Biomarker for detecting primary local hyperhidrosis and application thereof

Abstract

The invention relates to the technical field of primary local hyperhidrosis, in particular to a biomarker for detecting primary local hyperhidrosis and application of the biomarker, and the biomarker comprises but is not limited to one or more of the ratio of Th17 cells to Treg cells, IL-17A, IL-6, ROR gamma t and FoxP3. According to the invention, a multi-dimensional detection system covering PFH core pathological links (immune disorder, hyperactivity of sympathetic nerves and hyperfunction of sweat gland) is constructed by integrating immune related markers such as Th17 / Treg cell ratio, IL-17A, IL-6, ROR [gamma] t, FoxP3 and the like and combining the concentrations of peripheral blood epinephrine (E) and noradrenaline (NE) and the gene expression levels of sweat gland tissues AQP5 and Cacna1c. And a potential molecular target is provided for developing a novel therapeutic strategy (such as specific blocking of an IL-17 signal channel or enhancement of a Treg function) of a targeted Th17 / Treg axis.

Description

Technical Field

[0001] The present invention relates to the technical field of primary focal hyperhidrosis, and specifically relates to biomarkers for detecting primary focal hyperhidrosis and their applications. Background Art

[0002] Primary focal hyperhidrosis (PFH) is a disease characterized by unpredictable excessive sweating in a local part of the body caused by the dysfunction of the sympathetic nervous system, such as excessive sweating in the palms, soles, armpits or face. Primary focal hyperhidrosis usually appears in adolescence or early adulthood and can significantly affect an individual's daily life, social interaction and emotional health. Although the exact cause of primary focal hyperhidrosis is not fully understood, it is thought to be related to genetics because it often runs in families. Stress and anxiety can exacerbate the symptoms, making them more obvious in a high-pressure environment. The treatment of PFH includes a series of treatment options, but needs to be tailored to each individual's needs and the severity of the symptoms. Non-surgical treatments for PFH include topical antiperspirants, oral anticholinergics, botulinum toxin injections and microwave thermolysis. Although these treatment methods have good short-term effects, they are prone to recurrence and may cause side effects such as muscle weakness and local pain. Among the existing treatment methods, thoracoscopic sympathectomy is the most effective method for treating PFH. However, the high incidence of compensatory hyperhidrosis after this surgery significantly affects the quality of life of patients, and in severe cases, it may even cause mental health problems. Therefore, exploring the pathogenesis of PFH, finding key pathogenic factors, and exploring new treatment methods with fewer side effects may bring new hope for the treatment of PFH. Summary of the Invention

[0003] The purpose of the present invention is to provide biomarkers for detecting primary focal hyperhidrosis and their applications. The present invention confirms that there is an imbalance in the Th17 / Treg cell balance in patients with primary focal hyperhidrosis (PFH), providing new evidence for the involvement of the immune system in the pathogenesis of this disease. Abnormal Th17 / Treg ratio in peripheral blood, changes in the serum cytokine profile (elevation of Th17-related pro-inflammatory factors and decrease of Treg-related anti-inflammatory factors), and disordered expression of key transcription factors in sweat gland tissue (upregulation of RORγt / downregulation of FOXP3) together suggest a characteristic immune imbalance pattern in PFH. It provides potential molecular targets for the development of new treatment strategies targeting the Th17 / Treg axis (such as specifically blocking the IL-17 signaling pathway or enhancing Treg function).

[0004] To achieve the above technical purposes and reach the above technical effects, the present invention is realized through the following technical solutions:

[0005] Biomarkers for detecting primary focal hyperhidrosis include, but are not limited to: the ratio of Th17 cells to Treg cells, IL-17A, IL-6, RORγt, FoxP3, one or more of them.

[0006] Furthermore, the Th17 cells are identified by surface markers CD3+CD4+ and intracellular markers RORγt+IL-17A+, and the Treg cells are identified by surface markers CD3+CD4+CD25+ and intracellular markers FoxP3+.

[0007] Furthermore, the biomarker also includes at least one of the following: the concentrations of adrenaline and noradrenaline in peripheral blood; the gene or protein expression levels of AQP5 and Cacna1c in sweat gland tissue.

