Isothermal nucleic acid amplification system for simultaneously detecting brucella and mycobacterium bovis in one tube and application of isothermal nucleic acid amplification system

Abstract

The invention relates to an isothermal nucleic acid amplification system for simultaneously detecting brucella and mycobacterium bovis in one tube and application of the isothermal nucleic acid amplification system. The isothermal nucleic acid amplification system comprises a brucella primer probe, a mycobacterium bovis primer probe, dNTP (deoxyribonucleoside triphosphate), polyethylene glycol, dithiothreitol, phosphocreatine, creatine kinase, ATP (adenosine triphosphate), Tris, potassium acetate, DNA (deoxyribonucleic acid) polymerase, UvsX protein and UvsY protein. The isothermal nucleic acid amplification system provided by the invention can realize simultaneous detection of two pathogens in milk in one tube, and dual-channel detection has no competitive reaction, strong specificity and high sensitivity.

Description

Technical Field

[0001] The present invention relates to the field of in vitro diagnostic technologies, and particularly to an isothermal nucleic acid amplification system for simultaneously detecting Brucella and Mycobacterium bovis in one tube and its application. Background Art

[0002] Brucella is a Gram-negative bacterium, including a total of six species: Brucella abortus (Brucella melitensis), Brucella melitensis (Brucella melitensis), Brucella suis, Brucella canis, Brucella neotomae, and Brucella ovis, etc. Brucellosis mainly occurs in several regions such as the Middle East, Africa, Latin America, Central Asia, and the Mediterranean. The number of global Brucella patients has reached about 500,000. After this bacterium invades the human body, it reaches the lymph nodes along the lymph fluid and is phagocytosed by phagocytes. If the Brucella bacteria are not killed by the phagocytes, the bacteria will grow and multiply inside the cells. The massive reproduction of bacteria in phagocytes causes the phagocytes to rupture, and then a large number of bacteria enter the lymph fluid and blood circulation to form bacteremia. In the blood, the bacteria are phagocytosed by phagocytes in the blood flow and are carried throughout the body with the blood flow. They multiply in the mononuclear phagocyte system in the liver, spleen, lymph nodes, bone marrow, etc., forming multiple lesions, resulting in not only bacteremia and septicemia but also toxemia clinically.

[0003] Bovine tuberculosis is a zoonotic infectious disease, and the cross-transmission of human and animal tuberculosis is one of the important reasons for the widespread epidemic of tuberculosis. Members of the genus Mycobacterium are all aerobic bacteria, with straight or curved and slender morphology, Gram-positive bacilli. Under certain circumstances, hyphae can be produced, but these hyphae become rod-shaped or spherical after agitation. Mycobacterium bovis mainly infects more than 50 species of warm-blooded animals of different species, including ungulates, marsupials, carnivores, primates, pinnipeds, and rodents, as well as more than 20 species of birds such as parrots, rock doves, and North American crows. Among them, cattle are the most sensitive animals, especially dairy cows, followed by water buffalo and yellow cattle, often causing systemic tuberculosis in various livestock. The production of foods and related products such as milk and beef makes the relationship between humans and cattle closer than that between humans and other animals, resulting in the difficult control of the transmission of bovine tuberculosis. Studying the pathogens of bovine tuberculosis is the premise for effectively controlling and eliminating bovine tuberculosis. The distinction and identification between various pathogens are important links in pathogen research, so it is necessary to clarify their relationships and be able to achieve rapid and accurate identification.

[0004] Currently, the traditional detection technologies for Brucella and Mycobacterium bovis mainly include pathogen isolation technology, culture characteristic identification technology, serological detection technology, immunological detection technology, and molecular biology (in vitro nucleic acid amplification diagnosis) and other technologies.

[0005] Etiological detection is to isolate and culture bacilli from infected blood or tissues, using solid media such as serum glucose agar and tryptone soy agar medium for culture. The detection principle is to identify through methods such as the bacterial cell morphology, staining characteristics, colony morphology, growth characteristics, biochemical reaction characteristics of bacilli, and Brucella polyclonal antibody agglutination test. This method has a relatively low cost and has the characteristics of qualitative and quantitative analysis. However, there are also problems such as a relatively low isolation rate, easy contamination, and long time consumption. Moreover, isolating Brucella poses a biosafety risk to the environment and staff, thus limiting the use of this method.

[0006] Tube agglutination reaction (SAT) is a classic serological agglutination reaction. It refers to the aggregation of particulate antigens such as red blood cells, bacteria, etc. with corresponding antibodies into visible aggregates to the naked eye after a certain time in the presence of an appropriate amount of electrolyte. SAT is a legal experiment for brucellosis detection in China. Its advantages are that the detection of serum immunoglobulin M (IgM) by SAT has high sensitivity, simple operation, easy determination, and high diagnostic value. However, when used alone, its specificity is poor, and it cannot distinguish between artificial immunization and natural infection. Moreover, the antibody titers of some infected animals do not reach the diagnostic level, so it is also easy to cause misdiagnosis and missed diagnosis.

[0007] In vitro nucleic acid amplification diagnosis, the artificial replication of genetic material, has penetrated into all fields of life science and biotechnology, such as pathogen detection, genetic engineering, synthetic biology, gene typing, food detection, medical diagnosis, etc. In vitro diagnosis originated from polymerase chain reaction technology (PCR). By providing continuous temperatures conducive to nucleic acid strand denaturation, primer annealing, and enzymatic extension, a single nucleic acid molecule is replicated into billions of copies in vitro, increasing the molecular quantity to make the processing and subsequent applications of nucleic acids easier, and generating great creativity in terms of applications. However, it requires a complex thermal cycler to provide the cyclic heating and cooling process, which largely limits the use of PCR technology in field scenarios outside the laboratory and hinders its application in POCT.

