Application of TSPAN4 gene expression inhibitor and medicine containing TSPAN4 gene expression inhibitor

Abstract

The invention belongs to the technical field of gene engineering and cardiovascular disease treatment, and particularly discloses application of an expression inhibitor of a TSPAN4 gene in preparation of a medicine for treating cardiovascular diseases and the medicine containing the expression inhibitor of the TSPAN4 gene. According to the application disclosed by the invention, firstly, a carotid artery injury mouse model is constructed, and research finds that after expression deletion of TSPAN4, the TSPAN4 has a remarkable improvement effect on intimal neogenesis; according to the present invention, the expression of the TSPAN4 gene is further inhibited by using the siRNA interfering RNA technology of the targeting TSPAN4 gene, such that the phenotype of the smooth muscle cell can be changed after the treatment with the human h-siTSPAN4 so as to achieve the cardiovascular disease treatment purpose; according to the method, expression of the TSPAN4 gene can be inhibited by delivering siRNA, so that proliferation and migration of abnormal smooth muscle cells are inhibited, and development of cardiovascular diseases is reduced.

Description

Technical Field

[0001] The present invention belongs to the technical fields of genetic engineering and the treatment of cardiovascular diseases, and particularly relates to the application of an expression inhibitor of the TSPAN4 gene in the preparation of a drug for treating cardiovascular diseases and a drug containing the expression inhibitor of the TSPAN4 gene. Background Art

[0002] Cardiovascular diseases refer to coronary heart disease, hypertension, cardiomyopathy, arrhythmia, heart failure, etc., which are globally recognized as diseases seriously endangering human health. In the past three decades, cardiovascular diseases have been the main cause of global morbidity and mortality. The pathophysiological basis of vascular diseases involves multiple mechanisms, including vascular aging, calcification, atherosclerosis, extracellular matrix remodeling, and immune cell infiltration. Vascular smooth muscle cells (VSMCs) are the most abundant cell type in blood vessels, not only playing a vascular physiological function, but also promoting vascular diseases in various ways. Recent studies have shown that VSMCs exhibit high plasticity in disease states and have multiple differentiation potentials, ultimately obtaining unexpected phenotypes with morphological and functional changes. Notably, in a single local injury, the phenotypic conversion of VSMCs may be multi-directional. According to literature reports, this process involves metabolic dysfunction, stress response, cell-cell communication, and multi-level signaling pathways, jointly constituting a complex regulatory network. Since there is a significant correlation between the VSMC phenotype and the occurrence and progression of vascular diseases, many studies have pointed out that the phenotypic conversion of VSMCs is the basis for the progression of vascular diseases, and it has been found that inhibiting the conversion of VSMCs from a contractile phenotype to other phenotypes helps to reduce the severity of vascular diseases. The research on VSMC phenotypic conversion not only clarifies the new mechanism of vascular diseases, but also provides a new therapeutic target.

[0003] However, there is no literature report on the role of the expression of TSPAN4 in the onset and development of cardiovascular diseases. TSPAN4, as a member of the Tetraspanin family, its function and regulatory mechanism have attracted increasing attention. Studies have shown that TSPAN4 is expressed in a variety of cell types and is involved in a variety of biological processes. TSPAN4 was previously found to be a marker protein of the novel organelle "migrasome", which is closely related to cell functions such as migration and other biological functions. In addition to its role in normal physiological processes, the abnormal expression of TSPAN4 is closely related to the occurrence and development of various diseases. For example, TSPAN4 has been reported to be related to the occurrence and development of tumors such as gastric cancer, lung cancer, and glioma. At the same time, a small number of studies have shown that TSPAN4 is related to cardiovascular diseases. However, the relationship between TSPAN4 and smooth muscle phenotypic conversion and neointima formation has not been reported, and its potential role in cardiovascular diseases remains to be explored and studied. Summary of the Invention