[0008] Furthermore, at least one of the following, an increase in the Th17 / Treg ratio, an increase in the expression levels of IL-17A and IL-6, a decrease in the expression levels of IL-10 and TGF-β1, an increase in the RORγt / FoxP3 ratio, an increase in the concentrations of E and NE, and an increase in the expression levels of AQP5 and Cacna1c, is used as a positive predictive indicator for PFH.

[0009] On the other hand, the present invention provides the use of the above-mentioned markers in the preparation of a detection kit for primary focal hyperhidrosis, and the kit contains at least one of the following components:

[0010] Antibodies specifically recognizing CD3, CD4, RORγt, IL-17A, FoxP3, CD25;

[0011] ELISA detection reagents for IL-17A, IL-6, IL-10, TGF-β1;

[0012] Protein or gene detection reagents for RORγt, FoxP3, AQP5, Cacna1c;

[0013] High performance liquid chromatography (HPLC) detection reagents for adrenaline and noradrenaline.

[0014] On the other hand, the present invention provides a pharmaceutical composition for treating primary focal hyperhidrosis, and the pharmaceutical composition contains at least one of the following active ingredients:

[0015] Inhibitors that inhibit Th17 cell differentiation, selected from RORγt antagonists, IL-17A neutralizing antibodies or IL-6 receptor blockers;

[0016] Activators that promote Treg cell differentiation, selected from TGF-β1, IL-10 or FoxP3 expression enhancers;

[0017] Sympathetic nerve activity regulators, selected from β-adrenergic receptor antagonists or α-adrenergic receptor agonists.

[0018] On the other hand, the present invention proposes the application of the above-mentioned biomarker in screening PFH therapeutic drugs, and detects the regulatory effects of candidate compounds on the Th17 / Treg ratio, IL-17A, IL-6, IL-10, TGF-β1, RORγt, and FoxP3 through in vitro or in vivo models to screen compounds with PFH treatment potential.

[0019] Advantages of the present invention:

[0020] The present invention constructs a multi-dimensional detection system covering the core pathological links of PFH (immune disorder, sympathetic overactivation, and hyperhidrosis of sweat glands) by integrating immune-related markers such as Th17 / Treg cell ratio, IL-17A, IL-6, RORγt, and FoxP3, combined with the concentrations of adrenaline (E) and noradrenaline (NE) in peripheral blood and the expression levels of AQP5 and Cacna1c genes in sweat gland tissues. Th17 cells drive the secretion of IL-17A and IL-6 through the RORγt transcription factor, directly activating the inflammatory response around sweat glands, while Treg cells inhibit inflammation through the IL-10 / TGF-β1 signal mediated by FoxP3. An increase in the Th17 / Treg ratio indicates that immune homeostasis imbalance is the key driving factor of PFH. At the same time, an increase in the E / NE concentration enhances the cAMP-PKA signal by activating the β2-adrenergic receptor in sweat glands, promoting the membrane localization of the AQP5 water channel and the sweat secretion dependent on the Cacna1c calcium channel. The combined detection of sympathetic neurotransmitters and sweat gland function genes in the biomarker system can accurately distinguish between "immune-dominant" and "sympathetic hyperactivity" PFH subtypes. Compared with single-index detection, the present invention significantly improves the diagnostic specificity through multi-pathway collaborative analysis. For example, AQP5, as a sweat gland-specific biomarker, can exclude the interference of systemic inflammatory diseases, and the combination of the Th17 / Treg ratio and the E / NE concentration can clarify the interaction between the immune and sympathetic nervous systems, providing a basis for individualized treatment.

[0021] The pharmaceutical composition proposed by the present invention precisely regulates immune imbalance through a dual strategy of inhibiting Th17 cell differentiation (RORγt antagonist, IL-17A neutralizing antibody, IL-6 receptor blocker) and promoting Treg cell function (TGF-β1, IL-10, FoxP3 enhancer). The RORγt antagonist inhibits the expression of IL-17A from the source by blocking the activity of the key transcription factor of Th17 cells, while the IL-17A neutralizing antibody directly neutralizes the pro-inflammatory factor and blocks the inflammatory cascade reaction triggered by its activation of the NF-κB pathway around the sweat gland. TGF-β1 and IL-10 synergistically promote the expansion of Treg cells through the SMAD3 / STAT3 signaling pathway, enhance their inhibitory effect on Th17 cells, and at the same time inhibit the local inflammatory microenvironment through the paracrine effect of regulatory cytokines. Compared with the systemic side effects (dry mouth, constipation) caused by the non-selective action of traditional anticholinergic drugs (such as oxybutynin), the present invention realizes local inflammation regulation by targeting key nodes of immune cell differentiation, reduces the risk of systemic immunosuppression, and the multi-target synergy can reduce the single drug dose and further avoid drug resistance.