[0008] In summary, providing a novel in vitro nucleic acid amplification method for simultaneously detecting Brucella and Mycobacterium bovis has become one of the urgent problems to be solved in this field. Summary of the Invention

[0009] To solve the above technical problems, the present invention provides an isothermal nucleic acid amplification system for simultaneously detecting Brucella and Mycobacterium bovis in one tube and its application. By the isothermal nucleic acid amplification method, two pathogens can be detected simultaneously, with dual-channel detection and no competitive reaction, strong specificity, and high sensitivity.

[0010] To achieve this purpose, the present invention adopts the following technical solutions:

[0011] In a first aspect, the present invention provides an isothermal nucleic acid amplification system for simultaneously detecting Brucella and Mycobacterium bovis in a tube. The isothermal nucleic acid amplification system includes Brucella primer-probes, Mycobacterium bovis primer-probes, dNTPs, polyethylene glycol, dithiothreitol, creatine phosphate, creatine kinase, ATP, Tris, potassium acetate, DNA polymerase, UvsX protein, and UvsY protein.

[0012] The present invention provides an isothermal nucleic acid amplification system. Isothermal nucleic acid amplification solves the problem of PCR amplification relying on thermal cycling, reduces equipment requirements, opens up a new way to break through laboratory boundaries and perform amplification in resource-poor environments, and improves detection efficiency by reducing the amplification time and eliminating repeated heating and cooling steps. The faster occurrence of the reaction is not only due to the reduction of heating and cooling times, but also because multiple molecular reactions can proceed asynchronously instead of being forced to operate sequentially in artificial heating and cooling cycles.

[0013] In the isothermal nucleic acid amplification system provided by the present invention, dNTPs are the raw materials for DNA synthesis; polyethylene glycol enhances the catalytic activity of the enzyme and mimics the real in vivo conditions of biological macromolecules; dithiothreitol is used to remove free sulfhydryl groups and stabilize the enzyme system; creatine phosphate, creatine kinase, and ATP provide reaction energy; Tris and potassium acetate are used to stabilize and dissolve DNA in the solution; DNA polymerase synthesizes a new DNA template homologous to the target nucleic acid by extending nucleotide building blocks from the bound primers; UvsX protein is a recombinase used for gene recombination, DNA repair, and replication; UvsY protein is a recombinase loading factor, a recombination mediator protein, which can stimulate the single-stranded DNA-dependent, ATPase activity of UvsX and reduce the critical concentration of UvsX required for activity.

[0014] Preferably, the isothermal nucleic acid amplification system includes Brucella primer-probes, Mycobacterium bovis primer-probes, 1-2 mmol / L dNTPs, 5%-10% w / v polyethylene glycol, 2-10 mmol / L dithiothreitol, 25-50 mmol / L creatine phosphate, 2.7-4.3 μg / U creatine kinase, 5-10 mmol / L ATP, 30-100 nM Tris, 25-75 mmol / L potassium acetate, 10-100 ng / μL DNA polymerase, 10-100 ng / μL UvsX protein, and 10-100 ng / μL UvsY protein.

[0015] Specific point values within the above 1-2 mmol / L can be 1 mmol / L, 1.2 mmol / L, 1.4 mmol / L, 1.5 mmol / L, 1.6 mmol / L, 1.8 mmol / L, or 2 mmol / L, etc.

[0016] Specific point values within the above 5% - 10% can be 5%, 6%, 7%, 7.5%, 8%, 9%, or 10%, etc.

[0017] Specific point values within the above 2 - 10 mmol / L can be 2 mmol / L, 3 mmol / L, 4 mmol / L, 5 mmol / L, 6 mmol / L, 7 mmol / L, 8 mmol / L, 9 mmol / L, or 10 mmol / L, etc.

[0018] Specific point values within the above 25 - 50 mmol / L can be 25 mmol / L, 30 mmol / L, 35 mmol / L, 40 mmol / L, 45 mmol / L, or 50 mmol / L, etc.

[0019] Specific point values within the above 2.7 - 4.3 μg / U can be 2.7 μg / U, 3 μg / U, 3.3 μg / U, 3.5 μg / U, 3.7 μg / U, 4 μg / U, or 4.3 μg / U, etc.

[0020] Specific point values within the above 5 - 10 mmol / L can be 5 mmol / L, 6 mmol / L, 7 mmol / L, 7.5 mmol / L, 8 mmol / L, 9 mmol / L, or 10 mmol / L, etc.

[0021] Specific point values within the above 30 - 100 nM can be 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM, etc.

[0022] Specific point values within the above 25 - 75 mmol / L can be 25 mmol / L, 30 mmol / L, 35 mmol / L, 40 mmol / L, 45 mmol / L, 50 mmol / L, 55 mmol / L, 60 mmol / L, 65 mmol / L, 70 mmol / L, or 75 mmol / L, etc.

[0023] Specific point values within the above 10 - 100 ng / μL can be 10 ng / μL, 20 ng / μL, 30 ng / μL, 40 ng / μL, 50 ng / μL, 60 ng / μL, 70 ng / μL, 80 ng / μL, 90 ng / μL, or 100 ng / μL, etc.

[0024] Preferably, the source of the DNA polymerase includes Bacillus subtilis and / or Staphylococcus aureus.

[0025] Preferably, the polyethylene glycol includes polyethylene glycol 35K.

[0026] Preferably, the isothermal nucleic acid amplification system is a weakly alkaline system.

