Method for reducing corn plant height

Abstract

The invention relates to the technical field of biology, and particularly discloses a method for reducing the plant height of corn. The corn contains the ZmD9 mutant gene or the protein coded by the ZmD9 mutant gene, so that the plant height and the ear height of the plant can be reduced; the ZmD9 mutant gene takes a nucleotide sequence of a wild type ZmD9 gene as a reference sequence, and comprises 64-91 base deletion mutation in a CDS (Coding Sequence) region. The method is beneficial to improving the plant height and density tolerance characters of corn varieties, and has important breeding application potential.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a method for reducing corn plant height. Background Art

[0002] Maize (Zea mays L.) is a staple food crop. With global population growth and increasingly limited arable land resources, increasing maize yields has become a key research topic in modern agriculture. In recent years, the application of modern agricultural technologies, such as molecular breeding, transgenic technology, and high-density planting, has significantly boosted maize yields. Among these, planting density, as a key factor influencing maize yield, has garnered widespread attention.

[0003] Under high-density planting conditions, maize plants exhibit a typical shade avoidance syndrome (SAS). This physiological mechanism initiates a series of morphological and physiological changes when the plant perceives competition from surrounding plants through light signals (such as a decrease in the red / far-red light ratio). Specifically, these adaptive responses manifest as rapid stem elongation, changes in leaf angle, and earlier flowering time, all in an effort to overcome the shade and capture more photosynthetically active radiation. However, this shade avoidance response can lead to significant changes in plant structure: reduced stem diameter, elevated ear position, and longer internodes. This ultimately increases the risk of plant lodging, severely impacting yield and quality.

[0004] In contrast, dwarf maize exhibits unique agronomic advantages in high-density planting environments. Its plant height is significantly reduced, typically controlled at 60%-80% of normal plant height, while also possessing greater stalk mechanical strength. Research has shown that dwarf maize's stalks are 30%-50% more resistant to bending than conventional varieties, significantly reducing the incidence of lodging.

[0005] The screening and utilization of dwarf corn germplasm resources are key technical links in the genetic improvement of dwarf corn. Currently, discovered dwarf corn mutants can be primarily divided into two categories: recessive mutants and dominant / semi-dominant mutants. Recessive dwarf mutants (such as d1, d3, and d5) are more common in breeding applications, but they suffer from long breeding cycles and complex genetic backgrounds. Of particular note is the semi-dominant dwarf mutant d9. While exhibiting an extreme dwarf phenotype (plant height is only 40%-50% of normal varieties), it is accompanied by severe fertility defects, limiting its direct application in production. Therefore, the creation of new dwarf corn germplasm with superior agronomic traits through modern biotechnologies such as molecular marker-assisted selection and gene editing remains a key research direction in corn genetics and breeding.

[0006] In summary, in-depth research on the dwarfing mechanism of corn and the development of new dwarf germplasm resources are of great theoretical and practical significance for improving corn's resistance to lodging and achieving stable and high yields under high-density planting. Summary of the Invention

[0007] One of the purposes of the present invention is to provide a new method for reducing corn plant height and ear height without affecting plant fertility.

[0008] The present invention provides a method for reducing corn plant height, wherein the corn comprises ZmD9 Mutated gene or protein encoded by it; ZmD9 mutant gene, wild type ZmD9 The nucleotide sequence of the gene is a reference sequence, which contains a mutation in which bases 64 to 91 of the CDS region are deleted.

[0009] The present invention uses gene editing technology to D9 The gene was modified specifically to start the secondary translation of the protein, ZmD9 The mutant gene exhibits excellent plant fertility and semi-dominant dwarfing characteristics. Plant height and ear height are significantly reduced, while flowering time (pollen shedding) is not significantly different from the wild type. This gene is easy to select in the field and can significantly reduce the height of F1 generation plants, helping to improve plant height and density tolerance in corn varieties, showing significant potential for breeding applications.

[0010] In the method of the present invention, the ZmD9 The mutant gene has a nucleotide sequence as shown in SEQ ID NO.2.

[0011] In the method of the present invention, the corn is modified by gene knockout, hybridization, backcrossing, selfing or asexual reproduction. ZmD9 Mutated gene.

[0012] The present invention also provides a ZmD9 The mutant gene is as described above.

