Rice sheath blight resistance related gene as well as encoding protein and application thereof

By identifying and regulating the expression of OsSBR4 gene in rice, the problem of preventing and treating rice streak blight is solved, and efficient genetic engineering methods are provided to enhance or reduce rice's resistance to streak blight, and the breeding application value is significant.

CN120464641APending Publication Date: 2025-08-12HUAZHONG AGRI UNIV
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510669719.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2025-08-12

AI Technical Summary

Technical Problem

The existing technology is difficult to effectively prevent and control rice streak blight. Chemical control is harmful to the environment and is costly, and lacks efficient genetic engineering methods.

Method used

By identifying and utilizing rice OsSBR4 genes, its expression in rice is enhanced or weakened by genetic engineering, and its resistance to striatal blight is regulated, including gene knockout and overexpression, using the CRISPR/Cas9 vector and the overexpression vector pCAMBIA1301.

Benefits of technology

It significantly enhances or reduces the resistance of rice to striae blight, provides a genetically modified rice variety that resists striae blight, and has basically not affected agronomic traits, providing a theoretical basis for breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464641A_ABST
    Figure CN120464641A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of plant genetic breeding, in particular to a rice sheath blight resistance related gene and an encoding protein and application thereof. The invention provides a rice sheath blight resistance related gene as well as an encoding protein and application thereof, the gene is OsSBR4 or a related gene thereof, the resistance of rice to sheath blight can be remarkably enhanced by knocking out the gene, and the resistance of rice to sheath blight can be reduced by overexpressing the gene. After agronomic traits of a transgenic line of the gene are investigated, it is found that the plant height, the ear length, the ear number, the thousand seed weight and the like are not affected, and it is indicated that the gene has important application value in sheath blight resistance molecular breeding. According to the invention, a novel rice sheath blight resistance related gene is screened and excavated, and the identification of the sheath blight resistance gene can provide a theory and a basis for breeding a sheath blight resistance rice variety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic breeding, and in particular to rice sheath blight resistance-related genes, encoded proteins and applications thereof. Background Art

[0002] Rice, one of the world's major food crops, is known as "the food of life." During its growth, rice is susceptible to a variety of pathogens, particularly sheath blight, caused by the soil-borne necrotic fungus Rhizoctonia solani, which causes significant losses to global agriculture. Due to its wide host range and high genetic variability, no viable rice germplasm resources with high resistance to sheath blight have been identified. Rice sheath blight is a serious fungal disease widely distributed in rice-growing areas worldwide. Sheath blight can occur throughout the rice plant's growth cycle, with its most severe effects during the tillering and heading stages. When infected, it damages rice leaves, leaf sheaths, and even panicles, causing them to wilt, reduce seed set, and ultimately affect rice quality and yield. Sheath blight primarily spreads at night and during high humidity, temporarily ceasing infection during the day and when humidity is low. In the early stages of R. solani infection of rice, small, dark green, water-soaked spots can be observed on the leaf sheaths near the water surface. Approximately 7-14 days after inoculation, the condition worsens, with multiple spots connecting and merging into larger ones, eventually forming cloud-like spots with brown edges and a grayish-white center. Under high temperature and high humidity, when infected with R. solani, the spots rapidly expand and connect across the leaf sheaths. In severe cases, they can extend to the flag leaf and panicle, disrupting nutrient supply to the panicle, resulting in white panicles and a large number of empty, barren grains, severely impacting rice yield.

[0003] Currently, the main method for controlling rice sheath blight is chemical control. However, spraying chemical fungicides in the field can cause irreversible environmental damage, and some cultivation and management measures can significantly increase costs. Creating transgenic rice resistant to sheath blight through genetic engineering could address these issues.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] In order to solve the above technical problems, the present invention provides genes related to rice sheath blight resistance, their encoded proteins and applications.

[0006] Specifically, the technical solution of the present invention is as follows: In the first aspect, the present invention provides a gene for regulating rice disease resistance, wherein the gene is selected from at least one of the following (a), (b), and (c): (a), the nucleotide sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2 OsSBR4 Gene; (b), same as (a) OsSBR4The nucleotide sequence of the gene has a nucleotide sequence with more than 90% similarity; (c) can be described in (a) OsSBR4 Genes are hybridized and have regulatory OsSBR4 The nucleotide sequence of a gene's active function.