[0027] Preferably, the Brucella primer probe includes a first primer, a second primer, and a first probe.

[0028] Preferably, the isothermal nucleic acid amplification system includes 200 - 420 nmol / L of the first primer, 200 - 420 nmol / L of the second primer, and 100 - 150 nmol / L of the first probe.

[0029] The specific point values within the range of 200 - 420 nmol / L can be 200 nmol / L, 225 nmol / L, 250 nmol / L, 275 nmol / L, 300 nmol / L, 325 nmol / L, 350 nmol / L, 375 nmol / L, 400 nmol / L, or 420 nmol / L, etc.

[0030] The specific point values within the range of 100 - 150 nmol / L can be 100 nmol / L, 110 nmol / L, 120 nmol / L, 125 nmol / L, 130 nmol / L, 140 nmol / L, or 150 nmol / L, etc.

[0031] Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.1.

[0032] Preferably, the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.2.

[0033] Preferably, the nucleic acid sequence of the first probe includes the sequences shown in SEQ ID NO.3 and SEQ ID NO.4.

[0034] SEQ ID NO.1: TCAATGCCATCATGTCGCGCGCTCTGCAGTC.

[0035] SEQ ID NO.2: TCCTTACGCCCAACGATATCGATCGATTCCG.

[0036] SEQ ID NO.3: CTTAATGATGGCAAGCGCAAGGTGCATGA.

[0037] SEQ ID NO.4: GCGCGTTCTGCCGAC.

[0038] Preferably, the nucleic acid sequence of the first probe is as follows:

[0039] CTTAATGATGGCAAGCGCAAGGTGCATGA / iHEXdT / / idSp / / iBHQ1dT / GCGCGTTCTGC CGAC。

[0040] Among them, iHEXdT is a fluorescent reporter group, idSp is at least 2 - 5 base Ts spaced between the fluorescent reporter group and the quenching group, where T is replaced by a tetrahydrofuran residue, and iBHQ1dT is a fluorescent quenching group.

[0041] Preferably, the Mycobacterium bovis primer probe includes a third primer, a fourth primer, and a second probe.

[0042] Preferably, the isothermal nucleic acid amplification system includes 200 - 420 nmol / L of the third primer, 200 - 420 nmol / L of the fourth primer, and 100 - 150 nmol / L of the second probe.

[0043] The specific point values of the above 200 - 420 nmol / L can be 200 nmol / L, 225 nmol / L, 250 nmol / L, 275 nmol / L, 300 nmol / L, 325 nmol / L, 350 nmol / L, 375 nmol / L, 400 nmol / L, or 420 nmol / L, etc.

[0044] The specific point values of the above 100 - 150 nmol / L can be 100 nmol / L, 110 nmol / L, 120 nmol / L, 125 nmol / L, 130 nmol / L, 140 nmol / L, or 150 nmol / L, etc.

[0045] Preferably, the nucleic acid sequence of the third primer includes the sequence shown in SEQ ID NO.5.

[0046] Preferably, the nucleic acid sequence of the fourth primer includes the sequence shown in SEQ ID NO.6.

[0047] Preferably, the nucleic acid sequence of the second probe includes the sequences shown in SEQ ID NO.7 and SEQ ID NO.8.

[0048] SEQ ID NO.5: CACTAGTGCGCGGACATCGCGTGATCGTT.

[0049] SEQ ID NO.6: CAGCCAGATGCTGCTCCGTGTCGATTAGATGAGAA.

[0050] SEQ ID NO.7: CGATAAGATCAGAACAGGTCATTGCGTCATT.

[0051] SEQ ID NO.8: TCGATTGACTATAGCT。

[0052] Preferably, the nucleic acid sequence of the second probe is as follows:

[0053] CGATAAGATCAGAACAGGTCATTGCGTCATT / i6FAMdT / / idSp / C / iBHQ1dT / TCGATTGACTATAGCT-Spacer。

[0054] Wherein, i6FAMdT is a fluorescent reporter group, idSp is a spacer of at least 2-5 base Ts between the fluorescent reporter group and the quenching group, wherein T is replaced by a tetrahydrofuran residue, and iBHQ1dT is a fluorescent quenching group.

[0055] In a second aspect, the present invention provides an isothermal nucleic acid amplification kit for simultaneously detecting Brucella and Mycobacterium bovis in one tube, and the isothermal nucleic acid amplification kit includes the isothermal nucleic acid amplification system described in the first aspect.

[0056] In a third aspect, the present invention provides the application of the isothermal nucleic acid amplification system described in the first aspect and / or the isothermal nucleic acid amplification kit described in the second aspect in isothermal amplification of Brucella and / or Mycobacterium bovis.

[0057] In a fourth aspect, the present invention provides an isothermal nucleic acid amplification method for simultaneously detecting Brucella and Mycobacterium bovis in one tube, and the isothermal nucleic acid amplification method includes: mixing a nucleic acid sample with the isothermal nucleic acid amplification system described in the first aspect to obtain a mixture, performing an isothermal amplification reaction, detecting the fluorescence signal in the amplification system, and obtaining a detection result.

[0058] Based on isothermal nucleic acid amplification, the present invention proposes a concept of accessible sample addition, that is, eliminating the traditional manual micro-precision pipette sample addition method, and adopting a large sample addition amount of 25-50 μL for the amplification reaction, solving the problem of precise micro-sample addition in mobile on-site nucleic acid detection, enabling the general public to simply operate manually according to the steps, and further improving the detection sensitivity.

[0059] The isothermal nucleic acid amplification method provided by the present invention can be applied to fields such as animal diseases, inspection and quarantine, and customs prevention and control, such as detecting whether Brucella and Mycobacterium bovis exist in milk samples.