[0013] The present invention also provides the protein encoded by the mutant gene.

[0014] The present invention also provides a biological material comprising the mutant gene, wherein the biological material is an expression cassette, a vector or a host cell.

[0015] The present invention also provides the use of the mutant gene, protein or biological material in regulating plant height and / or ear height; preferably, the plant is corn.

[0016] The present invention also provides the application of the mutant gene, protein or biological material in improving corn germplasm resources.

[0017] The present invention also provides a method for identifying whether corn contains ZmD9 A method for mutating a gene, comprising: (1) Extracting DNA from the corn to be identified; (2) Using the DNA extracted in step (1) as a template, perform PCR amplification using a primer combination; if the length of the amplified fragment is 125 bp, it is determined that the corn to be identified contains ZmD9 Mutated genes; The primer combination has the sequences shown in SEQ ID NOs. 4 and 5; described ZmD9 The mutant genes are as described above.

[0018] In the present invention, the term "nucleic acid" refers to a polymer composed of nucleotides linked by phosphodiester bonds, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

[0019] In the present invention, the nucleic acid may be in single-stranded or double-stranded form, and may be naturally occurring or artificially synthesized.

[0020] the term" ZmD9 "Mutant gene" refers to a gene that is different from the wild type ZmD9 Compared with a gene, a gene with a specific base deletion, insertion or substitution in its nucleotide sequence, such as a mutant gene containing a deletion of bases 64-91 in the CDS region.

[0021] The term "gene editing" refers to technologies that use artificial means to make specific modifications to the genome of an organism, including but not limited to CRISPR / Cas9, TALEN, and zinc finger nuclease (ZFN) technologies.

[0022] In the present invention, gene editing technology is used to introduce ZmD9 Mutate genes to regulate the height of corn plants.

[0023] The term "semi-dominant mutant" refers to a mutant that, in the heterozygous state, exhibits phenotypic characteristics intermediate between those of the wild type and the homozygous mutant.

[0024] In the present invention, ZmD9 The mutant gene exhibits a semi-dominant trait, that is, the plant height and ear height of the heterozygous plant (ZmD9 / +) are between the wild type (+ / +) and the homozygous mutant (ZmD9 / ZmD9), and the reduction is about half of that of the homozygous mutant. This semi-dominant trait makes ZmD9 Mutant genes have higher practicality and selection efficiency in corn breeding.

[0025] The term "secondary translation" refers to the phenomenon in which, during protein translation, upon encountering a stop codon (such as UAA, UAG, or UGA), the translation process is temporarily terminated. However, due to the presence of another start codon downstream (such as AUG), the translation process is restarted, resulting in the production of a new protein product. The protein produced by this secondary translation typically lacks the N-terminal region and contains only the C-terminal sequence starting from the downstream start codon.

[0026] In a specific embodiment of the present invention, ZmD9 The deletion of bases 64-91 in the CDS region of the mutant gene results in a stop codon during translation. However, due to the presence of another start codon downstream, translation is restarted, producing a mutant protein lacking the N-terminal DELLA domain. This secondary translation produces a protein that retains some functionality while causing the maize plant to exhibit semi-dominant dwarfism.

[0027] The terms "secondary translated protein", "secondary translation product", "N-terminal deleted protein" and the like are used interchangeably in the present invention.

[0028] The terms "protein", "polypeptide" and "peptide" are used interchangeably to refer to a polymer composed of amino acid residues linked by peptide bonds, and include naturally occurring amino acid residues or chemical analogs thereof.

[0029] The term "mutant protein" or "mutant protein" refers to a protein having one or more amino acid residue substitutions, insertions, deletions and / or additions in its amino acid sequence compared to a parent protein.

[0030] For example, the term "ZmD9 mutant protein" refers to a specific protein produced by a secondary translation process.

[0031] The phenomenon of secondary translation is of great significance in gene function research and protein engineering. By regulating the translation start site or introducing specific mutations, precise regulation of protein structure and function can be achieved.

[0032] In the present invention, the secondary translation is ZmD9 Functional research on mutant genes and dwarf corn breeding provide new theoretical basis and technical means.