[0022] The present invention forms a full-pathway intervention of "neurotransmitter release-receptor activation-effector function" by jointly applying β-adrenergic receptor antagonists (such as propranolol), α2 receptor agonists (such as clonidine), and siRNA or antisense oligonucleotides (ASO) targeting AQP5 / Cacna1c. The β receptor antagonist competitively blocks the β2 receptor of the sweat gland, inhibits the membrane localization of AQP5 and sweat secretion mediated by the cAMP-PKA signaling pathway; the α2 receptor agonist inhibits the release of NE through negative feedback by activating the presynaptic membrane receptor, reducing sympathetic nerve tension. At the same time, AQP5 siRNA degrades mRNA through RNA interference to reduce the expression of aquaporin, directly inhibiting the water permeability of the sweat gland duct; Cacna1c ASO reduces Ca 2 + influx-dependent secretion. Compared with the temporary neuromuscular junction block of botulinum toxin (which needs to be repeated every 3-6 months), gene silencing technology can achieve long-term regulation of sweat gland secretion function (from several weeks to several months), and enhances tissue targeting through delivery systems such as lipid nanoparticles, avoiding the risk of systemic exposure. By the synergistic effect of multiple links, the incidence of compensatory hyperhidrosis is reduced, and the trauma and postoperative complications of traditional thoracoscopic sympathectomy are significantly reduced.

[0023] The kit developed by the present invention integrates flow cytometry (Th17 / Treg cell typing), ELISA (detection of cytokines such as IL-17A and IL-6), HPLC (E / NE quantification), and qPCR (analysis of AQP5 and Cacna1c gene expression), achieving comprehensive coverage detection of the pathological links of PFH (immunity, nerve, and sweat gland). Flow cytometry accurately quantifies the proportion of Th17 / Treg cell subsets through multi-color labeling of CD3 / CD4 / RORγt / FoxP3. ELISA and HPLC analyze the inflammatory state and sympathetic nerve activity from the levels of proteins and metabolites respectively, while qPCR directly correlates with abnormal expression of sweat gland function genes. The combined detection of multiple technologies can quickly distinguish PFH subtypes (such as a high Th17 / Treg ratio accompanied by overexpression of AQP5 indicating abnormalities in both immune-sweat gland pathways), guiding the optimization of treatment strategies (such as the combination of immunomodulators and AQP5 siRNA). In addition, an in vitro Th17 / Treg differentiation model constructed based on peripheral blood mononuclear cells (PBMC) of patients can simulate the in vivo immune microenvironment and directly evaluate the regulatory effects of candidate drugs (such as RORγt antagonists) on the Th17 / Treg balance and inflammatory factors, significantly shortening the drug screening cycle and improving the clinical translation relevance. Compared with traditional animal models, the present invention is more disease-specific and can construct a personalized drug sensitivity platform based on individual patient cells, promoting the application of precision medicine.

[0024] Of course, it is not necessary for any product implementing the present invention to achieve all the above-mentioned advantages simultaneously. Brief Description of the Drawings

[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for the description of the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present invention, and those of ordinary skill in the art can obtain other drawings without creative efforts based on these drawings.

[0026] Figure 1 Comparison of Th17 (a), Treg (b) lymphocyte subsets and Th17 / Treg ratio (c) in peripheral blood of patients with primary focal hyperhidrosis (PFH, n = 180) and healthy control group (HC, n = 80). Data are expressed as mean ± standard deviation. ***p < 0.001 (using Welch-corrected t-test). ROC curve analysis of Th17 (d), Treg (e) lymphocyte subsets and Th17 / Treg ratio (f) in peripheral blood for differentiating patients with primary focal hyperhidrosis from healthy controls.

