Genetically engineered bacterium for producing glucuronic acid as well as construction method and application of genetically engineered bacterium

Abstract

The invention discloses a genetically engineered bacterium for producing glucuronic acid as well as a construction method and application of the genetically engineered bacterium, and belongs to the technical field of genetic engineering. According to the genetically engineered bacterium for producing glucuronic acid, an inositol oxidase gene MMIOX is integrated on a site of a uronic acid isomerase gene uxaC. According to the invention, an inositol oxidase gene MMIOX is integrated on a genome of a genetically engineered bacterium for producing glucuronic acid, and a uronic acid isomerase gene uxaC is knocked out at the same time, so that the genetically engineered bacterium can efficiently catalyze inositol reaction to generate glucuronic acid through the integrated inositol oxidase gene MMIOX; the glucuronic acid isomerase gene uxaC is knocked out, so that isomerization reaction of glucuronic acid can be avoided, and the yield of glucuronic acid is further increased.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a genetically engineered bacterium for producing glucuronic acid, a construction method thereof, and an application thereof. Background Art

[0002] Glucuronic acid, also known as glucuronate, is a uronic acid formed by oxidizing the C-6 hydroxyl group of glucose to a carboxyl group. It has various functions such as detoxification, antioxidant, anti-inflammatory, and liver protection. It is also an important intermediate for synthesizing many pharmaceuticals and is commonly used as an additive in functional beverages, weight loss drugs, cosmetics, etc.

[0003] Currently, in the prior art, glucuronic acid is mainly produced by biological methods, polysaccharide hydrolysis methods, or chemical oxidation methods. The biological method constructs a plasmid, transfers it into a host strain, selects positive strains for cultivation, and uses inositol as a substrate to produce glucuronic acid after the cultivation ends, but antibiotics need to be added during the strain cultivation process. The polysaccharide hydrolysis method hydrolyzes polysaccharides containing glucuronic acid to obtain glucuronic acid. The chemical oxidation method uses an oxidant to oxidize the hydroxyl group in the glucose molecule to a carboxyl group, thereby generating glucuronic acid. The efficiency of producing glucuronic acid using the above methods is not high, and there may also be problems such as high energy consumption and environmental pollution. Therefore, there is an urgent need for a method for efficiently producing glucuronic acid. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a genetically engineered bacterium for producing glucuronic acid, a construction method thereof, and an application thereof, which are used to overcome the problem of low production efficiency of glucuronic acid in the prior art.

[0005] In the first aspect, the present invention provides a genetically engineered bacterium for producing glucuronic acid, and the myo-inositol oxidase gene MMIOX is integrated at the locus of the glucuronate isomerase gene uxaC in this genetically engineered bacterium.

[0006] Compared with the prior art, in the present invention, the myo-inositol oxidase gene MMIOX is integrated into the genome of the genetically engineered bacterium for producing glucuronic acid, and at the same time, the glucuronate isomerase gene uxaC is knocked out. The integrated myo-inositol oxidase gene MMIOX enables this genetically engineered bacterium to efficiently catalyze the reaction of inositol to generate glucuronic acid. Knocking out the glucuronate isomerase gene uxaC can avoid the isomerization reaction of glucuronic acid, thereby further increasing the yield of glucuronic acid.

[0007] Furthermore, the myo-inositol oxidase gene MMIOX is the codon-optimized myo-inositol oxidase gene MMIOX, and the nucleotide sequence of the codon-optimized myo-inositol oxidase gene MMIOX is as shown in SEQ ID NO.1.

[0008] The above technical solution optimized the codons of the myo-inositol oxidase gene MMIOX, which can improve the expression efficiency and expression stability of myo-inositol oxidase, thereby further increasing the yield of glucuronic acid.

[0009] Furthermore, the nucleotide sequence of the glucuronate isomerase gene uxaC is shown in SEQ ID NO.2.

[0010] Furthermore, the starting strain used in the construction of the genetically engineered bacterium is Escherichia coli; this Escherichia coli is K12MG1655.

[0011] In a second aspect, the present invention provides a method for constructing a genetically engineered bacterium for producing glucuronic acid, which is used to construct the above-mentioned genetically engineered bacterium. The construction method includes:

[0012] Integrate the myo-inositol oxidase gene MMIOX into the gene locus uxaC of the genetically engineered bacterium to obtain a genetically engineered bacterium for producing glucuronic acid.