[0033] The beneficial effects of the present invention are at least: The present invention provides a new method for reducing plant height and ear height without affecting plant fertility. ZmD9 Mutating genes can create plant varieties that are more resistant to lodging, thus contributing to ensuring yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1Schematic diagram of the CRIPSR / Cas9 vector structure.

[0035] Figure 2 The results of target sequence mutation type analysis.

[0036] Figure 3 The phenotypic observation results of the wild-type maize inbred line KN5585, the mutant ΔN-D9 (mutant), and the BC1F1 heterozygous plants; A represents plant height, B represents ear height, C represents pollen shedding time, and D represents ear length. a, b, and c represent Turkey tests. P <0.05.

[0037] Figure 4 Figure 1 shows the plant height and ear phenotypes (obtained after self-pollination) of the wild-type maize inbred line KN5585, the mutant ΔN-D9, and the BC1F1 heterozygous plants. The scale bar represents 20 cm.

[0038] Figure 5 The results of electrophoresis detection are shown in Figure 5. Lanes 1, 2, 3, 4, and 5 represent Marker, wild type #1, wild type #2, mutant ΔN-D9, and BC1F1 heterozygote, respectively. DETAILED DESCRIPTION

[0039] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0040] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples are all commercially available or prepared according to conventional methods in the art.

[0041] Example 1 Preparation of N-terminal deletion mutant material of D9 gene The present invention uses D9 in corn as the target gene and uses the CRISPR / Cas9 system to edit the N-terminal sequence of D9 to obtain an N-terminal deletion mutant of D9.

[0042] 1. Target gene The genomic sequence of the D9 gene was obtained from NCBI (https: / / www.ncbi.nlm.nih.gov). The D9 gene (Zm00001d013465) is located on chromosome 5 of the maize genome and has only one exon. Its coding region (CDS) is 1881 bp long and encodes 626 amino acids. The sequence of the wild-type D9 gene is shown in SEQ ID No. 1.

[0043] SEQ ID NO.1 (wild-type DNA sequence of D9 gene):

[0044] 2. Target design sgRNA design was performed using the Huazhong Agricultural University CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Targets with high on-target scores, low off-target rates, and appropriate locations were selected. A highly specific sgRNA target sequence, Target 1, was designed targeting the upstream sequence of the DELLA domain of the D9 gene.

[0045] Target 1 (SEQ ID No. 3): CTCCTCCAAGGACAAGTCGATGG, which is located at positions 48-70 downstream of ATG.

[0046] 3. CRIPSR / Cas9 vector construction The specific construction method is as follows: 1) Amplify the target fragment sgRNA-1 (Target 1) using the primer pair, recover the target fragment and digest it with BsaI; 2) Digest the CRIPSR / Cas9 backbone vector (see paragraphs 0095-0097 of the specification of Chinese patent CN 113215156 A) with BsaI and recover the large fragment after digestion; 3) Connect sgRNA-1 to the linearized backbone vector; 4) Transform the ligation product into competent E. coli Trans-T1, spread on Kan plate for culture, pick 8 colonies for liquid culture for 2 hours, perform PCR bacterial liquid detection, select 2 correct monoclonal clones, and send the bacterial liquid for testing; 5) Select the single clone with correct sequencing for expansion, bacterial preservation, and plasmid extraction to finally obtain the CRIPSR / Cas9 vector containing sgRNA.

[0047] Schematic diagram of CRIPSR / Cas9 vector structure Figure 1 .

[0048] 4. Obtaining gene-edited positive plants The constructed CRIPSR / Cas9 vector was used to transform Agrobacterium tumefaciens EHA105. Five single colonies were cultured and, after positive PCR testing, preserved for future use. Positive Agrobacterium strains were used to transform callus tissue from the maize inbred line KN5585. The specific transformation steps were described in the literature "ISHIDA Y, HIEI Y, KOMARI T. Agrobacterium-mediated transformation of maize. Nature Protocols, 2007. 2(7):1614-21." The specific process is as follows: 1) Preparation of Agrobacterium culture solution.