[0007] Preferably, the gene has the ability to directly or indirectly regulate rice disease resistance.

[0008] Preferably, the rice disease resistance is resistance to sheath blight.

[0009] In a second aspect, the present invention provides a protein for regulating rice disease resistance, which is encoded by the gene for regulating rice disease resistance described in the first aspect and has the same rice disease resistance regulating ability as the gene for regulating rice disease resistance.

[0010] Preferably, the amino acid sequence of the protein regulating rice disease resistance is shown as SEQ ID NO.3.

[0011] In a third aspect, the present invention provides a type of biological material, which contains the gene for regulating rice disease resistance as described in the first aspect and has the ability to express the gene for regulating rice disease resistance.

[0012] Preferably, the biological material is an overexpression vector, or a recombinant microorganism or a transgenic plant cell line containing the overexpression vector.

[0013] More preferably, the overexpression vector is OsSBR4 The CDS sequence of the gene was amplified, connected to the overexpression vector pCAMBIA1301, and obtained after transformation and plasmid extraction.

[0014] In a fourth aspect, the present invention provides another type of biomaterial, which is a gene knockout vector, or a recombinant microorganism or transgenic plant cell line containing the gene knockout vector; the gene knockout vector includes a target sequence and a CRISPR / Cas9 vector; the nucleotide sequence of the target sequence is the sequence shown in SEQ ID NO.4 and / or SEQ ID NO.5.

[0015] In a fifth aspect, the present invention provides the use of the aforementioned gene for regulating rice disease resistance, the aforementioned protein for regulating rice disease resistance, or the aforementioned biological material in regulating rice disease resistance.

[0016] Preferably, the application includes at least one of the following: (1) Knockout in rice OsSBR4 Genes to improve resistance to sheath blight in rice.

[0017] (2) Overexpression in rice OsSBR4Genes to reduce resistance to sheath blight in rice.

[0018] In a fifth aspect, the present invention provides the use of the aforementioned gene regulating rice disease resistance, the aforementioned protein regulating rice disease resistance, or the aforementioned biological material in cultivating rice germplasm with enhanced resistance to sheath blight.

[0019] In a sixth aspect, the present invention provides a method for transgenic rice, comprising: enhancing or reducing the expression of OsSBR4 The expression level and / or activity of the protein encoded by the gene is increased to obtain transgenic rice, wherein the disease resistance of the transgenic rice is lower / higher than that of the recipient rice. Beneficial effects

[0020] The present invention provides a rice sheath blight resistance related gene and its encoding protein and application, wherein the gene is OsSBR4 Knocking out this gene, or its associated gene, significantly enhances rice resistance to sheath blight, while overexpressing it reduces resistance. A survey of agronomic traits in transgenic lines carrying this gene revealed that plant height, panicle length, panicle number, and 1000-grain weight were unaffected, indicating that this gene has important application value in molecular breeding for sheath blight resistance. This invention screened and discovered new genes associated with rice sheath blight resistance. The identification of these resistance genes can provide a theoretical basis for breeding rice varieties resistant to sheath blight. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.

[0022] Figure 1 for OsSBR4 Expression levels of overexpression material lines OE-1, OE-2, and OE-3.

[0023] Figure 2 for OsSBR4 Detailed diagram of the knockout targets of the knockout material lines Cri-1, Cri-2, and Cri-3.

[0024] Figure 3 for OsSBR4 Statistical chart of agronomic traits of the control and its transgenic materials: plant height, ear length, number of ears, and 1000-grain weight.

[0025] Figure 4 for OsSBR4 The control and transgenic materials were photographed, and the scale bar is 5 cm.

[0026] Figure 5 for OsSBR4 Figure 1. Detached leaves of the control and transgenic materials inoculated with sheath blight.

[0027] Figure 6 for OsSBR4 Statistical graph of sheath blight inoculated on detached leaves of the control and its transgenic materials.

