SMN1 heterozygous deletion type SMN1 / SMN2 = 1 / 2 (SMN(1:2)).

[0101] In this example, referring to the method described in Example 1, the peripheral blood mononuclear cells extracted from the blood (5 mL of whole blood) of an SMA patient with a genotype of SMN1 / SMN2 = 0 / 2 (SMN(0:2)) were immortalized. The difference between this example and Example 1 is that in the transformation medium used, the final concentration of PHA-M is 9 μg / mL, the final concentration of cyclosporin A (CyA) is 2.5 μg / mL, and the final concentration of CpG ODN is 2 μg / mL.

[0102] After microscopic examination, when co-culturing with the transformation medium and Epstein-Barr virus in this example for 22 days, it was already visible that a large number of cells aggregated into clusters, the cell morphology became larger and there were burr-like structures formed around the cells, and the cell immortalization was successful.

[0103] Example 3 Construction of Immortalized Spinal Muscular Atrophy Lymphocytes

[0104] In this example, referring to the method described in Example 1, peripheral blood mononuclear cells extracted from the blood (5 mL whole blood) of an SMA patient with a genotype of SMN1 / SMN2 = 0 / 3 (SMN(0:3)) were immortalized. The difference between this example and Example 1 is that in the transformation medium used, the final concentration of PHA-M is 11 μg / mL, the final concentration of CyA is 1.5 μg / mL, and the final concentration of CpG ODN is 3 μg / mL.

[0105] After microscopic examination, when co-culturing with the transformation medium and Epstein-Barr virus in this example for 19 days, it was already visible that a large number of cells aggregated into clusters, the cell morphology became larger and there were burr-like structures formed around the cells, and the cell immortalization was successful.

[0106] Comparative Example 1

[0107] The difference between the transformation medium described in this comparative example and the transformation medium described in Example 1 is that the transformation medium described in this comparative example does not contain PHA-M and CpG ODN.

[0108] Comparative Example 2

[0109] The difference between the transformation medium described in this comparative example and the transformation medium described in Example 1 is that the transformation medium described in this comparative example does not contain CpG ODN.

[0110] Comparative Example 3

[0111] The difference between the transformation medium described in this comparative example and the transformation medium described in Example 1 is that the transformation medium described in this comparative example does not contain CyA and PHA-M.

[0112] Test Example 1 Comparison of Immortalization Success Rates of Different Transformation Media

[0113] In the present invention, the time required and the success rate for immortalizing spinal muscular atrophy lymphocytes were respectively tested using the transformation media described in Comparative Examples 1 to 3 (Serial Nos. 1 to 3) and Example 1 (Serial No. 4) based on the method described in Example 1. The results are shown in Table 1. Among them, the average immortalization success time is the time to construct an immortalized cell line, and the number of PBMC cells used for immortalization is 4 × 10^6 cells / mL.

[0114] Table 1 Success rate and immortalization time of immortalized culture using different transformation media

[0115]

[0116] As can be seen from Table 1, Epstein-Barr virus combined with the transformation medium described in the present invention can rapidly and efficiently immortalize spinal muscular atrophy lymphocytes.

[0117] Test Example 2 Genetic stability test of immortalized cells

[0118] The present invention carried out long-term culture on the immortalized cells constructed in Examples 1 and 3 to test their genetic stability.

[0119] The method for long-term culture of immortalized cells is as follows:

[0120] Take the cryopreserved immortalized cell line. After thawing in a 37°C water bath, transfer the cell suspension to a centrifuge tube, centrifuge at 800 rpm for 5 min, discard the supernatant, and resuspend the precipitate in 1640 complete medium containing 15% FBS (containing 1.25 μg / mL CpG ODN) to 5×10^5 - 7.5×10^5 cells / mL. Culture at 37°C and 5% CO2 for 3 - 4 days. After the cell density reaches 1×10^6 - 2×10^6 cells / mL, passage at a ratio of 1:3 (v / v); subsequent culture is the same as before.

[0121] Referring to the method described in the literature (Beijing Medical Association, Genetics Branch, Beijing Society for Diagnosis and Treatment of Rare Diseases. Expert consensus on genetic diagnosis of spinal muscular atrophy [J]. Chinese Medical Journal, 2020, 100(40): 3130 - 3140. DOI: 10.3760 / cma.j.cn112137 - 20200803 - 02267.), MLPA detection was performed on the immortalized cells at 0, 10, 30, and 60 days of culture to test the genetic stability of the immortalized spinal muscular atrophy lymphocytes constructed by the present invention. The results are shown in Table 2.

[0122] Table 2 Results of genetic stability test of immortalized cells

[0123]

[0124] As can be seen from the results shown in Table 2, the immortalized cells constructed by the present invention can still be stably inherited after 60 days of culture, indicating good genetic stability.

[0125] Test Example 3 Platform compatibility test

[0126] Using the immortalized cells obtained from Examples 1 and 3 as test materials, the DNA of the above immortalized cells was extracted using 3 different DNA extraction kits, and the concentration of the extracted DNA was detected using a NanoDrop ultra-micro ultraviolet spectrophotometer. The DNA extraction kits were respectively: ① Nucleic Acid Extraction Kit (DNA-L type magnetic bead method) (Chaozhou Kap Biosciences Co., Ltd., Yue Chao Medical Equipment Preparation 20140023); ② Nucleic Acid Extraction or Purification Reagent (Magnetic Bead Method DR-9600-KZ type) (Chaozhou Kap Biosciences Co., Ltd., Yue Chao Medical Equipment Preparation 20210003); ③ Blood / Cell / Tissue Genomic DNA Extraction Kit (Centrifugal Column Method) (Tiangen Biochemical Technology (Beijing) Co., Ltd., product number DP304). DNA was extracted according to the kit instructions, and the concentration and quality detection results are shown in Table 3.

