Bioluminescence kit for detecting myeloperoxidase in whole blood and use method and application thereof

Abstract

The invention discloses a bioluminescence kit for detecting myeloperoxidase in whole blood as well as a use method and application of the bioluminescence kit. The bioluminescence kit comprises a nucleic acid hairpin probe, H2O2, NaCl, a PBS (Phosphate Buffer Solution), a Cas12a / crRNA binary complex, a bioluminescence type molecular beacon, an NEBuffer 2.1 and a luminescent substrate Furimazine. The 5'end and the 3 'end of the bioluminescence type molecular beacon are respectively marked with Cy3 and cpHNLuc, and a bioluminescence resonance energy transfer phenomenon (BRET) can occur. A BRET signal does not need an external excitation light source, interference of autofluorescence of a blood sample and environmental factors can be effectively avoided, meanwhile, the excellent signal amplification capacity of a CRISPR / Cas12a system is combined, rapid and ultra-sensitive detection of MPO in a whole blood sample can be achieved, and therefore the method has a great application prospect in the fields of biosensing and medical examination.

Description

Technical Field

[0001] The present invention belongs to the technical field of analytical detection, and mainly relates to a bioluminescence kit for detecting myeloperoxidase in whole blood, its use method and application. Background Art

[0002] Myeloperoxidase (MPO) is a peroxidase mainly expressed and secreted in neutrophils, which can catalyze chloride ions and hydrogen peroxide to generate oxidizing substances such as hypochlorous acid, thus playing an important role in clearing pathogenic bacteria in the body. However, when the body is in an inflammatory state, the overexpression of MPO can lead to oxidative stress and oxidative tissue damage, thereby exacerbating the inflammatory response and participating in the occurrence and development of various diseases, such as atherosclerosis, neurodegenerative diseases, and tumors. Therefore, the determination of MPO activity is helpful for the diagnosis, disease monitoring, and prognosis evaluation of the above diseases. Currently, the commonly used MPO detection methods in clinical practice mainly include cytochemical staining, enzyme-linked immunosorbent assay, and flow cytometry. However, these techniques have many limitations, such as complex operation, the need for pretreatment of blood samples, or relying on large equipment and being unable to perform point-of-care testing. Therefore, developing a kit that can directly detect MPO in whole blood samples is of great significance for the clinical diagnosis and treatment of various diseases. Summary of the Invention

[0003] One of the purposes of the present invention is to provide a bioluminescence kit for detecting myeloperoxidase in whole blood. The bioluminescence kit uses a bioluminescence resonance energy transfer signal (BRET) that does not require external excitation light, which can effectively avoid the interference of autofluorescence of blood samples and environmental factors. At the same time, combined with the excellent signal amplification ability of the CRISPR / Cas12a system, it can achieve rapid and ultrasensitive detection of MPO in whole blood samples.

[0004] Another purpose of the present invention is to provide a use method of the bioluminescence kit.

[0005] The third purpose of the present invention is to provide an application of the bioluminescence kit.

[0006] The present invention provides a bioluminescence kit for detecting myeloperoxidase in whole blood, including a nucleic acid hairpin probe, H2O2, NaCl, PBS buffer, Cas12a / crRNA binary complex, bioluminescent molecular beacon (cpHNLuc-MB), NEBuffer 2.1, and luminescent substrate Furimazine.

[0007] Furthermore, in the base sequence of the nucleic acid hairpin probe, the number of thiophosphorylated modified bases is 1 or 2.

[0008] Preferably, when the number of phosphorothioate-modified bases in the base sequence of the nucleic acid hairpin probe is 2, the base sequence is specifically: 5'-3', CAGGTAAAC ACACAAACCTTAAAAAAAGGT*TTGTGT*GTTTACCTG, where * represents that the base is phosphorothioate-modified.

[0009] Furthermore, the neck of the nucleic acid hairpin probe contains an activation sequence of the CRISPR / Cas12a system, with a length of 20 bases.

[0010] Furthermore, the preparation method of the cpHNLuc-MB includes the following steps:

[0011] A. Synthesize a nano luciferase (cpHNLuc) fused with a HaloTag protein tag;

[0012] B. Modify the molecular beacon (MB) to obtain a modified molecular beacon (CH-MB);

[0013] C. Perform a bioorthogonal reaction on cpHNLuc and CH-MB to obtain cpHNLuc-MB.