[0027] Figure 2Comparison of the subsets of Th17 (a), Treg (b) lymphocytes and the Th17 / Treg ratio (c) in the peripheral blood of patients in the healthy control group (n = 80), primary palmar hyperhidrosis group (n = 60), primary axillary hyperhidrosis group (n = 60) and primary craniohidrosis group (n = 60). Data are expressed as mean ± standard deviation. ***p < 0.001 (Brown-Forsythe analysis of variance combined with Dunnett's T3 multiple comparison test).

[0028] Figure 3 Comparison of the levels of serum IL-17 (a), IL-6 (b), IL-10 (c) and TGF-β1 (d) in patients in the healthy control group (n = 80), primary palmar hyperhidrosis group (n = 60), primary axillary hyperhidrosis group (n = 60) and primary craniohidrosis group (n = 60). Data are expressed as mean ± standard deviation. **p < 0.01, ***p < 0.001 (Brown-Forsythe analysis of variance combined with Dunnett's T3 multiple comparison test).

[0029] Figure 4 Changes in the expression of RORγt and FOXP3 in the sweat gland tissues of patients with primary local hyperhidrosis. (a) qRT-PCR was used to detect the expression of RORγt mRNA in the sweat gland tissues of each group; (b) FOXP3 mRNA expression (n = 6 in each group); (c) Western blotting was used to detect the expression of RORγt and FOXP3 proteins in the lysates of sweat gland tissues; (d-e) Using β-actin as an internal reference, the protein expression levels were normalized to the HC group (n = 6 in each group). Data are expressed as mean ± standard deviation. ***p < 0.001 (Brown-Forsythe analysis of variance combined with Dunnett's T3 multiple comparison test). Detailed implementation manners

[0030] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the scope of protection of the present invention.

[0031] Example 1

[0032] The biomarkers for detecting primary local hyperhidrosis described in this example include, but are not limited to: the ratio of Th17 cells to Treg cells, IL-17A, IL-6, RORγt, FoxP3, one or more of them.

[0033] In this embodiment, the Th17 cells are identified by surface markers CD3+CD4+ and intracellular markers RORγt+IL-17A+, and the Treg cells are identified by surface markers CD3+CD4+CD25+ and intracellular marker FoxP3+.

[0034] In this embodiment, the biomarker further comprises at least one of the following: the concentrations of adrenaline and noradrenaline in peripheral blood; the gene or protein expression levels of AQP5 and Cacna1c in sweat gland tissue.

[0035] In this embodiment, at least one of the following, including an increased Th17 / Treg ratio, increased expression levels of IL-17A and IL-6, decreased expression levels of IL-10 and TGF-β1, increased RORγt / FoxP3 ratio, increased concentrations of E and NE, and increased expression levels of AQP5 and Cacna1c, is used as a positive predictive indicator for PFH.

[0036] On the other hand, the present invention provides an application of the above-mentioned markers in the preparation of a detection kit for primary focal hyperhidrosis, and the kit comprises at least one of the following components:

[0037] Antibodies specifically recognizing CD3, CD4, RORγt, IL-17A, FoxP3, CD25;

[0038] ELISA detection reagents for IL-17A, IL-6, IL-10, TGF-β1;

[0039] Protein or gene detection reagents for RORγt, FoxP3, AQP5, Cacna1c;

[0040] High performance liquid chromatography (HPLC) detection reagents for adrenaline and noradrenaline.

[0041] On the other hand, the present invention provides a pharmaceutical composition for treating primary focal hyperhidrosis, and the pharmaceutical composition comprises at least one of the following active ingredients:

[0042] Inhibitors that inhibit Th17 cell differentiation, selected from RORγt antagonists, IL-17A neutralizing antibodies or IL-6 receptor blockers;

[0043] Activators that promote Treg cell differentiation, selected from TGF-β1, IL-10 or FoxP3 expression enhancers;

[0044] Sympathetic nerve activity regulators, selected from β-adrenergic receptor antagonists or α-adrenergic receptor agonists.