[0060] Preferably, the volume of the nucleic acid sample is 3-30 μL (for example, it can be 3 μL, 5 μL, 7 μL, 10 μL, 15 μL, 20 μL, 23 μL, 25 μL, 27 μL or 30 μL, etc.).

[0061] Preferably, the volume of the mixed solution is 45-55 μL (for example, it can be 45 μL, 47 μL, 49 μL, 50 μL, 51 μL, 53 μL or 55 μL, etc.).

[0062] Preferably, the mixed solution contains magnesium acetate.

[0063] Preferably, the concentration of magnesium acetate in the mixed solution is 100-200 mmol (for example, it can be 100 mmol, 120 mmol, 140 mmol, 150 mmol, 160 mmol, 180 mmol or 200 mmol, etc.).

[0064] Preferably, the volume of magnesium acetate in the mixed solution is 3-7 μL (for example, it can be 3 μL, 4 μL, 4.5 μL, 5 μL, 5.5 μL, 6 μL or 7 μL, etc.).

[0065] Preferably, the mixed solution contains 3-10 μL (for example, it can be 3 μL, 4 μL, 4.5 μL, 5 μL, 5.5 μL, 6 μL, 7 μL, 8 μL, 9 μL or 10 μL, etc.) of nucleic acid sample, 3-7 μL (for example, it can be 3 μL, 4 μL, 4.5 μL, 5 μL, 5.5 μL, 6 μL or 7 μL, etc.) of magnesium acetate with a concentration of 100-200 mmol, and the isothermal nucleic acid amplification system described in the first aspect, and the volume of the mixed solution is 45-55 μL (for example, it can be 45 μL, 47 μL, 49 μL, 50 μL, 51 μL, 53 μL or 55 μL, etc.).

[0066] Preferably, the mixed solution contains 10-30 μL (for example, it can be 10 μL, 15 μL, 20 μL, 22 μL, 24 μL, 25 μL, 26 μL, 28 μL or 30 μL, etc.) of nucleic acid sample and the isothermal nucleic acid amplification system described in the first aspect, and the volume of the mixed solution is 45-55 μL (for example, it can be 45 μL, 47 μL, 49 μL, 50 μL, 51 μL, 53 μL or 55 μL, etc.).

[0067] Preferably, the temperature of the isothermal amplification reaction is 35-45 °C (for example, it can be 35 °C, 36 °C, 37 °C, 38 °C, 39 °C, 40 °C, 41 °C, 42 °C, 43 °C, 44 °C or 45 °C, etc.).

[0068] Preferably, the time of the isothermal amplification reaction is 5-40 min (for example, it can be 5 min, 10 min, 15 min, 20 min, 25 min, 27 min, 29 min, 30 min, 31 min, 33 min, 35 min or 40 min, etc.).

[0069] Preferably, before the isothermal amplification reaction, the steps of mixing and centrifuging the mixture and pre-reacting for 3 to 5 minutes (such as 3 minutes, 3.5 minutes, 4 minutes, 4.5 minutes or 5 minutes, etc.) are further included.

[0070] Other specific point values within the above numerical ranges can all be selected and will not be elaborated one by one here.

[0071] Compared with the prior art, the present invention has the following beneficial effects:

[0072] (1) The isothermal nucleic acid amplification system provided by the present invention can detect two pathogens in milk simultaneously in one tube, with no competitive reaction in dual-channel detection, strong specificity, and a sensitivity up to 1 CFU / mL.

[0073] (2) Based on the specific isothermal nucleic acid amplification system provided by the present invention, the detection method provided by the present invention can achieve large-sample-volume amplification, solve the problem of precise and micro-sample addition in mobile on-site nucleic acid detection. The equipment used in the detection method is light and portable, and can realize mobile detection, bedside detection, battlefield medical treatment and other scenarios. Without large equipment, the results can be automatically interpreted, and a detection pipeline can be randomly formed in animal disease detection scenarios such as individual households, field scenarios, and customs. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 It is a verification result diagram of Brucella negative samples.

[0075] Figure 2 It is a verification result diagram of Brucella primer / probe adjusted negative samples.

[0076] Figure 3 It is a verification result diagram of Brucella primer / probe adjusted negative samples.

[0077] Figure 4 It is a verification result diagram of positive simulated samples of systems 1, 2 and 3.

[0078] Figure 5 It is a verification result diagram of positive simulated samples of systems 4 and 5.

[0079] Figure 6 It is a verification result diagram of positive and negative simulated samples of system 4.

[0080] Figure 7 It is a verification result diagram of positive and negative simulated samples of system 5.

[0081] Figure 8 It is a verification result diagram of negative samples of the optimal reaction system.

[0082] Figure 9 It is a verification result diagram of the BCG detection sensitivity of the optimal reaction system.

[0083] Figure 10 It is the verification result graph of the detection sensitivity of the best reaction system BRU.

[0084] Figure 11 It is the verification result graph of the competitive reaction of two bacteria in the best reaction system.

[0085] Figure 12 It is the verification result graph of the competitive reaction of two bacteria in the best reaction system.

[0086] Figure 13 It is the verification result graph of the extract of the negative milk sample in the best reaction system.

[0087] Figure 14 It is the detection result graph of the mixed sample by the conventional sample addition method.

[0088] Figure 15 It is the detection result graph of the mixed sample by the conventional sample addition method.

[0089] Figure 16 It is the detection result graph of the accessible sample addition method.