[0014] Furthermore, in step A, cpHNLuc is obtained through recombinant protein expression and purification techniques. The obtained cpHNLuc can catalyze the oxidation of the luminescent substrate Furimazine and emit blue light with a wavelength range of 400 - 500 nm.

[0015] Furthermore, in step B, the number of base pairs n in the neck of the molecular beacon is 5, 6, or 7; when the number of base pairs n in the neck of the molecular beacon is 6, the sequence of the molecular beacon (5'-3') is Cy3-TCCTCTTTATTTATTTTAGAGGA-C6-NH2.

[0016] The molecular beacon is modified using a ligand molecule (chloroalkane, CH) of the HaloTag protein.

[0017] The ligand molecule structure of the HaloTag protein is shown as follows:

[0018]

[0019] Furthermore, in specific implementation, the bioorthogonal reaction in step C is specifically: 1 μM cpHNLuc and 3 μM CH-MB are mixed in a reaction activation buffer and incubated at room temperature for 1 - 2 h to obtain a conjugate product cpHNLuc-MB.

[0020] The reaction activation buffer contains 100 mM HEPES, 100 mM NaCl, and the pH is 7.3.

[0021] The Cas12a used in the Cas12a / crRNA binary complex is Lba Cas12a (cpf1);

[0022] The crRNA sequence (5'-3') used in the Cas12a / crRNA binary complex is UAAUUUCUACUAAGUGUAGAUAAGGUUUGUGUGUUUACCUG.

[0023] The NEBuffer2.1 contains 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 and 100 μg / mL BSA, with a pH of 7.9.

[0024] The present invention also provides a method for using the bioluminescence kit, comprising the following steps:

[0025] S1. Mix and react the nucleic acid hairpin probe, H2O2, NaCl and MPO in PBS buffer to obtain product solution 1;

[0026] S2. Mix and react the product solution obtained in step S1 with the Cas12a / crRNA binary complex and cpHNLuc-MB in NEBuffer 2.1. After the reaction, add the luminescence substrate Furimazine for detection and recording.

[0027] Further, in specific implementation, step S1 is specifically: Mix 2 μL of MPO, 2 μL of H2O2 (1 mM), 1 μL of NaCl (1.5 M) and 2 μL of the nucleic acid hairpin probe (1 μM) in 12 μL of PBS buffer, and react at 37 °C for 1.5 - 2 h to obtain product solution 1;

[0028] Further, in specific implementation, step S2 is specifically: Mix 2 μL of the product solution 1 obtained in step S1 with 10 μL of the Cas12a / crRNA binary complex (10 nM) and 2 μL of cpHNLuc-MB (1 μM) in 6 μL of NEBuffer 2.1, and react at 37 °C for 30 - 50 min. After the reaction, add 80 μL of NEBuffer2.1 and 1 μL of the luminescence substrate Furimazine (1 μg / mL), and then immediately perform detection and recording.

[0029] Further, in step S2, the detection method includes: Measuring the bioluminescence intensities at 450 nm and 565 nm respectively by a fluorescence spectrophotometer (FS-5, Edinburgh), calculating the relevant BRET ratio, and further quantitatively detecting MPO in the blood.

[0030] Further, in step S2, the detection method further includes: taking a picture with a camera and using ImageJ software to calculate the average RGB value, and then quantitatively detecting MPO using the blue / red ratio.

[0031] The present invention also provides the application of the bioluminescence kit in whole blood.

[0032] In the above application, the whole blood sample is diluted with a PBS solution with a pH of 7.4.