[0049] A single Agrobacterium colony carrying the binary vector was selected and inoculated into YEB liquid medium (containing 50 mg / L streptomycin, 50 mg / L rifampicin, and the appropriate antibiotics). Culture was shaken at 28°C and 220 rpm for 12-16 hours until the OD600 value reached 0.6-0.8. The logarithmic growth phase culture was collected by centrifugation at 4000 × g for 10 minutes, resuspended in an equal volume of infection solution (MS salts + 100 μM acetosyringone AS + 10 mM MES pH 5.6), and incubated in the dark for 1 hour to induce Vir gene expression.

[0050] 2) Pretreatment of corn callus.

[0051] Immature embryos of KN5585 10-12 days after pollination were sterilized with 70% ethanol (30 s) and 20% sodium hypochlorite (15 min), and then inoculated into N6 induction medium (2 mg / L 2,4-D + 30 g / L sucrose + 0.5 g / L hydrolyzed casein). Type I callus was obtained by culture at 25°C in the dark for 2 weeks.

[0052] 3) Agrobacterium-callus co-culture.

[0053] Immerse type II callus (subcultured once) in the induced Agrobacterium culture solution (OD600=0.3-0.5), gently shake for 10-15 min, aspirate the excess culture solution, and transfer to co-culture medium (MS+100 μM AS+2 mg / L 2,4-D+0.8% agar).

[0054] 4) Degerming and screening culture.

[0055] After co-cultivation, the callus was blotted dry with sterile filter paper and washed three times with MS liquid medium containing 500 mg / L cefotaxime for 5 min each time to completely remove Agrobacterium on the surface.

[0056] Calli were transferred to recovery medium (N6 medium with 250 mg / L cephalexin and 0.5 mg / L 2,4-D) and incubated in the dark at 25°C for 5-7 days to promote wound repair. The selection pressure was then gradually increased, with primary screening (N6 medium containing 1 / 2 critical concentration of antibiotics for 2 weeks) and secondary screening (full concentration antibiotic medium, subcultured every 2 weeks for 6 weeks to eliminate non-transformed cells).

[0057] 5) Regeneration and molecular characterization.

[0058] The resistant calli were transferred to regeneration medium (MS + 1 mg / L 6-BA + 0.5 mg / L NAA + 30 g / L sucrose) and cultured at 25°C under illumination (16 h light / 8 h dark) for 3-4 weeks to induce bud differentiation.

[0059] Cut 2-3 cm regenerated shoots, inoculate them into rooting medium (1 / 2 MS + 0.1 mg / L NAA), and culture for 10-15 days to form a complete root system.

[0060] The PCR amplification method was used to verify the transgenic positive plants. The genomic DNA of the T0 generation plants was extracted and PCR amplified using Basta-specific primers (Bar-F and Bar-R). The plants that could amplify the target fragment were the T0 generation gene-edited positive seedlings.

[0061] Bar-F: CCATCGTCAACCACTACATCGAGACA (SEQ ID No. 8); Bar-R: CTTCAGCAGGTGGGTGTAGAGCGT (SEQ ID No. 9).

[0062] The PCR reaction system is shown in Table 1 below.

[0063] Table 1 Example 2 Analysis of target sequence mutation types in gene-edited positive plants and development of molecular markers 1. Target mutation detection and sequence analysis To accurately analyze the efficiency and mutation types of CRISPR / Cas9-mediated gene editing, specific primers were designed for the targeted editing site of the key maize dwarf gene D9 (GenBank accession number: XM_020548619.1). Using the NCBI Primer-BLAST tool, primer pairs D9-genotyping-F (5'-CATGAAGCGCGAGTACCAAA-3', SEQ ID No. 4) and D9-genotyping-R (5'-GACGAACGCACCTTGTACC-3', SEQ ID No. 5) were designed within a conserved region approximately 150 bp upstream and downstream of the target site. These primers span the target site (amplifying the fragment encompassing the sgRNA binding region). Primer Tm values were 62.3°C and 61.8°C, respectively, as calculated by OligoCalc. The GC content was 45%-50%, minimizing primer dimers and nonspecific binding.