[0013] Furthermore, integrating the myo-inositol oxidase gene MMIOX into the gene locus uxaC of the genetically engineered bacterium includes the following steps:

[0014] The myo-inositol oxidase gene MMIOX is the codon-optimized myo-inositol oxidase gene MMIOX;

[0015] PCR amplify to obtain the pTargetF plasmid containing sgRNA;

[0016] Connect the upstream and downstream homologous arms of the glucuronate isomerase gene uxaC with the codon-optimized myo-inositol oxidase gene MMIOX by the method of overlap PCR to obtain a gene repair template: upstream homologous arm - MMIOX - downstream homologous arm;

[0017] Transfer the pTargetF plasmid containing sgRNA and the gene repair template into the host strain containing the pCas9 plasmid to obtain a genetically engineered bacterium for producing glucuronic acid.

[0018] Furthermore, it also includes:

[0019] After transferring the pTargetF plasmid containing sgRNA and the gene repair template into the host strain containing the pCas9 plasmid, eliminate the pTargetF plasmid and the pCas9 plasmid containing sgRNA.

[0020] The above technical solution eliminates the plasmid in the genetically engineered bacterium, eliminates the antibiotic resistance gene in the strain, reduces the spread of antibiotic resistance, and improves the biological safety.

[0021] In a third aspect, the present invention provides a method for preparing glucuronic acid, using the above-mentioned genetically engineered bacterium to produce glucuronic acid.

[0022] Compared with the prior art, the genetically engineered bacterium of the present invention can efficiently catalyze the reaction of inositol to produce glucuronic acid, effectively increasing the yield of glucuronic acid.

[0023] Further, the reaction system for producing glucuronic acid is as follows: phosphate buffer at 0.1 - 0.3 mM, genetically engineered bacterium at 15 - 25 g / L, inositol at 30 - 40 g / L, and Triton X-100 with a volume percentage of 0.5 - 1.5%.

[0024] Further, the pH value of the reaction system is 7.5 - 8.5, the reaction temperature is 35 - 40 °C, and the reaction time is 10 - 14 h.

[0025] In a fourth aspect, the present invention provides a method for preparing glucuronolactone, using the glucuronic acid produced by the above-mentioned genetically engineered bacterium to prepare glucuronolactone. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 PCR verification result of gene MMIOX in Example 3.

[0027] Figure 2 PCR verification result of gene uxaC in Example 3. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0028] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention clearer and more understandable, the following further describes the present invention in detail with reference to specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0029] It should be understood that the raw materials used in the following embodiments are all commercially available raw materials unless otherwise specified.

[0030] Example 1

[0031] Obtaining of plasmid

[0032] The pCas9 plasmid can be obtained by extracting from Escherichia coli DH5α containing the pCas9 plasmid using a plasmid extraction kit.

[0033] The pTargetF plasmid can be purchased from Fenghui Biotech Co., Ltd. in China. This pTargetF plasmid has a streptomycin resistance gene and a pMB replicon. PCR amplification reaction is carried out on this pTargetF plasmid to obtain a pTargetF plasmid containing sgRNA, and this sgRNA targets the glucuronate isomerase gene uxaC. The PCR amplification reaction system is shown in Table 1, and the PCR amplification reaction conditions are shown in Table 2.

[0034] sgRNA sequence:

[0035] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTG (SEQ ID NO.3).

[0036] Design primers for PCR of plasmid pTargetF according to the sgRNA sequence:

[0037] gUXAC F:

[0038] 5’GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTG3’ (SEQ ID NO.3).

[0039] gUXAC R:

[0040] 5’CACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC3’ (SEQ ID NO.4).

[0041] Table 1 PCR amplification reaction system (50 μL)

[0042] Component Volume (μL) 5×Phusion HF buffer (Phu High-Fidelity DNA Polymerase Buffer) 10 dNTP (2.5 mmol / L) (Deoxyribonucleotide) 4 pTargetF Plasmid Template 1 gUXACF 1.5 gUXACR 1.5 Phu High-Fidelity DNA Polymerase (2 U / μL) 0.5 <![CDATA[ddH2O]]> 31.5

[0043] Table 2 PCR amplification reaction conditions

[0044] Procedure Temperature Time Number of Cycles Pre-denaturation 95℃ 3 min Denaturation 95℃ 10s 30 Annealing 55℃ 30s 30 Extension 72℃ 5 min 30 Final Extension 72℃ 10 min Storage 4℃ ∞

[0045] Purify the reaction solution obtained after the above PCR reaction. The purified plasmid is transformed into Escherichia coli DH5α competent cells by chemical transformation method. Pick the correct positive clones for sequencing. After correct sequencing, extract the plasmid to obtain the pTargetF plasmid containing sgRNA.