[0033] Principle of the present invention:

[0034] The principle of the bioluminescence kit of the present invention for the instant detection of MPO is as Figure 1 shown. The ends of the bioluminescent molecular beacon cpHNLuc-MB in the bioluminescence kit are respectively labeled with cpHNLuc and Cy3. Before adding MPO, cpHNLuc and Cy3 are close to each other and trigger the BRET phenomenon, so the solution shows the orange light emitted by Cy3. After adding MPO, MPO catalyzes the reaction of H2O2 and NaCl to generate hypochlorous acid (HClO), and HClO can specifically cleave the thiol-modified site (PT) on the nucleic acid hairpin probe, releasing the activation strand, thereby activating the CRISPR / Cas12a system. The activated CRISPR / Cas12a system further catalyzes the cleavage of cpHNLuc-MB, resulting in the separation of cpHNLuc and Cy3, and the BRET efficiency is significantly reduced. At this time, the solution shows the spontaneous blue light of cpHNLuc. Since the cleavage of cpHNLuc-MB by the CRISPR / Cas12a system is MPO concentration-dependent, MPO can be quantitatively detected thereby. Beneficial effects of the present invention:

[0035] (1) The present invention adopts a proportional bioluminescence resonance energy transfer signal and does not require an external excitation light source, which can effectively avoid the interference of the autofluorescence of blood samples and environmental factors, and realize the accurate detection of MPO in whole blood samples;

[0036] (2) The present invention further regulates the activity of the CRISPR / Cas12a system by MPO-catalyzed cleavage of the thiol-modified site on the nucleic acid hairpin probe; due to the high trans-cleavage activity of the CRISPR / Cas12a system, the detection of MPO has the advantages of rapidity and high sensitivity;

[0037] (3) The detection result of the present invention can be read by the naked eye or a smart phone, realizing the visual instant detection of MPO. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 It is a schematic diagram of the principle of the bioluminescence kit for detecting MPO;

[0039] Figure 2 Mass spectrometry characterization spectrum of the molecular beacon CH-MB that modifies the HaloTag ligand in Example 1;

[0040] Figure 3 SDS-PAGE electrophoresis diagram of cpHNLuc after orthogonal coupling with CH-MB in Example 1, where lane 1 is the protein maker, lane 2 is cpHNLuc, and lane 3 is cpHNLuc-MB;

[0041] Figure 4 Emission spectra and smartphone photos of cpHNLuc, cpHNLuc-MB, and the mixture of uncoupled cpHNLuc and MB in Example 2;

[0042] Figure 5 Emission spectra and smartphone photos of cpHNLuc-MB before and after adding the CRISPR / Cas12a system in Example 3;

[0043] Figure 6 (a) Emission spectra of the bioluminescence kit for different concentrations of MPO in Example 4; Figure 6 (b) Calibration curve diagram of the bioluminescence kit for different concentrations of MPO; Figure 6 (c) Mobile phone photos of the bioluminescence kit for different concentrations of MPO; Figure 6 (d) Ratio diagram of the average blue pigment intensity and average red pigment intensity extracted using image J;

[0044] Figure 7 Selectivity test of the bioluminescence detection kit in Example 4, showing the change diagram of the bioluminescence ratio and the photos taken after adding myeloperoxidase (MPO), glucose oxidase (GOX), hydrogen peroxide (H2O2), bovine albumin (BSA), lipopolysaccharide (LPS), horseradish peroxidase (HRP), nicotinamide adenine dinucleotide (NADH), and the mixture of MPO and its inhibitor (4-ABAH);

[0045] Figure 8 Data diagram of quantitative detection of MPO by the bioluminescence kit in whole blood dilution in Example 5. Figure (a) is the photo, and Figure (b) is the ratio diagram of the average blue pigment intensity and average red pigment intensity extracted using image J. Detailed implementation mode

[0046] To enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described in detail below in conjunction with the embodiments.

[0047] Preparation of Bioluminescent Molecular Beacon cpHNLuc-MB in Example 1

[0048] The plasmid (pET28a-cpHNLuc) was transferred into competent cells BL21(DE3) using the heat shock method, plated and cultured overnight. A single colony was picked from the plate, transferred to Luria-Bertani broth medium containing 0.1 mg / mL ampicillin after overnight culture, and when the optical density reached 0.6 - 0.8, 0.5 mM isopropyl-β-D-thiogalactoside and 1 mM MgCl2 were added, and induced for expression overnight at 18°C. The cells were collected by centrifugation, 3 mL of non-denaturing lysis buffer was added, and then sonicated for 5 min at a power of 300 W. After centrifugation to obtain the supernatant, the His-tagged fusion protein was separated and purified using Ni-NTA agarose gel (Beyotime Biotechnology), and concentrated using an ultrafiltration tube with a molecular weight cut-off of 30 kD to obtain cpHNLuc protein. Finally, the protein concentration of the obtained product was quantitatively measured using a BCA kit (Biotime Biotechnology) and stored at -80°C.