[0004] The object of the present invention is to provide an application of an expression inhibitor of the TSPAN4 gene in the preparation of a drug for treating cardiovascular diseases. First, by constructing a carotid artery ligation mouse model, the present invention found that after knockout of the TSPAN4 gene, there was a significant improvement in carotid artery stenosis, suggesting that TSPAN4 plays an important role in cardiovascular diseases; further, using a cell model of vascular smooth muscle phenotype change, it was found that after administration of human-derived h-siTSPAN4, it could significantly inhibit the proliferation, migration and phenotype change of vascular smooth muscle cells induced by PDGF, which has important reference and guiding significance for new drug research and development clinically, and provides an important basis for the clinical use of h-siTSPAN4 to treat cardiovascular diseases.

[0005] To achieve the above object, the technical solution adopted by the present invention is:

[0006] The present invention provides an application of an expression inhibitor of the TSPAN4 gene in the preparation of a drug for treating cardiovascular diseases.

[0007] As a preferred embodiment of the present invention, the expression inhibitor of the TSPAN4 gene is the interference sequence h-siTSPAN4 of TSPAN4;

[0008] The nucleotide sequence of the interference sequence h-siTSPAN4 is shown in SEQ ID NO.1.

[0009] As a preferred embodiment of the present invention, the expression inhibitor of the TSPAN4 gene is used for the preparation of a drug for treating cardiovascular diseases caused by neointima formation-induced vascular stenosis.

[0010] As a preferred embodiment of the present invention, the expression inhibitor of the TSPAN4 gene is used for the preparation of a drug for improving cardiovascular diseases caused by the proliferation, migration or phenotype change of vascular smooth muscle cells.

[0011] The expression inhibitor of the TSPAN4 gene plays a role in treating related cardiovascular diseases by inhibiting the proliferation, migration and phenotype transformation of vascular smooth muscle cells.

[0012] As a preferred embodiment of the present invention, when the interference sequence h-siTSPAN4 acts on cells, the concentration of the interference sequence h-siTSPAN4 in the transfection system is 10 nM to 50 nM.

[0013] As a preferred embodiment of the present invention, the interference sequence h-siTSPAN4 is used for the preparation of an expression promoter of SMA, SM22a or CNN1 in human smooth muscle cells.

[0014] As a preferred embodiment of the present invention, the interfering sequence h-siTSPAN4 is used to prepare an inhibitor for the proliferation and migration of human smooth muscle cells.

[0015] The present invention also provides a drug for treating cardiovascular diseases, and the drug uses an expression inhibitor of the TSPAN4 gene as the only effective active ingredient.

[0016] As a preferred embodiment of the present invention, the drug includes pharmaceutically acceptable excipients or carriers.

[0017] As a preferred embodiment of the present invention, the drug is an oral preparation or an injection preparation.

[0018] More preferably, the oral preparation is a granule, a tablet, a capsule, a granule, a powder, a syrup, an oral liquid or a tincture.

[0019] More preferably, the injection preparation is an intravenous injection preparation, a intramuscular injection preparation or an injection powder.

[0020] When the drug is prepared into an oral preparation or an injection preparation, the selected excipients or carriers are specifically selected according to the different drug dosage forms to be prepared. Exemplarily, the selected excipients can be a suspension, a suspending agent, a thickening agent, a coloring agent, an antioxidant, a preservative, a pH regulator, an osmotic pressure regulator, a thickening agent, a wetting agent, a coating material, a capsule shell, etc.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] The present invention finds through research that the expression level of TSPAN4 increases in both human atherosclerotic sample data and arteries after vascular intimal hyperplasia in mice. After knocking out TSPAN4, the vascular intimal hyperplasia in mice is inhibited, and the expression of vascular contractile markers increases. This suggests that TSPAN4 may affect the function of smooth muscle cells and thus affect diseases related to vascular intimal hyperplasia, such as atherosclerosis, coronary heart disease, pulmonary hypertension, restenosis after artery surgery or diabetic syndrome, etc. In vitro experiments confirm that the expression inhibitor of the TSPAN4 gene can inhibit the proliferation, migration and phenotypic transformation of vascular smooth muscle cells, thereby achieving the ultimate goal of treating cardiovascular diseases.