[0045] On the other hand, the present invention provides the use of the above-mentioned biomarker in screening therapeutic drugs for PFH. By detecting the regulatory effects of candidate compounds on the Th17 / Treg ratio, IL-17A, IL-6, IL-10, TGF-β1, RORγt, and FoxP3 in vitro or in vivo models, compounds with potential for PFH treatment can be screened.

[0046] Example 2

[0047] Research subjects

[0048] Eighty healthy controls and 60 patients with primary palmar hyperhidrosis (PPH), primary craniomofacial hyperhidrosis (PCH), and primary axillary hyperhidrosis (PAH) from the First Affiliated Hospital of Fujian Medical University were included. All subjects were Han ethnicity, aged ≥18 years, and had signed an informed consent form. Exclusion criteria: patients with impaired function of vital organs, infectious diseases, autoimmune diseases, long-term use of immunosuppressants, and tumors. This study was approved by the hospital ethics committee (

[2021] 466).

[0049] Isolation of PBMCs

[0050] Fasting blood was collected from all subjects, and peripheral blood PBMCs were isolated as follows: Under sterile conditions, 1 ml of Ficoll was added to a 15 ml centrifuge tube first, then 1 ml of freshly anticoagulated peripheral blood was taken, mixed with an equal volume of PBS, and carefully added above the Ficoll liquid surface, trying to keep the liquid interface clear. At room temperature, centrifuge at 400×g for 15 min. After centrifugation, it was divided into four layers from top to bottom: plasma layer, monocyte layer, transparent separation liquid layer, and blood cell layer. Carefully aspirate the second cloudy target cell layer and place it into a centrifuge tube containing PBS, mix well, and centrifuge at 2000 rpm for 10 min. The precipitate was washed twice with PBS to obtain PBMCs. PBMCs were resuspended with RPMI1640 medium, and the cell concentration was adjusted to 1 - 2×106 / ml after cell counting. First, 500 μl was taken for FACS staining of Treg cells; another 600 μl was placed in a 24-well cell culture plate, appropriate amounts of the stimulation blocker PMA and BFA were added, and cultured in a 37°C, 5% CO2 cell culture incubator for 5 h, and the cells were collected for FACS staining of Th17 cells.

[0051] Detection of Th17 cells

[0052] FACS detection of Th17 cells: Resuspend the in vitro-stimulated cells. Take 100 μl of the cell suspension into 1.5 ml EP tubes respectively, and divide them into blank tubes, compensation tubes, and sample tubes. Add 5 μl of each surface antibody (CD3-FITC and CD4-APC), incubate at room temperature in the dark for 30 min, centrifuge at 400×g for 5 min, discard the supernatant, and resuspend the cells. Add 100 μl of Fixation / Permeabilization Solution A, incubate at room temperature for 15 min, mix with flow cytometry buffer, centrifuge at 400×g for 5 min, discard the supernatant and resuspend. Add 100 μl of Fixation / Permeabilization Solution B and 5 μl of intracellular antibody (IL-17-PE), incubate at 4°C in the dark for 30 min, mix with flow cytometry buffer, centrifuge at 400×g for 5 min, discard the supernatant. Add 100 μl of 4% paraformaldehyde, incubate at 4°C in the dark for 15 min, wash twice, centrifuge at 400×g for 5 min, discard the supernatant. Add 300 μl of PBS to resuspend the cells, place them at 4°C in the dark, and wait for detection by flow cytometry.

[0053] Detection of Treg cells

[0054] FACS detection of Treg cells: Resuspend the cells. Take 100 μl of the cell suspension into 1.5 ml EP tubes respectively, and divide them into blank tubes, compensation tubes, and sample tubes. Prepare the solutions: Prepare the required Fixation / Permeabilization Solution D and Wash Buffer E according to the instructions for standby. Add 5 μl of each surface antibody (CD4-FITC and CD25-PE), incubate at room temperature in the dark for 25 min, add flow cytometry buffer, centrifuge at 400×g for 5 min, discard the supernatant. Add 1 ml of the prepared Fixation / Permeabilization Solution D, incubate at room temperature in the dark for 40 min. Add 2 ml of the diluted Wash Buffer E, centrifuge at 400×g for 5 min, discard the supernatant, and resuspend the precipitate. Add 5 μl of intracellular antibody (Foxp3-APC), incubate at room temperature in the dark for 40 min, add 2 ml of Wash Buffer E, mix well, centrifuge at 400×g for 5 min, discard the supernatant. Add 100 μl of 4% paraformaldehyde, incubate at 4°C in the dark for 15 min, wash twice with PBS, centrifuge at 400×g for 5 min, discard the supernatant. Add 300 μl of PBS to resuspend the cells, place them at 4°C in the dark and wait for detection by flow cytometry.