[0090] Figure 17 Detection result graph of the accessible sample addition method. Detailed implementation manners

[0091] To further illustrate the technical means and effects adopted by the present invention, the present invention will be further described below in conjunction with embodiments and drawings. It can be understood that the specific implementation manners described herein are only used to explain the present invention, rather than limiting the present invention.

[0092] For those not specifying specific techniques or conditions in the embodiments, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For those reagents or instruments not specifying the manufacturer, they are all conventional products that can be obtained by purchasing through regular channels.

[0093] Embodiment 1

[0094] (1) Experimental materials

[0095] Table 1

[0096]

[0097] Among them, the fluorescence basic reaction unit contains dNTP, polyethylene glycol, dithiothreitol, creatine phosphate, creatine kinase, ATP, Tris, potassium acetate, DNA polymerase, UvsX protein and UvsY protein, etc.

[0098] The nucleic acid sequences of the upstream primer, downstream primer and probe of Brucella (hereinafter referred to as BRU) are as follows:

[0099] Forward primer (SEQ ID NO.1): TCAATGCCATCATGTCGCGCGCTCTGCAGTC;

[0100] Reverse primer (SEQ ID NO.2): TCCTTACGCCCAACGATATCGATCGATTCCG;

[0101] Probe: CTTAATGATGGCAAGCGCAAGGTGCATGA / iHEXdT / / idSp / / iBHQ1dT / GCGCGTTCTGCCGAC.

[0102] The nucleic acid sequences of the forward primer, reverse primer and probe of Mycobacterium bovis BCG (hereinafter referred to as BCG) are as follows:

[0103] Forward primer (SEQ ID NO.5): CACTAGTGCGCGGACATCGCGTGATCGTT;

[0104] Reverse primer (SEQ ID NO.6): CAGCCAGATGCTGCTCCGTGTCGATTAGATGAGAA;

[0105] Probe: CGATAAGATCAGAACAGGTCATTGCGTCATT / i6FAMdT / / idSp / C / iBHQ1dT / TCGATTGACTATAGCT-Spacer.

[0106] (2) Verification of Brucella negative samples

[0107] Prepare the RAA mixture according to Table 2, dispense 40 μL of the above RAA mixture into the fluorescence basic reaction unit, add 5 μL of magnesium acetate to the reaction tube cap, add 5 μL of negative water to the reaction tube, set a total of 10 parallel experiments with negative water, place the reaction tube in F6108 for pretreatment, and place it in F1620 / F1628 for constant temperature amplification at 39 °C for 30 min.

[0108] Table 2

[0109] Reagent Volume (μL) DEPC Water 10.2 Buffer 25 Brucella Upstream Primer 2.1 Brucella Downstream Primer 2.1 Brucella Probe 0.6

[0110] The results are as Figure 1 shown. In 10 negative experiments of the Brucella single-pass system, no amplification phenomenon occurred and there was no false positive situation.

[0111] (3) Verification of Brucella primer / probe adjustment

[0112] Prepare the RAA mixture according to Table 3. Aliquot 40 μL of the above RAA mixture into the fluorescence basic reaction unit. Add 5 μL of magnesium acetate to the reaction tube cap, and add 5 μL of negative water or the extraction product of negative milk sample to the reaction tube. Set up 3 parallel experiments for negative water and 3 parallel experiments for the extraction product of negative milk sample. Place the reaction tube in F6108 for pretreatment, and then place it in F1620 / F1628 for isothermal amplification at 39 °C for 30 min.

[0113] Table 3

[0114]

[0115] Adjust the dosage of Brucella primers and probes. The results are as Figure 2 and Figure 3 shown. Figure 2 They are the detection results of System 1, System 2 and System 3. Figure 3 They are the detection results of System 4 and System 5. It is found that only in System 3, slight amplification phenomena occur in Channel 1 and Channel 2 of the negative milk sample extract, and no amplification phenomena occur in the negative water and negative milk sample extracts of the other four systems.

[0116] (4) Verification of positive and negative simulated samples in the system after adjustment of Brucella primers / probes

[0117] Prepare the RAA mixture according to Table 3. Aliquot 40 μL of the above RAA mixture into the fluorescence basic reaction unit. Add 5 μL of magnesium acetate to the reaction tube cap, and add 5 μL of sample nucleic acid to the reaction tube. Set up 1 group of negative milk extract, 3 parallel experiments of Mycobacterium bovis extract with a concentration of 50 CFU / mL (diluted from negative milk sample extract), and 3 parallel experiments of Brucella plasmid with a concentration of 2 copies / μL (diluted from negative milk sample extract). Place the reaction tube in F6108 for pretreatment, and then place it in F1620 / F1628 for isothermal amplification at 39 °C for 30 min.

[0118] The results are as Figure 4 and Figure 5 shown. Figure 4 They are the detection results of System 1, System 2 and System 3. Figure 5 They are the detection results of System 4 and System 5. It is found that slight amplification still occurs in the negative milk sample (Channel 1) of System 3, so this system is no longer studied. For System 1, System 2, System 4 and System 5, all Mycobacterium bovis with a concentration of 50 cfu / mL can be detected in Channel 1, and all Brucella plasmids with 2 copies / μL can be detected in Channel 2. According to the principle of saving raw materials, the sensitivity verification is carried out for System 4 and System 5 below.

[0119] (5) Verification of positive and negative simulated samples in System 4 and System 5

[0120] Prepare the RAA mixtures for System 4 and System 5 according to Table 3. Aliquot 40 μL of the above RAA mixture into the fluorescence basic reaction unit. Add 5 μL of magnesium acetate to the reaction tube cap, and add 5 μL of sample nucleic acid to the reaction tube. Set up 1 group of negative milk extraction products, 3 parallel experiments of Mycobacterium bovis extraction products with a concentration of 10 CFU / mL (diluted from negative milk sample extracts), and 3 parallel experiments of Brucella plasmid with a concentration of 1 copy / μL (diluted from negative milk sample extracts). Place the reaction tube in F6108 for pretreatment, and then place it in F1620 / F1628 for isothermal amplification at 39 °C for 30 min.