[0049] 1 mg of HaloTag ligand (CH), 1.0 mg of dicyclohexylcarbodiimide (DCC), and 1.0 mg of N-hydroxysuccinimide (NHS) were separately dissolved in 200 μL of DMF, mixed well, and reacted at 37°C for 2 h. Then, 14 OD of MB was dissolved in 250 μL of borate buffer (0.1 M, pH 8.5) and added to the above reaction solution, and shaken overnight at 37°C to obtain the cross-linked product (CH-MB). Then, CH-MB was purified using a high-performance liquid chromatograph (Agilent Model 1260 HPLC system, Alltech C18 column) and freeze-dried. Finally, the ultraviolet absorption of CH-MB at 260 nm was measured, and its molar extinction coefficient was found to be 223700 L / (mole·cm). According to the Lambert-Beer law, the concentration of the cross-linked product was calculated to be 82 μM. Mass spectrometry characterization was performed, and the mass spectrometry characterization map is as Figure 2 shown. The characterization map shows that the molecular weight of the cross-linked product is 6834.7, and the calculated molecular weight of the cross-linked product is 6836.62, proving that the HaloTag ligand was successfully modified on MB.

[0050] cpHNLuc and CH-MB were added to HEPES buffer in a molar ratio of 1:3 and incubated at room temperature for 2 h to obtain the conjugate cpHNLuc-MB. SDS-PAGE gel electrophoresis technology was used to separate the conjugate. After electrophoresis, the protein was stained with Coomassie Brilliant Blue staining solution for 1 h, decolorized with ultrapure water for 2 h, and finally analyzed using a gel imaging system. The results are as Figure 3 shown. Figure 3The results showed that cpHNLuc was successfully conjugated with CH-MB, and the conjugation yield was 88.0%.

[0051] Example 2 Performance Verification of Bioluminescent Molecular Beacon cpHNLuc-MB

[0052] Dilute cpHNLuc-MB with 100 μL of buffer solution (100 mM HEPES, 100 mM NaCl, 5 mM MgCl2) to obtain a working solution with a concentration of 20 nM. Add 1 μL of Furimazine (1 μg / mL) to the above solution, and use a fluorescence spectrometer (Edinburgh Instruments Ltd, FS5, UK) to measure the emission spectrum of the sample. During the measurement, the excitation light source needs to be turned off, the excitation slit is set to 0 nm, the emission slit is set to 10 nm, and the scanning range of the emission spectrum is 400 nm - 700 nm. At the same time, use a smartphone to take a picture of the bioluminescence of the sample, where the relevant parameter IOS is 3200 and the exposure time is 10 s. The results obtained are as Figure 4 shown. Figure 4 The results showed that bioluminescence resonance energy transfer occurred between cpHNLuc and Cy3, and the energy transfer ratio was 2.5 times (565 nm / 450 nm).

[0053] Example 3 Cleavage Verification of Bioluminescent Molecular Beacon by CRISPR / Cas12a System

[0054] Add LbCas12a and crRNA with a final concentration of 100 nM each to NEBuffer2.1, mix well and incubate at 37 °C for 30 min to obtain the Cas12a / crRNA binary complex. Then take 1 μL of the Cas12a / crRNA binary complex, 2 μL of the activation strand (100 nM), and 1 μL of cpHNLuc-MB (1 μM) and add them to 16 μL of NEBuffer2.1, and react at 37 °C for 30 min. Then add 80 μL of NEBuffer 2.1 and 1 μL of the luminescent substrate Furimazine (1 μg / mL) and immediately measure its emission spectrum, and use a smartphone to take pictures to record the results at the same time. The results obtained are as Figure 5 shown, and the relevant parameters measured are the same as those in Example 2. Figure 5 It was shown that under the action of the CRISPR / Cas12a system, the bioluminescence color of cpHNLuc-MB changed from orange to blue, indicating that the CRISPR / Cas12a system could effectively cleave cpHNLuc-MB, and the cleavage process was not affected by the steric hindrance of cpHNLuc.