[0023] The present invention provides an application of an expression inhibitor of the TSPAN4 gene in the preparation of a drug for treating cardiovascular diseases. The expression inhibitor of the TSPAN4 gene is an interfering sequence of TSPAN4. First, the present invention constructs a carotid artery stenosis mouse model and finds that TSPAN4 knockout has a significant improvement effect on carotid artery stenosis, suggesting that TSPAN4 plays an important role in carotid artery stenosis; further, human-derived TSPAN4 synthetic siNRA: h-siTSPAN4 is synthesized, and using a vascular smooth muscle cell model, it is found that after administration of h-siTSPAN4, it can significantly inhibit the proliferation, migration and phenotypic transformation of vascular smooth muscle cells induced by PDGF. It is proved that h-siTSPAN4 has the effect of treating cardiovascular diseases, which provides help for the treatment of cardiovascular diseases and the development and application of nucleic acid drugs, and provides an important basis for clinically using siTSPAN4 to treat diabetic cardiomyopathy. The method of the present invention can inhibit the expression of the TSPAN4 gene by delivering siRNA, thereby inhibiting the proliferation and migration of abnormal smooth muscle cells and reducing the development of cardiovascular diseases.

[0024] The interfering sequence of TSPAN4 provided by the present invention, as a novel drug molecule, has the advantages of high affinity, high specificity, easy synthesis and modification, flexible design, etc., and provides help for the wide application of nucleic acid drugs in the medical field. Brief Description of the Drawings

[0025] Figure 1 It shows that after TSPAN4 knockout, the formation of vascular intimal hyperplasia in mice is alleviated. (A) H&E staining of carotid artery tissues of WT and TSPAN4- / - mice; (B) Statistical chart of intimal and medial areas of blood vessels;

[0026] Figure 2 It shows the proliferation of vascular smooth muscle after human vascular smooth muscle cells (HASMC) in Example 2 of the present invention were treated with the nucleic acid drug h-siTSPAN4 (concentration: 20 nM); (A) EdU staining of human vascular smooth muscle cells after treatment with the control group siNC and the experimental group si-TSPAN4; (B) Statistical chart of EdU staining;

[0027] Figure 3 It shows the migration of vascular smooth muscle after human vascular smooth muscle cells (HASMC) in Example 2 of the present invention were treated with the nucleic acid drug h-siTSPAN4 (concentration: 20 nM); (A) Cell scratch test of human vascular smooth muscle cells after treatment with the control group siNC and the experimental group si-TSPAN4; (B) Statistical chart of relative cell migration distance;

[0028] Figure 4In Example 2 of the present invention, after human vascular smooth muscle cells (HASMC) were treated with the nucleic acid drug h-siTSPAN4 (concentration: 20 nM), the expression of proteins related to vascular smooth muscle contraction type was detected; (A) Expression of α-SMA, SM22α, and CNN1 in human vascular smooth muscle cells after treatment with siNC in the control group and si-TSPAN4 in the experimental group; (B) Statistical chart of relative protein expression intensity. Detailed implementation manners

[0029] The technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of them. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0030] The present invention provides an application of an expression inhibitor of the TSPAN4 gene in the preparation of a drug for treating cardiovascular diseases.

[0031] The present invention has found through research that the expression level of TSPAN4 is increased in both human atherosclerotic sample data and arteries after vascular intimal hyperplasia in mice. After knocking out TSPAN4, vascular intimal hyperplasia in mice is inhibited, and the expression of vascular contraction type markers increases. This suggests that TSPAN4 may affect the function of smooth muscle cells and thus affect diseases related to vascular intimal hyperplasia.