[0064] 2. DNA extraction and PCR detection High-quality genomic DNA (A260 / A280 = 1.85 ± 0.05, concentration ≥ 50 ng / μL) was extracted from fresh leaves of T0-generation transgenic-positive plants using a modified CTAB method. High-fidelity PCR amplification was performed using PrimeSTAR® HS DNA Polymerase (TaKaRa). The reaction mixture (25 μL) contained: 12.5 μL of 2× PCR Buffer, 1 μL each of 10 μM forward and reverse primers, 50 ng of template DNA, and ddH2O to the final volume. The thermal cycling program was as follows: initial denaturation at 95°C for 5 min; 35 cycles of (98°C for 10 s, annealing at 60°C for 15 s, and extension at 72°C for 20 s); and a final extension at 72°C for 5 min. After verification by 1% agarose gel electrophoresis (120 V, 30 min), the amplified product was purified using the SanPrep column DNA gel extraction kit (Sangon Biotech) and sent to a sequencing company for bidirectional Sanger sequencing (ABI 3730xl sequencer).

[0065] 3. Sequencing Data Analysis The original peak profile files were imported into SnapGene® software and multiple sequence alignment was performed with the wild-type KN5585 reference sequence using the sequence alignment module (Clustal Omega algorithm). The results showed that the positive plants had a 28-bp in-frame deletion (Δ28 bp, SEQ ID No. 2) at positions 64-91 (with the ATG start codon as +1) in the CDS region of the D9 gene. This deletion resulted in the loss of amino acids 22-29 (VLRQLLQS, SEQ ID No. 7) in the encoded protein (SEQ ID No. 6). Further SWISS-MODEL homology modeling revealed that the deleted region is located in the highly conserved α-helical region of the DELLA domain, a key site for GID1 receptor binding in the gibberellin signaling pathway. Protein function prediction (PROVEAN score = -12.6, threshold < -2.5 is considered deleterious) indicates that this mutation will significantly disrupt the tertiary structure of the DELLA domain, hindering the GID1-DELLA interaction, thereby leading to abnormal gibberellin signal transduction and ultimately causing a dwarf phenotype in the plant. Based on this, the mutant was officially named ΔN-D9 (Δ represents a deletion mutation and N represents the N-terminal functional domain). The results of the target sequence mutation type analysis are shown in Figure 2 .

[0066] SEQ ID NO.2 (D9 gene mutant DNA sequence):

[0067] SEQ ID NO.6 (wild-type amino acid sequence of D9 gene): .

[0068] 4. Development and validation of co-dominant molecular markers 1) To establish a rapid and reliable genotyping system, a co-dominant inDel molecular marker was developed based on the Δ28 bp deletion site. This marker, generated by amplification with the primer pair D9-genotyping-F / R, exhibits significant length polymorphism between the wild-type and mutant amplification products. The wild-type KN5585 amplification product is 153 bp in length, as the target sequence is intact. However, the amplification product of the ΔN-D9 mutant is shortened to 125 bp due to the 28 bp deletion.

[0069] 2) Molecular marker specificity verification PCR amplification was performed using genomic DNA from the wild type, the homozygous ΔN-D9 mutant, and the heterozygous line (BC1F1 generation of KN5585 × ΔN-D9) as templates. Reaction conditions were: 94°C for 5 min; 35 cycles (94°C for 30 s, 60°C for 30 s, 72°C for 20 s); and 72°C for 5 min. Electrophoresis on a 1% agarose gel (containing GelRed nucleic acid dye) revealed that only a 153 bp band was present in the wild type. Figure 5 Lanes 2 and 3 of the Figure 2A), the mutant showed only a 125 bp band ( Figure 5 Lane 4), while the BC1F1 generation heterozygote showed two bands at the same time ( Figure 5 5), indicating that the marker has a codominant characteristic and can accurately distinguish the three genotypes.

[0070] 3) Labeling sensitivity test A gradient dilution of template DNA (10 ng to 0.1 ng) revealed a minimum detection limit of 1 ng (clearly visible bands). A mixed template experiment (wild-type:mutant DNA in a 1:1 ratio) showed no nonspecific bands, demonstrating excellent primer specificity. This marker has been successfully applied to genotype screening of a 1,200-plant backcross population (BC1F2), achieving a 98.7% concordance rate with phenotypes (plant height and internode length), providing technical support for marker-assisted selection (MAS).