[0046] Example 2

[0047] Construction of gene repair template (Donor DNA)

[0048] Optimize the codons of the target gene myo - inositol oxidase gene MMIOX, and then synthesize it artificially by Nanjing Genscript Corporation to obtain the optimized myo - inositol oxidase gene MMIOX, whose amino acid sequence is shown in SEQ ID NO.1.

[0049] Homologous arms were designed based on the genomic sequence of Escherichia coli K12 MG1655 and the upstream and downstream sequences of the uronic acid isomerase gene uxaC, obtaining the upstream homologous arm T1 (SEQ ID NO.5) and the downstream homologous arm T2 (SEQ ID NO.6).

[0050] The above two homologous arms T1 and T2 were ligated with the optimized myo - inositol oxidase gene MMIOX by overlapping PCR to obtain a gene repair template: upstream homologous arm - MMIOX - downstream homologous arm. The reaction system of overlapping PCR is shown in Table 3, and the reaction conditions of overlapping PCR are shown in Table 4.

[0051] Upstream primer of the upstream homologous arm:

[0052] F1: 5’CGCGTCAGGTAACCAAGCACG3’ (SEQ ID NO.7).

[0053] Downstream primer of the downstream homologous arm:

[0054] R3: 5’GATCGTCGCCCAGCTGTGAGC3’ (SEQ ID NO.8).

[0055] Table 3 Reaction system of overlapping PCR

[0056]

[0057] Table 4 Reaction conditions of overlapping PCR

[0058] Procedure Temperature Time Number of Cycles Pre-denaturation 98℃ 3 min Denaturation 98℃ 10s 32 Annealing 55℃ 30s 32 Extension 72℃ 30s 32 Final Extension 72℃ 10 min Storage 4℃ ∞

[0059] After the above overlapping PCR reaction, agarose gel electrophoresis and gel extraction were performed.

[0060] Example 3

[0061] The pTargetF plasmid containing sgRNA obtained in Example 1 above and the gene repair template (upstream homologous arm - MMIOX - downstream homologous arm) obtained in Example 2 were co - transformed into the competent cells of Escherichia coli K12 MG1655 containing the pCas9 plasmid by electroporation method, and the two plasmids used for gene editing were eliminated to obtain the target strain K12G001. Then, PCR technology was used for verification, and the results are as Figure 1 、 Figure 2 shown.

[0062] Figure 1 In lane M is the DNA Marker; in lane 1 is the PCR fragment of Escherichia coli K12 MG1655; in lane 2 is the PCR fragment of the target strain K12G001. As shown by Figure 1It can be seen that the gene MMIOX has been successfully integrated into the target strain K12G001.

[0063] Figure 2 In lane M is the DNA Marker; in lane 1 is the PCR fragment of Escherichia coli K12MG1655; in lane 2 is the PCR fragment of the target strain K12G001. It can be seen that Figure 2 the gene uxaC in the target strain K12G001 has been successfully knocked out.

[0064] The specific method for eliminating the two plasmids (pCas9 plasmid and pTargetF plasmid containing sgRNA) used for gene editing in Escherichia coli K12MG1655 is as follows:

[0065] S1: Streak the positive clones obtained after the above electrotransformation on an LB solid medium (containing 50 μg / mL kanamycin and 10 μg / mL streptomycin), and culture at 30 °C for 14 h.

[0066] S2: Pick the single colonies grown in step S1 into 2 mL of LB liquid medium (containing 10 μg / mL streptomycin), and culture at 37 °C and 220 r / min for 14 h.

[0067] S3: Take the bacterial liquid obtained by culturing in step S2 and streak it on an LB solid medium (containing 10 μg / mL streptomycin), and culture at 42 °C for 14 h.

[0068] S4: Take the single colonies obtained by culturing in step S3 and streak them respectively on LB solid medium 1 (containing 50 μg / mL kanamycin and 10 μg / mL streptomycin) and LB solid medium 2 (containing 10 μg / mL streptomycin), culture at 37 °C for 14 h. If growth occurs on LB solid medium 2 (containing 10 μg / mL streptomycin) while no growth occurs on LB solid medium 1 (containing 50 μg / mL kanamycin and 10 μg / mL streptomycin), it indicates that the pCas9 plasmid has been successfully eliminated.

[0069] S5: Take the single colonies with successfully eliminated pCas9 plasmid in step S4, pick them into 2 mL of LB liquid medium (without antibiotics), culture at 37 °C and 220 r / min. After the OD 600 value reaches 0.6, add IPTG with a final concentration of 0.25 mM and continue to induce culture for 14 h.

[0070] S6: Take the bacterial liquid after the induction culture in step S5, streak and spread it on an LB solid medium (without antibiotics), and culture at 37 °C for 14 h.