[0032] Further, by constructing a carotid artery stenosis mouse model, it is found that knocking out TSPAN4 has a significant improvement effect on carotid artery stenosis, indicating that TSPAN4 plays an important role in carotid artery stenosis.

[0033] The present invention further synthesizes siNRA of human-derived TSPAN4: h-siTSPAN4. The nucleotide sequence of h-siTSPAN4 is shown in SEQ ID NO.1. Using a vascular smooth muscle cell model, it is found that after administration of h-siTSPAN4, it can significantly inhibit the proliferation, migration, and phenotypic transformation of vascular smooth muscle cells induced by PDGF, demonstrating that h-siTSPAN4 has the effect of treating cardiovascular diseases.

[0034] Example 1

[0035] Effect of TSPAN4 knockout on carotid artery stenosis in mice caused by carotid artery ligation

[0036] To verify the effect of TSPAN4 on cardiovascular diseases, a mouse model of arterial stenosis was constructed by carotid artery ligation, and TSPAN4 was knocked out. The tissue changes of the carotid arteries in mice before and after TSPAN4 knockout were observed as follows:

[0037] 1. Modeling and grouping

[0038] CRISPR / Cas9 gene editing technology was used to knock out TSPAN4 in mice to obtain TSPAN4-KO mice to explore the protective effect of TSPAN4 on arterial stenosis. The specific method is as follows:

[0039] Twenty wild-type and TSPAN4-KO C57BL / 6 mice, SPF grade, weighing (20±2) g, were selected and fed a normal diet for 1 month. Ten mice were randomly selected from the wild-type and TSPAN4-KO groups as the blank control group (WT) and TSPAN4 knockout group (TSPAN4-KO), respectively.

[0040] That is, the groups were: blank control group WT, arterial vascular stenosis model group WT+Ligation, TSPAN4 knockout group TSPAN4-KO, and arterial vascular stenosis model group after TSPAN4 knockout TSPAN4-KO+Ligation.

[0041] Implementation method:

[0042] (1) The instruments used in the surgery, including spring scissors, forceps, and scissors, should be sterilized in advance by high temperature and high pressure, and then dried in an oven at 55°C;

[0043] (2) After the mice were generally anesthetized with 1% sodium pentobarbital at a dose of 50 mg / kg, the neck was depilated with a depilatory cream and disinfected with iodine;

[0044] (3) The mouse was placed in a supine position. After the limbs and head were fixed, the skin was cut along the midline of the neck. The neck muscles were bluntly separated with forceps under a stereomicroscope to avoid damaging the nerves next to the blood vessels. The left common carotid artery was found and exposed.

[0045] (4) Ligate the left common carotid artery with 7-0 sterile surgical sutures;

[0046] (5) After ligation, the muscles are put back in place, the surgical opening is sutured, disinfected with iodine, and placed on a warming pad;

[0047] (6) After the mouse wakes up, place it in a clean cage, raise it under normal conditions, and observe its condition;

[0048] 2. Evaluation method

[0049] After 3 weeks, the degree of vascular stenosis was evaluated by embedding the mouse carotid artery and HE staining to determine the success of the model and the effect of TSPAN4 knockout on arterial stenosis.

[0050] 2.1. Collection of mouse carotid artery and aorta tissue

[0051] (1) Instruments required for sampling, including spring scissors, forceps, and scissors, etc., are sterilized by high-temperature and high-pressure in advance and placed in an oven at 55 °C for drying.

[0052] (2) After euthanizing the mice, the mice are fixed in the supine position, the skin and subcutaneous tissue are incised to expose the heart, the pericardium is removed, a small incision is made in the right auricle, and about 20 mL of pre-cooled normal saline is perfused through the left ventricle.

[0053] (3) Bluntly separate the neck muscle layer, remove the common carotid artery from the carotid artery bifurcation, and retain the ligation thread; separate the blood vessels and surrounding redundant tissues along the aortic arch to the thoracic aorta, abdominal aorta, and iliac artery with fine spring scissors and sharp forceps, and remove the aorta; place it in a saline well plate on ice, wash it and then place it in a 1.5 mL EP tube.