[0028] Figure 7 for OsSBR4 The control and its transgenic materials were inoculated with sheath blight and photographed. The scale bar is 1 cm.

[0029] Figure 8 for OsSBR4 Statistical chart of the control and its transgenic materials inoculated with sheath blight. DETAILED DESCRIPTION

[0030] The present invention aims to provide a gene for negatively regulating rice resistance to sheath blight OsSBR4 , which can be used to cultivate rice varieties resistant to sheath blight.

[0031] In order to achieve the above object, the present invention provides a gene that negatively regulates rice sheath blight OsSBR4 , the gene OsSBR4 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the CDS sequence of the gene is shown in SEQ ID NO.2.

[0032] The present invention utilizes the gene to regulate the resistance to sheath blight by means of genetic engineering, thereby solving the problem of difficulty in preventing and controlling sheath blight.

[0033] Further, for amplifying the gene OsSBR4 The primer pairs are: OsSBR4-CDS-F:5'-ATGGGACCTGTGCTGCTGTG-3' (SEQ ID NO.6); OsSBR4-CDS-R: 5'-GCGCGGTAGATCTGTCCAAG-3' (SEQ ID NO. 7).

[0034] The present invention also provides a negative regulation rice sheath blight resistance gene OsSBR4 Encoded protein, vector and application.

[0035] The rice sheath blight regulating gene of the present invention OsSBR4 The amino acid sequence of the encoded protein is shown in SEQ ID NO.3.

[0036] The present invention provides a negative regulation rice sheath blight gene OsSBR4 Furthermore, the gene knockout vector construction method comprises designing and identifying the sgRNA of the target site, enzymatically ligating the sgRNA to the pRC6b vector, and then transforming the sgRNA by Agrobacterium to obtain the gene knockout vector Cri-OsSBR4.

[0037] The present invention provides a negative regulation rice sheath blight gene OsSBR4 The overexpression vector OE-OsSBR4 is further constructed by inserting the gene OsSBR4 After amplification, enzyme digestion and ligation into the pCAMBIA1301 vector, the overexpression vector OE-OsSBR4 was finally obtained through transformation of Escherichia coli and Agrobacterium.

[0038] The present invention provides the gene for regulating sheath blight OsSBR4 Or the use of the protein, the gene knockout vector or the overexpression vector in cultivating rice germplasm resources resistant to sheath blight.

[0039] The present invention provides a method for cultivating transgenic rice with increased or decreased resistance to sheath blight, comprising increasing or decreasing the resistance of the recipient rice to sheath blight. OsSBR4 The expression level or activity of the protein encoded by the gene is increased to obtain transgenic rice, wherein the disease resistance of the transgenic rice is lower / higher than that of the recipient rice.

[0040] The disease resistance of the transgenic rice is higher / lower than that of the recipient rice, which is reflected in that the length of the sheath blight lesions of the transgenic rice is lower / higher than that of the recipient rice.

[0041] Wherein, the method for increasing or decreasing the expression level and / or activity of the OsSBR4 protein in the recipient rice is achieved by overexpressing or knocking out the gene encoding the OsSBR4 protein in the recipient rice.

[0042] Furthermore, the present invention also provides a method for cultivating transgenic rice with reduced / increased resistance to sheath blight and its application in creating new disease-resistant rice germplasm.

[0043] In the present invention, the rice variety mentioned above may specifically be G46B.

[0044] The present invention identifies a gene through reverse genetics OsSBR4 (LOC_Os04g03830), encoding a cell wall-associated protein kinase, is located on rice chromosome 4. The CDS sequence is 2022 bp long and encodes 673 amino acids. OsSBR4 Negative regulation of rice resistance to sheath blight, i.e. knockout OsSBR4 The gene significantly enhances rice resistance to sheath blight, while overexpression OsSBR4 These results indicate that OsSBR4 As a negative regulatory gene, it has important application potential in rice disease resistance molecular breeding.