[0121] Prepare the RAA mixtures for System 4 and System 5 according to Table 3. Aliquot 40 μL of the above RAA mixture into the fluorescence basic reaction unit. Add 5 μL of magnesium acetate to the reaction tube cap, and add 5 μL of sample nucleic acid to the reaction tube. Set up 1 group of negative milk extraction products, 3 parallel experiments of Mycobacterium bovis extraction products with a concentration of 5 CFU / mL (diluted from negative milk sample extracts), and 3 parallel experiments of Brucella plasmid with a concentration of 0.5 copy / μL (diluted from negative milk sample extracts). Place the reaction tube in F6108 for pretreatment, and then place it in F1620 / F1628 for isothermal amplification at 39 °C for 30 min.

[0122] The results are as Figure 6 and Figure 7 shown. Figure 6 are the detection results of System 4, Figure 7 are the detection results of System 5. In Channel 1 (Mycobacterium bovis) of System 4 and System 5, 10 cfu / mL can be detected, and in Channel 2 (Brucella), 0.5 copy / μL can be detected. Finally, System 5 is selected as the amplification system for the integrated single-tube detection of Mycobacterium bovis and Brucella.

[0123] (6) Verification of negative samples in System 5

[0124] Prepare the RAA mixture for System 5 according to Table 3. Aliquot 40 μL of the above RAA mixture into the fluorescence basic reaction unit. Add 5 μL of magnesium acetate to the reaction tube cap, and add 5 μL of negative water or sample nucleic acid to the reaction tube. Set up 8 parallel experiments of negative water samples and 8 parallel experiments of negative milk sample extracts. Place the reaction tube in F6108 for pretreatment, and then place it in F1620 / F1628 for isothermal amplification at 39 °C for 30 min. Replace the fluorescence basic reaction unit with Batch 20240725-1 and repeat the above isothermal amplification process.

[0125] The results are as Figure 8As shown, no amplification occurred in either Channel 1 or Channel 2. The fluorescence basic reaction unit (batch 20240725-1) was replaced and the negative verification experiment was conducted again. It was found that slight amplification occurred in Channel 1 and Channel 2 for the negative water and negative milk sample extracts. Therefore, the fluorescence basic reaction unit of batch 20231018-2 was still used as the reaction unit for research.

[0126] (7) Sensitivity verification of System 5

[0127] Prepare the RAA mixture of System 5 according to Table 3. Aliquot 40 μL of the above RAA mixture into the fluorescence basic reaction unit. Add 5 μL of magnesium acetate to the reaction tube cap, and add 5 μL of sample nucleic acid to the reaction tube. Set up 4 groups of negative milk extraction products, 20 parallel experiments of Mycobacterium bovis extraction products with a concentration of 10 CFU / mL (diluted from negative milk sample extracts), and 20 parallel experiments of Brucella plasmid with a concentration of 0.5 copies / μL (diluted from negative milk sample extracts). Place the reaction tube in F6108 for pretreatment, and then place it in F1620 / F1628 for constant temperature amplification at 39 °C for 30 min.

[0128] The results are as Figure 9 and Figure 10 shown. The detection rate of Mycobacterium bovis at 10 cfu / mL in Channel 1 was 95% (19 / 20), and the detection rate of Brucella at 0.5 copies / μL in Channel 2 was (20 / 20).

[0129] (8) Competition reaction verification of System 5

[0130] Prepare the RAA mixture of System 5 according to Table 3. Aliquot 40 μL of the above RAA mixture into the fluorescence basic reaction unit. Add 5 μL of magnesium acetate to the reaction tube cap, and add 5 μL of sample nucleic acid to the reaction tube. Place the reaction tube in F6108 for pretreatment, and then place it in F1620 / F1628 for constant temperature amplification at 39 °C for 30 min. The experimental groups are as follows: 4 groups of negative milk extraction products, 20 integrated single tubes of Mycobacterium bovis extraction products with a final concentration of 10 CFU / mL and Brucella plasmid with a final concentration of 10 4 copies / μL (diluted from negative milk sample extracts), and 20 integrated single tubes of Mycobacterium bovis extraction products with a final concentration of 10 4 CFU / mL and Brucella plasmid with a final concentration of 0.5 copies / μL (diluted from negative milk sample extracts).

[0131] The results are as Figure 11 and Figure 12 shown. When the contents of Mycobacterium bovis and Brucella are 10 CFU / mL and 10 4When the copy number was 10 copies / μL, the detection rate of channel 1 was 100% (20 / 20), and the detection rate of channel 2 was 100% (20 / 20), and there was no competitive reaction phenomenon; when the contents of Mycobacterium bovis and Brucella were 10 4 CFU / mL and 0.5 copies / μL, the detection rate of channel 1 was 100% (20 / 20), and the detection rate of channel 2 was 100% (20 / 20), and there was no competitive reaction phenomenon.

[0132] (9) Verification of negative samples in System 5

[0133] Prepare the RAA mixture of System 5 according to Table 3, dispense 40 μL of the above RAA mixture into the fluorescence basic reaction unit, add 5 μL of magnesium acetate to the reaction tube cap, add 5 μL of negative water or negative milk extract to the reaction tube, set up 20 groups of parallel experiments, place the reaction tube in F6108 for pretreatment, and place it in F1620 / F1628 for constant temperature amplification at 39 °C for 30 min.