[0054] (4) The removed carotid artery is fixed overnight in 4% paraformaldehyde in a 4 °C refrigerator and then transferred to 30% sucrose solution for dehydration until it naturally sinks to the bottom, and then the tissue is embedded with OCT; the tissue used for protein and RNA extraction is placed in a 1.5 mL EP tube, quickly frozen in liquid nitrogen and then stored in an -80 °C refrigerator for standby.

[0055] (5) Preparation of frozen sections: After embedding with OCT, section with a cryostat, label the sections and store them in a -20 °C refrigerator.

[0056] 2.2. Hematoxylin-eosin staining (H&E) of tissue sections and pathological evaluation

[0057] (1) After taking out the frozen sections, place them at room temperature for about 30 min for rewarming and soak them in double-distilled water for 5 min.

[0058] (2) Immerse them in hematoxylin staining solution for 3 - 5 min, soak them in double-distilled water twice, and observe the color under a microscope.

[0059] (3) Dehydrate with 95% ethanol for 5 min.

[0060] (4) Immerse them in eosin staining solution for 1 min.

[0061] (5) Dehydrate with absolute ethanol for 5 min and repeat twice.

[0062] (6) Clear with xylene for 5 min.

[0063] (7) Mount with neutral resin, scan the sections with a digital slide scanner and save them.

[0064] 3. Results and analysis

[0065] The results showed that WT (wild type) and TSPAN4 - / -(TSPAN4 knockout) mice and Sham (sham operation group, i.e., negative control group) mice had relatively smooth and intact carotid arteries, and the smooth muscle cells in the tunica media were arranged relatively regularly; severe intimal hyperplasia and stenosis occurred in the ligated carotid arteries of WT mice, while the intimal hyperplasia induced after carotid artery ligation in TSPAN4 - / - group mice was significantly alleviated ( Figure 1 ).

[0066] The above results showed the important role of TSPAN4 in carotid artery stenosis, suggesting that the inhibition of TSPAN4 has a therapeutic effect on related cardiovascular diseases.

[0067] Example 2

[0068] Preparation of TSPAN4 interference sequence and its effect on related cardiovascular diseases

[0069] 1. According to Example 1, the corresponding interference sequence was designed: h-siTSPAN4, and its sequence was CGGACAAGAUUGACAGGUAUG (SEQ ID NO.1), which was manufactured by Sangon Biotech (Shanghai) Co., Ltd.

[0070] 2. Treatment of human vascular smooth muscle cells (HASMC) with the interference sequence

[0071] h-siTSPAN4 was delivered to human vascular smooth muscle cells by transfection. The specific method was as follows:

[0072] In this experiment, Lipofectamine RNAiMAX transfection reagent and Gibco TM Opti-MEM TM medium were used. The cells were divided into two groups: the control group was transfected with the control sequence (siNC, the concentration of the control sequence in the transfection system was 20 nM), and the experimental group was transfected with the h-siTSPAN4 sequence (labeled as si-TSPAN4, the concentration of the h-siTSPAN4 sequence in the transfection system was 20 nM). Among them, the control siNC sequence: UCUCCGAACGUGUCACGUdTdT, SEQ ID NO.2.

[0073] It should be noted that the effects of the h-siTSPAN4 sequence with a concentration of 10 nM - 50 nM in the transfection system on human vascular smooth muscle cells were basically the same. Here, the present invention only took the concentration of 20 nM as an example to illustrate this effect.