[0127] Table 3 Detection Results of DNA Extracted by Different DNA Extraction Kits

[0128]

[0129]

[0130] Using the DNA of the extracted immortalized cells A and B as templates respectively, 4 different gene detection kits were used for detection respectively to test the platform compatibility of the immortalized cells described in the present invention. The gene detection kits were respectively: ① Survival Motor Neuron 1 (SMN1) Exon Deletion Detection Kit (Fluorescence Quantitative PCR Method) (Shanghai Wuseshi Medical Research Co., Ltd., product number YDLC-976); ② Kap's Self-developed Survival Motor Neuron 1 (SMN1) Detection Kit (Fluorescence PCR Method) (Guangzhou Kap Medical Technology Co., Ltd.); ③ Human Survival Motor Neuron 1 (SMN1) Detection Kit (PCR-Fluorescence Probe Method) (Shenzhen Huizhong Biotechnology Co., Ltd., National Medical Device Registration Approval 20223400080); ④ Multiplex Ligation-dependent Probe Amplification (MLPA) Detection Kit of the Dutch MRC Company (MRC Holland, product number: P021-B1 SMA). The immortalized cells were detected according to the instructions of the detection kits respectively, and the detection results are shown in Table 4; among them, the detection results of the immortalized cells with the genotype SMN(1:2) detected by the detection kits ① - ④ are as follows Figures 3 - 6 shown.

[0131] Table 4 Detection Results of Different Gene Detection Kits

[0132]

[0133] Note: The detection ranges of different detection kits are different. For example, the reagent of Wuseshi can only detect exons E7 and E8 of SMN1, while MLPA can detect exons E7 and E8 of both SMN1 and SMN2 simultaneously. Therefore, there are differences in the detection results shown in the table.

[0134] The above results indicate that the immortalized spinal muscular atrophy lymphocytes prepared by the present invention have good multi-platform applicability as spinal muscular atrophy quality control products and can be applied to extraction kits and detection kits with different principles.

[0135] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A transformation medium, characterized in that, The conversion culture medium consists of an animal cell basal medium and added components; the added components include 15% - 25% (v / v) fetal bovine serum, 1 - 3 μg / mL cyclosporine A, 8.5 - 11.5 μg / mL phytohemagglutinin, and 1.5 - 3.5 μg / mL CpG ODN; the nucleotide sequence of the CpG ODN is as shown in SEQ ID NO.

1.

2. Use of the conversion culture medium according to claim 1 and Epstein - Barr virus in constructing immortalized lymphocytes or in preparing a preparation for constructing immortalized lymphocytes.

3. The application according to claim 2, wherein The immortalized lymphocytes are immortalized spinal muscular atrophy lymphocytes.

4. A method for constructing immortalized spinal muscular atrophy lymphocytes, characterized in that, Isolate peripheral blood mononuclear cells or lymphocytes from the whole blood of spinal muscular atrophy patients, and co - culture the peripheral blood mononuclear cells with Epstein - Barr virus solution and the conversion culture medium according to claim 1 until lymphocyte immortalization is successful.

5. The construction method according to claim 4, characterized in that, Comprising the following steps: S1. Resuspend the isolated peripheral blood mononuclear cells or lymphocytes with the conversion culture medium according to claim 1, and then add Epstein - Barr virus solution to obtain a mixed system of Epstein - Barr virus and cells. S2. Oscillate and culture the mixed system obtained in S1 for 1.5 - 3 h, then collect the cells, resuspend them with an equal volume of the conversion culture medium according to claim 1, and continue the culture. S3. When the cells are continuously cultured to the 115 - 125 h, perform a half - volume medium change, and supplement with Epstein - Barr virus solution; continue the culture for 115 - 125 h, perform a half - volume medium change, supplement with Epstein - Barr virus solution, and then continue the culture; subsequently, perform a half - volume medium change every 115 - 125 h of culture until lymphocyte immortalization is successful, thus obtaining an immortalized spinal muscular atrophy lymphocyte strain.

6. The construction method according to claim 5, characterized in that, In S1, for the cells extracted from every 5 - 10 mL of whole blood, add 0.25 - 0.5 mL of the conversion culture medium according to claim 1 and 0.25 - 0.5 mL of Epstein - Barr virus solution, and the concentration of the Epstein - Barr virus solution is 1×10^7 copies / mL - 3×10^7 copies / mL.

7. The construction method according to claim 5, wherein The volume of the Epstein - Barr virus solution supplemented in S3 is half of the Epstein - Barr virus solution used in S1.

8. Immortalized spinal muscular atrophy lymphocytes constructed by the construction method according to any one of claims 4 - 7.

9. Use of the cells according to claim 8 in preparing a positive control product for spinal muscular atrophy gene detection.

10. Use of the cell according to claim 8 in the preparation of a gene detection product for spinal muscular atrophy, characterized in that, The cells are used as a positive control product for spinal muscular atrophy gene detection.

Images