[0071] S7: Inoculate the single colonies grown in step S6 onto LB solid medium 3 (without antibiotics) and LB solid medium 2 (containing 10 μg / mL streptomycin) respectively. Those that grow on LB solid medium 3 (without antibiotics) but do not grow on LB solid medium 2 (containing 10 μg / mL streptomycin) are the target strains that have simultaneously eliminated the two plasmids (pCas9 plasmid and pTargetF plasmid containing sgRNA), named K12G001.

[0072] Example 4

[0073] Apply the strain K12G001 to the preparation of glucuronic acid. The specific method is as follows:

[0074] Inoculate a monoclonal colony of K12G001 into LB liquid medium (without antibiotics), and shake culture at 37 °C and 220 rmp / min until the OD 600 value reaches 0.6. Add L-arabinose with a final concentration of 2 g / L and continue to shake culture at 30 °C and 200 rmp / min for 14 h. After the culture is completed, centrifuge the culture solution at 4 °C and 8000 rmp / min for 15 min, discard the supernatant, and collect the cell precipitate.

[0075] Prepare glucuronic acid using the following reaction systems respectively:

[0076] Reaction system 1: Dissolve 20 g of cell precipitate (wet weight), 35 g of inositol, and Triton-X 100 cell permeabilization solution (Triton-X 100) in 0.2 mM phosphate buffer (pH 8.0) to make the total volume of the reaction system 1 L, and the volume percentage content of Triton-X 100 in the reaction system is 1%.

[0077] React at 37 °C for 12 h. After the reaction is completed, dilute 10 times with distilled water, centrifuge at 12000 rmp / min for 10 min, collect the supernatant, filter it through a 0.22 μm filter membrane, detect the content of glucuronic acid in the filtrate using HPLC, and calculate the conversion rate. The results are shown in Table 5.

[0078] Reaction system 2: Dissolve 15 g of cell precipitate (wet weight), 30 g of inositol, and Triton-X 100 cell permeabilization solution (Triton-X 100) in 0.1 mM phosphate buffer (pH 7.5) to make the total volume of the reaction system 1 L, and the volume percentage content of Triton-X 100 in the reaction system is 0.5%.

[0079] React at 35 °C for 10 h. After the reaction is completed, add distilled water to dilute 10 times, centrifuge at 12000 rmp / min for 10 min, collect the supernatant, filter it through a 0.22 μm filter membrane, use HPLC to detect the content of glucuronic acid in the filtrate, and calculate the conversion rate. The results are shown in Table 5.

[0080] Reaction system 3: Dissolve 25 g of cell precipitate (wet weight), 40 g of inositol, and Triton-X 100 cell permeabilization solution (Triton-X 100) in 0.3 mM phosphate buffer (pH 8.5) to make the total volume of the reaction system 1 L. The volume percentage content of Triton-X 100 in the reaction system is 1.5%.

[0081] React at 40 °C for 14 h. After the reaction is completed, add distilled water to dilute 10 times, centrifuge at 12000 rmp / min for 10 min, collect the supernatant, filter it through a 0.22 μm filter membrane, use HPLC to detect the content of glucuronic acid in the filtrate, and calculate the conversion rate. The results are shown in Table 5.

[0082] Example 5

[0083] The preparation method of glucuronolactone is as follows:

[0084] Centrifuge the reaction solution obtained after the reaction in Example 4 above at 8000 rmp / min for 30 min, collect the supernatant, and filter the supernatant through a ultrafiltration membrane module with a pore size of 10000 Da at an inlet pressure of 0.5 MPa, an outlet pressure of 0.3 MPa, and a flow rate of 150 L / h, and collect the ultrafiltration membrane permeate. Pass the ultrafiltration membrane permeate through a cation exchange resin for desalting at a flow rate of 1.5 BV, and the conductivity of the desalted solution is 5000 us / cm, and collect the desalted solution. Concentrate the desalted solution under a vacuum of -0.09 MPa until the solid content of the solution is 60% w / w to obtain a concentrated solution. Add phosphoric acid with a mass fraction of 90% to the concentrated solution, carry out an internal esterification reaction at an esterification temperature of 60 °C, and the addition amount of phosphoric acid is 20% of the volume of the concentrated solution. Evaporate the reaction solution obtained by the reaction under a vacuum of -0.09 MPa, and then crystallize it under the condition that the cooling rate is 5 °C / h, and the crystallization termination temperature is 5 °C to obtain the crude glucuronolactone. The purity of glucuronolactone is 99.5%, and the crystallization yield is 87%.