[0055] Example 4 Detection of MPO Using a Bioluminescent Kit

[0056] A series of 20 μL reaction buffers (10 mM Na2HPO4 / NaH2PO4, pH = 7.4) containing different concentrations of MPO, 100 nM nucleic acid hairpin probe, 100 μM H2O2, and 150 mM NaCl were reacted at 37 °C for 2 h. Then, 2 μL of the above reaction solution was added to 1 μL of Cas12a / crRNA binary complex (1 μM) and 1 μL of cpHNLuc-MB (1 μM) in 16 μL of NEBuffer 2.1, and the reaction was carried out at 37 °C for 30 min. Finally, 80 μL of NEBuffer 2.1 and 1 μL of Furimazine were added and the emission spectrum was measured. The results are as Figure 6 (a) shown. As the concentration of MPO increased from 0 to 4 μg / mL, the luminescence intensity of Cy3 at 565 nm gradually decreased. At the same time, the ratio R450 nm / 565 nm increased from 0.6 to 2.5. By calculating, the detection limit of MPO in this system was 1.11 ng / mL. These results are as Figure 6 (b) shown. At the same time, the results were recorded by taking pictures with a smartphone, where the IOS was 3200 and the exposure time was 10 s. The results are as Figure 6 (c) shown. As the concentration of MPO increased from 0 to 4 μg / mL, the bioluminescence color of this system gradually changed from orange to blue. The Image J software was used to process the images, and the ratio (average pixel intensity of the blue channel / average pixel intensity of the red channel) increased from 0.8 to 4.3. By calculating, the detection limit of MPO by this method was 1.14 ng / mL. These results are as Figure 6 (d) shown.

[0057] According to the above MPO detection steps, glucose oxidase (GOX), hydrogen peroxide (H2O2), bovine serum albumin (BSA), lipopolysaccharide (LPS), horseradish peroxidase (HRP), nicotinamide adenine dinucleotide (NADH), MPO + inhibitor (4-ABAH), and blank were used as control groups for selectivity experiments to test the response of the kit. The results are as Figure 7 shown.

[0058] Among them, 4-ABAH powder needs to be dissolved in DMSO and then added to the MPO solution, and the reaction is carried out at 37 °C for 30 min.

[0059] Figure 7 The results show that the kit of the present invention has excellent selectivity for MPO.

[0060] Example 5 Quantitative determination of MPO in whole blood by bioluminescence kit

[0061] Collect blood from healthy individuals, dilute it 10-fold with PBS solution at pH 7.4, then add different concentrations of MPO to the diluted blood and perform the detection according to the operation steps in Example 4. Take pictures using a smartphone in a dark environment, and the results are as Figure 8 shown. Analyze the pictures by calculating the average RGB value using ImageJ software. Figure 8 (a) The results show that as the concentration of MPO increases from 0.5 ng / mL to 500 μg / mL, the color of the system bioluminescence gradually changes from orange to blue. Figure 8 (b) represents the ratio of the average pixel in the blue channel (blue) to the average pixel in the red channel (red) under different concentrations of MPO. The results indicate that this bioluminescence kit can visually and quantitatively detect MPO in whole blood.

Claims

1. A bioluminescence kit for detecting myeloperoxidase in whole blood, characterized in that, It includes nucleic acid hairpin probe, H2O2, NaCl, PBS buffer solution, Cas12a / crRNA binary complex, bioluminescent molecular beacon, NEBuffer 2.1, and luminescent substrate Furimazine.

2. The bioluminescence kit for detecting myeloperoxidase in whole blood according to claim 1, characterized in that, In the base sequence of the nucleic acid hairpin probe, the number of thiophosphorothioate-modified bases is 1 or 2; the neck of the nucleic acid hairpin probe contains the activation sequence of the CRISPR / Cas system, with a length of 20 bases.