[0074] The specific operation steps were as follows (taking a 6-well plate as an example):

[0075] (1) Passage was performed when the cell density reached 80%. After resuspension, the cells were counted, and according to 3×10 5Transfer the cell amount of

[0076] (2) Incubate siRNA or siNC with RNAiMAX transfection reagent and Opti-MEM medium at room temperature for 5 min;

[0077] (3) Aspirate the supernatant of the centrifuged cells, then add the mixture in step (2) to resuspend the cells, and let them stand at room temperature for 5 min;

[0078] (4) Seed the cells into a 6-well plate, gently shake to mix evenly, and then place it in the cell culture incubator.

[0079] The transfection efficiency can be detected and the next experiment can be carried out after 24 h to 48 h.

[0080] 3. Detect cell proliferation by EdU

[0081] (1) Seed cells at a density of 3×10 4 cells per well onto the prepared sterile cell slides in a 24-well plate, and culture them in the cell culture incubator until they adhere;

[0082] (2) After adhesion, change the medium to a medium without FBS and continue culturing for 48 h;

[0083] (3) Dilute EdU (10 mM) with cell culture medium at a ratio of 1:500 to obtain a (2×) EdU working solution (20 μM). Preheat the EdU working solution in a 37°C water bath, and add an equal volume to the 24-well plate to make the final concentration of EdU in the wells (2×), and incubate for 2 h;

[0084] (4) Aspirate the culture medium, and add 1 mL of 4% paraformaldehyde to fix at room temperature for 15 min;

[0085] (5) Aspirate the fixing solution, permeabilize each well with 1 mL of 0.3% Triton X-100 permeabilization solution at room temperature for 15 min, aspirate the permeabilization solution, wash the cells with 1 mL of washing solution per well for 5 min, and repeat 2 times;

[0086] (6) Aspirate the washing solution, add 0.25 mL of the prepared Click Additive Solution reaction solution to each well to evenly cover the cells, and incubate at room temperature in the dark for 30 min;

[0087] (7) Aspirate the Click reaction solution, wash with the washing solution for 5 min, and repeat 3 times;

[0088] (8) Mount the slides with an anti-fluorescence quenching mounting medium containing DAPI, store at 4°C, and take pictures under a fluorescence microscope.

[0089] 4. Detect cell migration by scratch assay

[0090] (1) Seed 5 1×10

[0091] cells per well in a 12-well plate and culture in a cell incubator until the confluence is greater than 90%;

[0092] (2) Use a 200 μL pipette tip to scratch a cross at the bottom of the well plate. Aspirate the culture medium, wash the cell debris with PBS, and then replace it with medium without FBS. Take a photo under the microscope for recording;

[0093] (3) Culture in a cell incubator for 12 h - 24 h and take a photo under the microscope for recording;

[0094] (4) Use Image J to statistically analyze the healing area of the scratch wound.

[0095] Protein extraction, concentration determination and protein denaturation

[0096] (1) After cell treatment, rinse twice with PBS, add 100 μl / well of protein lysate, gently shake to cover the bottom with the lysate, lyse on ice for 15 min, collect the cells with a cell scraper, and transfer the lysate to a 1.5 ml EP tube. Centrifuge at 12000 rpm at 4 °C for 30 min. After centrifugation, transfer the supernatant to a new EP tube to obtain the total cell protein.

[0097] (2) Determine the protein concentration by BCA method.

[0098] (3) Protein denaturation: Mix the protein sample and protein loading buffer at a ratio of 4:1, heat in a metal bath at 95 °C for 10 min, and store the sample at -80 °C.