[0134] The results are as Figure 13 shown. For the verification of negative milk sample extracts, no amplification phenomenon occurred in both channel 1 and channel 2. In summary, the detection limit of Mycobacterium bovis is 10 cfu / mL, the detection limit of Brucella is 0.5 copies / μL, the best reaction system for integrating Mycobacterium bovis and Brucella into a single tube is System 5, there is no competitive reaction, and there is no false positive phenomenon. After preparation according to System 5, System 5 contains 420 nmol / L BRU upstream primer, 420 nmol / L BRU downstream primer, 120 nmol / L BRU probe, 420 nmol / L BCG upstream primer, 420 nmol / L BCG downstream primer, 120 nmol / L BCG probe, 1.5 mmol / L dNTP, 7.5% w / v polyethylene glycol, 6 mmol / L dithiothreitol, 37.5 mmol / L creatine phosphate, 3.5 μg / U creatine kinase, 7.5 mmol / L ATP, 50 nM Tris, 50 mmol / L potassium acetate, 50 ng / μL DNA polymerase, 60 ng / μL UvsX protein and 50 ng / μL UvsY protein.

[0135] Example 2

[0136] (1) Experimental materials

[0137] Table 4

[0138]

[0139] Among them, the reaction unit contains 420 nmol / L BRU upstream primer, 420 nmol / L BRU downstream primer, 120 nmol / L BRU probe, 420 nmol / L BCG upstream primer, 420 nmol / L BCG downstream primer, 120 nmol / L BCG probe, 1.5 mmol / L dNTP, 7.5% w / v polyethylene glycol, 6 mmol / L dithiothreitol, 37.5 mmol / L creatine phosphate, 3.5 μg / U creatine kinase, 7.5 mmol / L ATP, 50 nM Tris, 50 mmol / L potassium acetate, 50 ng / μL DNA polymerase, 60 ng / μL UvsX protein, and 50 ng / μL UvsY protein. The primer probes of BRU and BCG are the same as those in Example 1.

[0140] (2) Sample preparation

[0141] a. Dilute the sample with negative milk sample extract to a mixed sample with a final concentration of 10 cfu / mL of Mycobacterium bovis and 0.5 copies / μL of Brucella

[0142] b. Dilute the sample with negative milk sample extract to a mixed sample with a final concentration of 10 cfu / mL of Mycobacterium bovis and 10 4 copies / μL of Brucella

[0143] c. Dilute the sample with negative milk sample extract to a mixed sample with a final concentration of 10 4 cfu / mL of Mycobacterium bovis and 0.5 copies / μL of Brucella

[0144] d. Dilute the nucleic acid of Mycobacterium bovis with negative milk sample extract to 1 cfu / mL and 0.5 cfu / mL.

[0145] e. Dilute the Brucella plasmid with negative milk sample extract to 0.5 copies / μL and 0.1 copies / μL.

[0146] (3) Verification of conventional sample loading method

[0147] Prepare the instrument sample pretreatment system B6108 and the isothermal nucleic acid amplification analyzer F1620 / F1628, adjust the temperature to 39 °C, and preheat. Add 40 μL of the system 5 in Example 1 to the Mycobacterium bovis / Brucella reaction unit tube, add 5 μL of magnesium acetate to the reaction unit tube cap, and add 5 μL of negative control or sample nucleic acid. Symmetrically place the reaction unit into the sample pretreatment system B6108, mix and centrifuge, and pre-react for 4 minutes. After the pretreatment is completed, sequentially place it into the isothermal nucleic acid amplification analyzer F1620 / F1628, react at 39 °C for 30 min, and observe the amplification result in real time through the computer terminal.

[0148] Figure 14 These are the 20 test results of sample a. Figure 15 These are the 10 test results of sample b and the 10 test results of sample c. The detection rate of Mycobacterium bovis extract at 10 cfu / mL is 100% (20 / 20), and the detection rate of Brucella plasmid at 0.5 copy / μL is 100% (20 / 20); in the dual-channel positive sample competition experiment, the final concentration of Mycobacterium bovis in channel 1 is 10 cfu / mL, and the final concentration of Brucella plasmid in channel 2 is 10 4 copies / μL. The detection rate of channel 1 is 100% (10 / 10), and the detection rate of channel 2 is 100% (10 / 10), and there is no competition reaction phenomenon; the final concentration of Mycobacterium bovis in channel 1 is 10 4 cfu / mL, the final concentration of Brucella plasmid in channel 2 is 0.5 copy / μL, the detection rate of channel 1 is 100% (10 / 10), and the detection rate of channel 2 is 100% (10 / 10), and there is no competition reaction phenomenon.

[0149] (4) Verification of accessible sample addition method

[0150] Prepare the instrument sample pretreatment system B6108 and the isothermal nucleic acid amplification analyzer F1620 / F1628, adjust the temperature to 39 °C, and perform preheating. Add 25 μL of System 5 in Example 1 to the lid of the Mycobacterium bovis / Brucella reaction unit tube, and then add 25 μL of negative control or sample nucleic acid to the reaction unit tube. Place the reaction unit symmetrically into the sample pretreatment system B6108, mix and centrifuge, and pre-react for 4 minutes. After the pretreatment is completed, place it into the isothermal nucleic acid amplification analyzer F1620 / F1628 in sequence, react at 39 °C for 30 min, and observe the amplification results in real time through the computer terminal.