3. The bioluminescence kit for detecting myeloperoxidase in whole blood according to claim 2, wherein, When the number of thiophosphorothioate-modified bases in the base sequence of the nucleic acid hairpin probe is 2, the base sequence is specifically: 5'-3', CAGGTAAACACACAAACCTTAAAAAAAGGT*TTGTGT*GTTTACCTG, where * represents the base is thiophosphorothioate-modified.

4. The bioluminescence kit for detecting myeloperoxidase in whole blood according to claim 1, characterized in that, The preparation method of the cpHNLuc-MB includes the following steps: A. Synthesize cpHNLuc fused with HaloTag protein tag; B. Modify MB to obtain CH-MB; C. Perform bioorthogonal reaction on cpHNLuc and CH-MB to obtain cpHNLuc-MB.

5. The bioluminescence kit for detecting myeloperoxidase in whole blood according to claim 4, wherein In step A, cpHNLuc is obtained through recombinant protein expression and purification technology. The obtained cpHNLuc can catalyze the oxidation of luminescent substrate Furimazine and emit blue light with a wavelength range of 400 - 500 nm; In step B, the number of base pairs n in the neck of the molecular beacon is 5, 6, or 7; when the number of base pairs n in the neck of the molecular beacon is 6, the sequence of the molecular beacon is specifically Cy3-TCCTCTTTATTTATTTTAGAGGA-C6-NH2 from 5'-3'; The modification is to modify the molecular beacon with the ligand molecule of HaloTag protein; the structure of the ligand molecule of HaloTag protein is shown as follows: In step C, the bioorthogonal reaction is specifically: 1 μM cpHNLuc and 3 μM CH-MB are mixed in the reaction activation buffer and incubated at room temperature for 1 - 2 h to obtain the conjugate product cpHNLuc-MB; The reaction activation buffer contains 100 mM HEPES, 100 mM NaCl, and the pH is 7.

3.

6. The bioluminescence kit for detecting myeloperoxidase in whole blood according to claim 1, wherein The Cas12a used in the CRISPR / Cas12a system of the Cas12a / crRNA binary complex is Lba Cas12a; the crRNA sequence used in the CRISPR / Cas12a system is specifically UAAUUUCUACUAAGUGUAGAUAAGGUUUGUGUGUUUACCUG from 5'-3'.

7. A method for using the bioluminescence kit according to any one of claims 1 to 6, characterized in that, It includes the following steps: S1. Mix and react MPO, H2O2, NaCl with the nucleic acid hairpin probe in PBS buffer solution to obtain product solution 1; S2. Mix and react the product solution obtained in step S1 with the Cas12a / crRNA binary complex and cpHNLuc-MB in NEBuffer2.1 for 30 min. After the reaction, add the luminescent substrate Furimazine for detection and recording.

8. The method for using the bioluminescence kit according to claim 7, characterized in that, Step S1 is specifically as follows: Mix 2 μL of MPO, 2 μL of H2O2 with a concentration of 1 mM, 1 μL of NaCl with a concentration of 1.5 M, and 2 μL of nucleic acid hairpin probe with a concentration of 1 μM in 12 μL of PBS buffer, and react at 37 °C for 1.5 - 2 h to obtain product solution 1; Step S2 is specifically as follows: Mix 2 μL of the product solution obtained in Step S1 with 10 μL of Cas12a / crRNA binary complex with a concentration of 10 nM and 2 μL of cpHNLuc-MB with a concentration of 1 μM in 6 μL of NEBuffer 2.1, and react at 37 °C for 30 - 50 min; After the reaction, add 80 μL of NEBuffer 2.1 and 1 μL of luminescent substrate Furimazine, and then immediately perform detection and recording.

9. The method for using the bioluminescence kit according to claim 7, characterized in that, In Step S2, the detection method includes: Measuring the bioluminescence intensities at 450 nm and 565 nm respectively by a fluorescence spectrophotometer, calculating the relevant BRET ratio, and further quantitatively detecting MPO in blood; The detection method includes: Taking a photo with a camera and using ImageJ software to calculate the average RGB value, and then quantitatively detecting MPO using the blue / red ratio.

10. Use of the bioluminescence kit according to any one of claims 1 to 6 in whole blood, characterized in that, In the said application, the whole blood sample is diluted with a PBS solution with a pH of 7.4.

Images