[0085] Comparative Example 1

[0086] This comparative example provides a method for preparing glucuronic acid, which includes the following steps: Dissolve 35 g of inositol and inositol oxidase in 0.2 mM phosphate buffer (pH 8.0) to make the volume of the whole reaction system 1 L, and the concentration of inositol oxidase in the reaction system is 0.4 U / mL. Carry out the conversion at 37 °C for 12 h. After the conversion is completed, obtain the glucuronic acid conversion solution, dilute it 10 times with distilled water, centrifuge at 12000 rmp / min for 10 min, collect the supernatant, filter it through a 0.22 μm filter membrane, detect the content of glucuronic acid in the filtrate by HPLC, and calculate the conversion rate. The results are shown in Table 5.

[0087] Table 5

[0088] Content of Glucuronic Acid in the System after the Reaction Conversion Rate of Glucuronic Acid Reaction System 1 of Example 4 31.72 g / L 84.28％ Reaction System 2 of Example 4 24.36 g / L 75.52％ Reaction System 3 of Example 4 31.65 g / L 73.58％ Comparative Example 1 17.23 g / L 45.78％

[0089] It can be seen from Table 5 that: Compared with Example 4, when using inositol oxidase to prepare glucuronic acid in Comparative Example 1, the content and conversion rate of glucuronic acid in the reaction system after the reaction are both significantly decreased, indicating that using the genetically engineered bacterium in the present invention to prepare glucuronic acid can significantly improve the yield and conversion rate of glucuronic acid.

[0090] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, for those skilled in the art, they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements for some of the technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A genetically engineered bacterium for producing glucuronic acid, characterized in that, The genetically engineered bacterium has integrated the myo - inositol oxidase gene MMIOX at the locus of the glucuronate isomerase gene uxaC.

2. The genetically engineered bacterium according to claim 1, characterized in that, The myo - inositol oxidase gene MMIOX is the codon - optimized myo - inositol oxidase gene MMIOX, and the nucleotide sequence of the codon - optimized myo - inositol oxidase gene MMIOX is shown as SEQ ID NO.

1.

3. The genetically engineered bacterium according to claim 1 or 2, characterized in that, The nucleotide sequence of the glucuronate isomerase gene uxaC is shown as SEQ ID NO.

2.

4. The genetically engineered bacterium according to claim 1, characterized in that, The starting strain used in constructing the genetically engineered bacterium is Escherichia coli; the Escherichia coli is K12 MG1655.

5. A method for constructing a genetically engineered bacterium for producing glucuronic acid, which is used to construct the genetically engineered bacterium according to any one of claims 1 to 4, characterized in that, The construction method includes: Integrating the myo - inositol oxidase gene MMIOX into the gene locus uxaC of the genetically engineered bacterium to obtain a genetically engineered bacterium for producing glucuronic acid.

6. The construction method according to claim 5, characterized in that, Integrating the myo - inositol oxidase gene MMIOX into the gene locus uxaC of the genetically engineered bacterium includes the following steps: The myo - inositol oxidase gene MMIOX is the codon - optimized myo - inositol oxidase gene MMIOX; PCR amplifying to obtain a pTargetF plasmid containing sgRNA; Connecting the upstream and downstream homologous arms of the glucuronate isomerase gene uxaC with the codon - optimized myo - inositol oxidase gene MMIOX by the method of overlap PCR to obtain a gene repair template: upstream homologous arm - MMIOX - downstream homologous arm; Transferring the pTargetF plasmid containing sgRNA and the gene repair template into a host strain containing the pCas9 plasmid to obtain a genetically engineered bacterium for producing glucuronic acid.

7. The construction method according to claim 6, characterized in that It also includes: After transferring the pTargetF plasmid containing sgRNA and the gene repair template into a host strain containing the pCas9 plasmid, eliminating the pTargetF plasmid containing sgRNA and the pCas9 plasmid.

8. A method for preparing glucuronic acid, characterized in that, Using the genetically engineered bacterium according to any one of claims 1 - 4 to produce glucuronic acid.

9. The preparation method of glucuronic acid according to claim 8, wherein, The reaction system for producing glucuronic acid is: 0.1 - 0.3 mM phosphate buffer, 15 - 25 g / L genetically engineered bacterium, 30 - 40 g / L myo - inositol, and Triton - 100 with a volume percentage of 0.5 - 1.5%.

10. The preparation method of glucuronic acid according to claim 9, characterized in that, The pH value of the reaction system is 7.5 - 8.5, the reaction temperature is 35 - 40 °C, and the reaction time is 10 - 14 h.

11. A method for preparing gluconolactone, characterized in that, Using the glucuronic acid produced by the genetically engineered bacterium according to any one of claims 8 - 10 to prepare glucurolactone.

Images