[0151] Figure 16 These are the 13 test results of Mycobacterium bovis at 1 cfu / mL in sample d and the 3 test results of Mycobacterium bovis at 0.5 cfu / mL in sample d. Figure 17 These are the 3 test results of Brucella at 0.5 copy / μL in sample e and the 13 test results of Brucella at 0.1 copy / μL in sample e. The detection rate of Mycobacterium bovis at 1 cfu / mL is 100% (13 / 13), and the detection rate of Brucella at 0.1 copy / μL is 100% (13 / 13). The sensitivity of channel 1 and channel 2 has been improved.

[0152] In summary, the present invention provides an isothermal nucleic acid amplification system for simultaneously detecting Brucella and Mycobacterium bovis in one tube and its application. By the isothermal nucleic acid amplification method, two pathogens can be simultaneously detected, there is no competition reaction in the dual-channel detection, the specificity is strong, and the sensitivity is high.

[0153] The applicant declares that the above description is only a specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by any person skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. An isothermal nucleic acid amplification system for simultaneously detecting Brucella and Mycobacterium bovis tuberculosis in a tube, characterized in that, The isothermal nucleic acid amplification system includes Brucella primer-probe, Mycobacterium bovis primer-probe, dNTP, polyethylene glycol, dithiothreitol, creatine phosphate, creatine kinase, ATP, Tris, potassium acetate, DNA polymerase, UvsX protein and UvsY protein.

2. The isothermal nucleic acid amplification system according to claim 1, wherein The isothermal nucleic acid amplification system includes Brucella primer-probe, Mycobacterium bovis primer-probe, 1-2 mmol / L dNTP, 5%-10% w / v polyethylene glycol, 2-10 mmol / L dithiothreitol, 25-50 mmol / L creatine phosphate, 2.7-4.3 μg / U creatine kinase, 5-10 mmol / L ATP, 30-100 nM Tris, 25-75 mmol / L potassium acetate, 10-100 ng / μL DNA polymerase, 10-100 ng / μL UvsX protein and 10-100 ng / μL UvsY protein.

3. The isothermal nucleic acid amplification system according to claim 1 or 2, characterized in that, The source of the DNA polymerase includes Bacillus subtilis and / or Staphylococcus aureus; Preferably, the Brucella primer-probe includes a first primer, a second primer and a first probe; Preferably, the isothermal nucleic acid amplification system includes 200-420 nmol / L first primer, 200-420 nmol / L second primer and 100-150 nmol / L first probe; Preferably, the nucleic acid sequence of the first primer includes the sequence shown in SEQ ID NO.1; Preferably, the nucleic acid sequence of the second primer includes the sequence shown in SEQ ID NO.2; Preferably, the nucleic acid sequence of the first probe includes the sequences shown in SEQ ID NO.3 and SEQ ID NO.

4.

4. The isothermal nucleic acid amplification system according to any one of claims 1 to 3, wherein The Mycobacterium bovis primer-probe includes a third primer, a fourth primer and a second probe; Preferably, the isothermal nucleic acid amplification system includes 200-420 nmol / L third primer, 200-420 nmol / L fourth primer and 100-150 nmol / L second probe; Preferably, the nucleic acid sequence of the third primer includes the sequence shown in SEQ ID NO.5; Preferably, the nucleic acid sequence of the fourth primer includes the sequence shown in SEQ ID NO.6; Preferably, the nucleic acid sequence of the second probe includes the sequences shown in SEQ ID NO.7 and SEQ ID NO.

8.

5. An isothermal nucleic acid amplification kit for simultaneously detecting Brucella and Mycobacterium bovis in a tube, characterized in that, The isothermal nucleic acid amplification kit includes the isothermal nucleic acid amplification system according to any one of claims 1-4.

6. Use of the isothermal nucleic acid amplification system according to any one of claims 1-4 and / or the isothermal nucleic acid amplification kit according to claim 5 in isothermal amplification of Brucella and / or Mycobacterium bovis.

7. An isothermal nucleic acid amplification method for simultaneously detecting Brucella and Mycobacterium bovis in a tube, characterized in that, The isothermal nucleic acid amplification method includes: mixing a nucleic acid sample with the isothermal nucleic acid amplification system according to any one of claims 1-4 to obtain a mixture, performing an isothermal amplification reaction, detecting the fluorescence signal in the amplification system, and obtaining a detection result.

8. The isothermal nucleic acid amplification method according to claim 7, wherein The volume of the nucleic acid sample is 3-30 μL; Preferably, the volume of the mixture is 45-55 μL; Preferably, the mixture contains magnesium acetate; Preferably, the concentration of magnesium acetate in the mixed solution is 100 - 200 mmol; Preferably, the volume of magnesium acetate in the mixed solution is 3 - 7 μL.

9. The isothermal nucleic acid amplification method according to claim 7 or 8, characterized in that, The mixed solution contains 3 - 10 μL of nucleic acid sample, 3 - 7 μL of magnesium acetate with a concentration of 100 - 200 mmol, and the isothermal nucleic acid amplification system according to any one of claims 1 - 4. The volume of the mixed solution is 45 - 55 μL; Preferably, the mixed solution contains 10 - 30 μL of nucleic acid sample and the isothermal nucleic acid amplification system according to any one of claims 1 - 4. The volume of the mixed solution is 45 - 55 μL.

10. The isothermal nucleic acid amplification method according to any one of claims 7 to 9, characterized in that, The temperature of the isothermal amplification reaction is 35 - 45 °C; Preferably, the time of the isothermal amplification reaction is 5 - 40 min; Preferably, before the isothermal amplification reaction, it further includes the steps of mixing and centrifuging the mixed solution and pre - reacting for 3 - 5 min.

Images