[0055] Collection of sweat gland tissue

[0056] Obtain the sweat gland tissue of PFH patients by single-port axillary surgery, and take an equal volume of surrounding normal tissue in the control group. All cases have no family history of hyperhidrosis in other parts and a history of bromhidrosis.

[0057] RT-PCR detection

[0058] Extract total RNA by TRIzol method and reverse transcribe to synthesize cDNA. Primer sequences:

[0059] FOXP3:

[0060] F:TTTCTGTCAGTCCACTTCACCA

[0061] R:CCAGCAGGTCTGAGGCTTTG

[0062] RORγt:

[0063] F:GTGGGGACAAGTCGTCTGG

[0064] R:AGTGCTGGCATCGGTTTCG

[0065] β-actin:

[0066] F:TGGCACCCAGCACAATGAA

[0067] R:CTAAGTCATAGTCCGCCTAGAAGCA

[0068] The PCR products were analyzed by agarose gel electrophoresis, and the relative expression levels were calculated using β-actin as an internal reference.

[0069] ELISA detection

[0070] The Fine Test kit was used to detect the concentrations of serum IL-17 (EH3267, inter-batch CV 4.94%, intra-batch CV 5.27%), IL-10 (EH0173, 5.05% / 5.19%), IL-6 (EH0201, 4.66% / 4.87%), and TGF-β1 (EH0287, 5.53% / 5.92%).

[0071] Statistical analysis

[0072] SPSS 15.0 software was used, and the sample size calculation formula: α = 0.05 and β = 0.2 were set. For measurement data, t-test or Brown-Forsythe analysis of variance + Dunnett T3 multiple comparison was used, and for count data, χ 2 test was used. P < 0.05 was considered statistically significant.

[0073] Results

[0074] Demographics and clinical characteristics

[0075] A total of 240 subjects were included in this study, including 80 healthy controls (HC), and 60 patients with PPH, PCH, and PAH respectively. There were no significant differences in age (p = 0.297) and gender distribution (p = 0.336) between the healthy control group and the PFH group (Table 1).

[0076] Table 1 Demographic and clinical characteristics of patients with primary focal hyperhidrosis (PFH) and healthy controls (HC) included in the study

[0077]

[0078] Data are presented as number of cases (percentage, %) or mean ± standard deviation. The p-value was calculated using the Mann-Whitney test, and the distribution of categorical variables was evaluated using Fisher's exact test.

[0079] Imbalance in the Th17 / Treg cell ratio in patients with PFH

[0080] By comparing 80 healthy controls with 180 patients with PFH, it was found that: the proportion of Th17 cells in the peripheral blood of patients with PFH was significantly increased ( Figure 1 a), the proportion of Treg cells was significantly decreased ( Figure 1 b), resulting in a significant increase in the Th17 / Treg ratio ( Figure 1 c). ROC curve analysis showed that peripheral blood Th17 (sensitivity 61.67%, specificity 71.25%, AUC = 0.72, p < 0.001; Figure 1 d), Treg (sensitivity 82.78%, specificity 64.75%, AUC = 0.76, p < 0.001; Figure 1 e) and the Th17 / Treg ratio (sensitivity 71.11%, specificity 93.75%, AUC = 0.86, p < 0.001; Figure 1 f) all had diagnostic value for PFH, and the Th17 / Treg ratio had the best diagnostic efficacy.

[0081] Comparison of Th17 / Treg ratio among PFH subtypes

[0082] By comparing 80 healthy controls, 60 patients with PPH, 60 patients with PCH and 60 patients with PAH, it was found that: there were no significant differences in the proportion of Th17 cells ( Figure 2 a), the proportion of Treg cells ( Figure 2 b) and the Th17 / Treg ratio ( Figure 2 c) among different PFH subtypes, but there were statistical differences compared with the healthy control group.