[0099] (4) Western Blot detection

[0100] The expression levels of several proteins related to pyroptosis were detected by Western blot analysis. Briefly, heart tissues and cells were homogenized in RIPA lysis buffer (Beyontime, Jiangsu, China) supplemented with 0.1 mM phenylmethylsulfonyl fluoride (PMSF) (Sigma, Missouri, USA) for immunoblot analysis. Cells were harvested and lysed in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1.5 mM MgCl2, 10% glycerol, 1% Triton X-100, 5 mM EGTA, 20 μM leupeptin, 1 mM AEBSF, 1 mM NaVO3, 10 mM NaF, and 1x protease inhibitor cocktail). Proteins were separated by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane at 300 mA for 1.5 h. Subsequently, the membrane was incubated in TBS / T buffer (20 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.1% Tween-20) containing 5% non-fat milk at room temperature for two hours. Specific primary antibodies included - rabbit anti-NLRP3 (D4D8T) (Cell Signaling Technology, USA), GSDMD, ASC, mouse anti-caspase-1 (1:1000, Santa Cruz Biotechnology, USA); all antibodies such as GSDMD were diluted in TBST buffer (50 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20, pH 7.4) and incubated with the PVDF membrane at 4 °C overnight. Subsequently, the corresponding horseradish peroxidase (HRP)-conjugated secondary antibody (1:5000, A21010, Abbkine, CA, USA) was incubated with the PVDF membrane at room temperature for 90 minutes. Signal detection was performed using enhanced chemiluminescence (ECL) reagent (Amersham Biosciences, Piscataway, NJ, USA). The luminescence signal was detected by a Bio-Rad ChemiDoc MP system (Bio-Rad, Richmond, CA, USA).

[0101] 6. Results

[0102] The statistical method for EdU results was to count the ratio of EdU-stained cells to DAPI-stained cells. The results showed that after h-siTSPAN4 treatment, the proliferation of vascular smooth muscle cells was significantly inhibited ( Figure 2 ).

[0103] The scratch test can reflect the migration of cells. The faster the migration, the shorter the distance between cells, indicating that the migration distance is longer. From the results, it can be seen that after the knockout of h-siTSPAN4, the migration of vascular smooth muscle cells was significantly inhibited ( Figure 3 ).

[0104] α-SMA, SM22α, and CNN1 are all phenotypic markers of contractile vascular smooth muscle cells. After h-siTSPAN4 treatment, the expression of α-SMA, SM22α, and CNN1 was enhanced, indicating that h-siTSPAN4 stabilized the contractile phenotype of vascular smooth muscle cells and was of great significance for maintaining the contractile state of vascular smooth muscle cells ( Figure 4 ).

[0105] The above results show that the nucleic acid drug h-siTSPAN4 prepared by the present invention can significantly inhibit the proliferation, migration and phenotypic transformation of vascular smooth muscle, and plays an important role in cardiovascular diseases. Therefore, the nucleic acid drug has the effect of treating cardiovascular diseases, and putting this nucleic acid drug into practice can help further individualized treatment.

[0106] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. Use of an expression inhibitor of TSPAN4 gene in the preparation of a drug for treating cardiovascular diseases.

2. The application according to claim 1, characterized in that, The expression inhibitor of TSPAN4 gene is the interfering sequence h-siTSPAN4 of TSPAN4; The nucleotide sequence of the interfering sequence h-siTSPAN4 is as shown in SEQ ID NO.

1.

3. The application according to claim 2, characterized in that, The expression inhibitor of TSPAN4 gene is used for the preparation of a drug for treating cardiovascular diseases caused by neointima formation-induced vascular stenosis.

4. The application according to claim 2, characterized in that The expression inhibitor of TSPAN4 gene is used for the preparation of a drug for improving cardiovascular diseases caused by the proliferation, migration or phenotypic change of vascular smooth muscle cells.

5. A drug for treating cardiovascular diseases, characterized in that, It uses the expression inhibitor of TSPAN4 gene described in claim 1 as the sole effective active ingredient.

6. The medicament according to claim 5, wherein The drug includes pharmaceutically acceptable excipients or carriers.

7. The drug according to claim 6, characterized in that, The drug is an oral preparation or an injection preparation.

8. The medicament according to claim 7, wherein The oral preparation is a granule, a tablet, a capsule, a granule, a powder, a syrup, an oral liquid or a tincture.

9. The drug according to claim 7, characterized in that, The injection preparation is an intravenous injection preparation, a intramuscular injection preparation or an injection powder.

Images