[0045] In the applications described herein, the disease resistance may be resistance to sheath blight; the regulation may be specifically embodied in that when the OsSBR4 protein in a plant is inactivated, the plant's resistance to sheath blight and bacterial blight increases; and when the OsSBR4 protein content in a plant is increased, the plant's resistance to sheath blight decreases. Specifically, the plant breeding may be the creation of new rice varieties resistant to sheath blight.

[0046] In the above method, the reduction of OsSBR4 The main steps of gene expression and / or activity are preferably as follows: (1) Obtaining the target gene fragment. In the present invention, the target fragments of all candidate genes are amplified by PCR technology from the gene corresponding to the G46B cDNA. (2) Connecting the target gene fragment to the intermediate (cloning) vector; (3) Selecting positive clones and confirming by sequencing; Mixing the positive clone plasmid and the final vector plasmid for recombination reaction; (4) PCR and plasmid enzyme digestion to verify the positive clone; (5) The recombinant positive plasmid is transferred into Agrobacterium; (6) Verification and preservation of positive Agrobacterium single clones. During the experimental operation, the extraction of total RNA was selected from the leaves of G46B rice plants according to the Trizol method (TianGen); the synthesis of total cDNA was carried out using the HiScript II One Step RT-PCR Kit (Vazyme); the receptor rice was enhanced. OsSBR4 Gene expression and / or activity were obtained by amplification using high-fidelity DNA polymerase OsSBR4 The CDS sequence of the gene was expressed and the target gene was introduced into the overexpression vector pCAMBIA1301 driven by a strong promoter via Kpn Ⅰ and BamH Ⅰ.

[0047] In summary, the present invention discloses a method for regulating rice disease resistance genes OsSBR4 and its encoded protein and application, the gene is OsSBR4 The present invention identifies a new rice sheath blight regulatory gene. OsSBR4 ,right OsSBR4 The gene was overexpressed and knocked out, and the knockout was found after resistance identification OsSBR4 The gene can enhance the resistance of rice to sheath blight, while overexpression of the gene can reduce the resistance of rice to sheath blight. OsSBR4 The discovery that the gene negatively regulates rice's resistance to sheath blight not only provides new ideas and directions for breeding more disease-resistant rice varieties, but also lays a solid foundation for further exploration in the field of disease-resistant rice breeding.

[0048] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention are described clearly and completely below. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are also within the scope of protection of the present invention.

[0049] The endpoints and any values of the ranges disclosed in this specification are not limited to the exact ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of each range, the endpoint values of each range and the individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be considered to be specifically disclosed herein.

[0050] In the description of this specification, the reference terms "one embodiment", "some embodiments", "specific implementation methods", or "some specific implementation methods" and the like mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the embodiments of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0051] Unless otherwise specified, the materials and reagents used in the following examples are all commercially available. Experimental methods without specific conditions specified in the examples are generally performed under conventional conditions or the conditions recommended by the manufacturer.

[0052] The sequences involved in the following embodiments include: SEQ ID NO.1( OsSBR4 Nucleotide sequence 9387bp):

[0053] SEQ ID NO.2( OsSBR4 CDS sequence 2022 bp):

[0054] SEQ ID NO.3 (OsSBR4 protein sequence, 673 AAs): MGPVLLCLAIAAATAVCAASSGAPPSPDAAAVAVGSCPTYSGSGYSSASDGGNQEEYDPNKENPCKRSCGSMPIPFPFALLSACSGSNRFLLNCTSNKTLIGIPPAQYQVINISLDDGVLFVNKHSNLGDIITTPTVANELHDFDFSGSQGIWRWAVANQTCHTARTDQLSYACVSNNSLCVDRSTGYHCKCSLGYGGNAYIEDGCEDIDECSLPNFCNGNCQNFLGSYRCSHCPRGSIFDPAKRVCIYGHGLHPAGLLIGLSCGIGVLFLVVGLILFVRRWRRHMQRKIRREYFQKNKGLLLEQLMLSDENVAHDPKIFSLEELEKATDNFHSTRILGCGGHGTVYKGILLDQRVVAIKKSRIVEQNEIDQFINEVAILSQIVHRNVVKLFGCCLESKVPLLVYEFISNGTLYDLLHGEQSTTFSLTWEDSIRISLEVASALSYLHSAASIPIFHRDVKSANILLNDNYTSKVSDFGASRSISIDETRVVTIVQGTFGYLDPEYFHTCQLTEKSDVYSFGVILVEILTRKKPIIVNCFGENQNLGHCFLQTLQHGTIMEIVDPQIAKEANESEINEMASLAEICLRIRGEERPKMKEVELRLQLLRAMITERSRQELLRNNGIGPSVQSNSSTTSVTRSVVLRAGIGISTDQDATRCYTMEQELVSWTDLPR。