[0083] Serum cytokine levels in patients with PFH

[0084] Detection of Th17-related cytokines IL-17, IL-6 and Treg-related cytokines IL-10, TGF-β1 found that: serum IL-17 ( Figure 3 a) and IL-6 ( Figure 3 b) levels in all patients with PFH subtypes were significantly higher than those in healthy controls; while IL-10 ( Figure 3c) and TGF-β1 ( Figure 3 d) The level was significantly decreased, further confirming the Th17 / Treg imbalance.

[0085] Characteristic gene expression analysis

[0086] The expression of the Th17 characteristic transcription factor RORγt and the Treg characteristic transcription factor FOXP3 in sweat gland tissues showed that for all patients with PFH subtypes, the RORγt mRNA ( Figure 4 a) and protein levels ( Figure 4 c, d) were significantly up-regulated; the FOXP3 mRNA ( Figure 4 b) and protein levels ( Figure 4 c, e) were significantly down-regulated. This result confirmed the Th17 / Treg immune imbalance in PFH patients at the molecular level.

[0087] The preferred embodiments of the present invention disclosed above are only used to help explain the present invention. The preferred embodiments do not describe all the details in detail, nor do they limit the invention to the specific embodiments described. Obviously, many modifications and changes can be made according to the content of this specification. These embodiments are selected and specifically described in this specification to better explain the principle and practical application of the present invention, so that those skilled in the art can well understand and utilize the present invention. The present invention is only limited by the claims and their full scope and equivalents.

Claims

1. A biomarker for the detection of primary focal hyperhidrosis, characterized in that, Including but not limited to: the ratio of Th17 cells to Treg cells, IL-17A, IL-6, RORγt, FoxP3, one or more of them.

2. The biomarker according to claim 1, wherein, The Th17 cells are identified by surface markers CD3+CD4+ and intracellular markers RORγt+IL-17A+, and the Treg cells are identified by surface markers CD3+CD4+CD25+ and intracellular markers FoxP3+.

3. The biomarker according to claim 1, wherein, The biomarker further includes at least one of the following: the concentrations of adrenaline and noradrenaline in peripheral blood; the gene or protein expression levels of AQP5 and Cacna1c in sweat gland tissue.

4. The biomarker according to any one of claims 1-3, characterized in that, At least one of the following: an increase in the Th17 / Treg ratio, an increase in the expression levels of IL-17A and IL-6, a decrease in the expression levels of IL-10 and TGF-β1, an increase in the RORγt / FoxP3 ratio, an increase in the concentrations of E and NE, an increase in the expression levels of AQP5 and Cacna1c, is used as a positive predictive indicator for PFH.

5. Use of the marker according to any one of claims 1-4 in the preparation of a detection kit for primary focal hyperhidrosis, characterized in that, The kit contains at least one of the following components: Antibodies specifically recognizing CD3, CD4, RORγt, IL-17A, FoxP3, CD25; ELISA detection reagents for IL-17A, IL-6, IL-10, TGF-β1; Protein or gene detection reagents for RORγt, FoxP3, AQP5, Cacna1c; High-performance liquid chromatography detection reagents for adrenaline and noradrenaline.

6. A pharmaceutical composition for treating primary local hyperhidrosis, characterized in that, The pharmaceutical composition contains at least one of the following active ingredients: Inhibitors that inhibit Th17 cell differentiation, selected from RORγt antagonists, IL-17A neutralizing antibodies or IL-6 receptor blockers; Activators that promote Treg cell differentiation, selected from TGF-β1, IL-10 or FoxP3 expression enhancers; Sympathetic nerve activity regulators, selected from β-adrenergic receptor antagonists or α-adrenergic receptor agonists.

7. Use of the biomarker according to any one of claims 1-4 in screening a therapeutic drug for PFH, characterized in that, Detect the regulatory effects of candidate compounds on the Th17 / Treg ratio, IL-17A, IL-6, IL-10, TGF-β1, RORγt, FoxP3 through in vitro or in vivo models, and screen compounds with potential for PFH treatment.

Images