[0071] Example 3 Analysis of plant height and agronomic traits of mutant materials To systematically analyze the effects of the ΔN-D9 mutation on maize growth and development, we conducted a field experiment at the Sanya Experimental Base in Hainan (18°14'N, 109°31'E). A randomized block design was used in the experimental field, with three genotypes assigned: wild-type KN5585, homozygous ΔN-D9 mutant, and heterozygous BC1F1. The planting density was 4,000 plants per mu. After sowing, conventional water and fertilizer management was implemented (basal fertilizer: 600 kg / ha of compound fertilizer; topdressing: 300 kg / ha of urea during the jointing stage).

[0072] 1. Construct a phenotypic observation system to record growth period parameters, plant type parameters, and yield parameters.

[0073] Pollen shedding period: The development of the tassel was observed from 09:00 to 11:00 every day. When the anthers in the middle and upper parts of the tassels of 50% of the plants were exposed and yellow pollen was shed, it was recorded as the pollen shedding period (R1 stage).

[0074] Plant height and ear height: Seven days after silking (R2 stage), the vertical heights from the base of the main stem (ground surface) to the top of the tassel (plant height) and to the uppermost node of the female ear (ear height) were measured using a laser altimeter (TruPulse 360R).

[0075] Ear length: During the harvest period, fully pollinated female ears were selected and the straight-line length from the base to the top of the ear (ear length) was measured using a digital vernier caliper.

[0076] 2. Phenotypic Data Analysis 1. Plant height and ear height The plant height of the ΔN-D9 mutant was significantly reduced compared to the wild type, with a decrease of 29.9% ( Figure 3 A and Figure 4 The ear height decreased significantly, with a drop of 39.6%. P <0.001), showing a typical dwarf and compact plant type ( Figure 3 The plant height and ear height of the BC1F1 heterozygote decreased by 14.8% and 20.5%, respectively, which is about 50% of that of the mutant, consistent with the semi-dominant inheritance characteristics ( t test, P <0.05).

[0077] 2. The pollen shedding period of the mutant was 0.6 days earlier than that of the wild type (wild type: 60.93±1.67 days, mutant: 60.33±1.1 days), but the difference did not reach a significant level ( P = 0.12, ANOVA). See Figure 3 C in.

[0078] 3. The spike length of the mutant was reduced by 11.3% compared with the wild type ( P <0.05, but the spike length of BC1F1 had no significant difference with that of wild type ( P =0.24). See Figure 3 D and Figure 4 .

[0079] Specific phenotypic statistical results are shown in Tables 2 to 5.

[0080] Table 2 Table 3 Table 4 Table 5 During the variety breeding process, the semi-dominant dwarfing trait can be easily identified and selected in the field, showing the great potential of this material in industrial application.

[0081] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. A method for reducing corn plant height, characterized in that: Make corn contain ZmD9 Mutated gene or protein encoded by it; ZmD9 mutant gene, wild type ZmD9 The nucleotide sequence of the gene is a reference sequence, which contains a mutation in which bases 64 to 91 of the CDS region are deleted.

2. The method according to claim 1, characterized in that described ZmD9 The mutant gene has a nucleotide sequence as shown in SEQ ID NO.

2.

3. The method according to claim 1 or 2, characterized in that Through gene knockout, hybridization, backcrossing, self-pollination or asexual reproduction, corn contains ZmD9 Mutated gene.

4. A ZmD9 The mutant gene is characterized by As described in claim 1 or 2.

5. The protein encoded by the mutant gene according to claim 4.

6. A biological material comprising the mutant gene according to claim 4, wherein the biological material is an expression cassette, a vector or a host cell.

7. Use of the mutant gene according to claim 4, the protein according to claim 5, or the biological material according to claim 6 in regulating plant height and / or ear height.

8. The use according to claim 7, characterized in that The plant is corn.

9. Use of the mutant gene according to claim 4, the protein according to claim 5, or the biological material according to claim 6 in improving corn germplasm resources.

10. A method for identifying whether corn contains ZmD9 A method for mutating a gene, characterized in that include: (1) Extracting DNA from the corn to be identified; (2) Using the DNA extracted in step (1) as a template, perform PCR amplification using a primer combination; If the length of the amplified fragment is 125 bp, it is determined that the corn to be identified contains ZmD9 Mutated genes; The primer combination has the sequences shown in SEQ ID NOs. 4 and 5; described ZmD9 The mutant gene is as described in claim 4.

Images