[0055] SEQ ID NO.4 ( OsSBR4 Target sequence for knockout vector construction) Target1: GAGCCACATGACCGTTTACA。

[0056] SEQ ID NO.5 ( OsSBR4 Target sequence for knockout vector construction) Target2: GTGTTGTGATGATATCTCCA。

[0057] The conventional rice variety in the present invention is G46B, the sheath blight fungus YN-7 used is a known pathogen, the overexpression vector pCAMBIA1301 is a known vector, and the vectors pGLU6a and pRC6b used to construct the knockout material are known vectors, all of which are from our laboratory. Example 1

[0058] OsSBR4 Cloning of the gene CDS region.

[0059] G46B seeds were grown into seedlings, and total RNA was extracted from G46B leaves using the Trizol method (Invitrogen). Total cDNA was synthesized using the HiScript II One Step RT-PCR Kit (Vazyme).

[0060] Design primers based on sequence information: OsSBR4-CDS-F:5'-ATGGGACCTGTGCTGCTGTG-3' (SEQ ID NO.6); OsSBR4-CDS-R: 5'-GCGCGGTAGATCTGTCCAAG-3' (SEQ ID NO. 7).

[0061] The gene was cloned using G46B cDNA as a template.

[0062] Rice of the present invention OsSBR4 The nucleotide sequence of the gene CDS is shown in SEQ ID NO.2, and the amino acid sequence encoded by it is shown in SEQ ID NO.3. Example 2

[0063] Vector construction, genetic transformation and detection.

[0064] 1. Rice OsSBR4 Steps for constructing a CRISPR / Cas9 knockout vector for a gene: exist OsSBR4 Select target gene sites in the full-length sequence and design primers to select target sites with high knockout efficiency: Target1: 5'-GAGCCACATGACCGTTTACA-3' (SEQ ID NO.4); Target2: 5'-GTGTTGTGATGATATCTCCA-3' (SEQ ID NO. 5).

[0065] Design primers for target sites: OsSBR4-T1-F: GTTGGAGCCACATGACCGTTTACA (SEQ ID NO.10); OsSBR4-T1-R:AAACGAGCCACATGACCGTTTACA(SEQ ID NO.11); OsSBR4-T2-F: GCCGGTGTTGTGATGATATCTCCAGTTTT (SEQ ID NO. 12); OsSBR4-T2-R: CTCTAAAAC GTTGTTGTGATGATATCTCCA (SEQ ID NO. 13).

[0066] Preparation of exogenous fragment gRNA2-LacZ-P U6a Before target primer synthesis, restriction enzyme Bsa I enzyme digested pGLU6a, ran on 1%-1.5% agarose gel, and used a DNA purification kit to recover the exogenous fragment gRNA2-LacZ-P U6a After the concentration was measured by NanoDrop2000, it was stored at -20℃ for future use.

[0067] Linearize the vector. Bsa I linearized pRC6b and inactivated it for later use. The enzyme digestion system was: 3 μg of vector, 5 μl of 10 × Cutsmart Buffer, 30 U Bsa I, add ddH2O to 50 μl, and digest at 37℃ for 1 h.

[0068] Prepare target adapters. After target primer synthesis, dissolve each target primer in ddH2O to a 100 μmol / L stock solution. Add 1 μl of each target primer to 98 μl of ddH2O and dilute to 1 μmol / L. Denature at 90°C for 30 seconds, then cool to room temperature to complete annealing.

[0069] Ligation reaction. 0.2 μl target primer (concentration of 1 μmol / L), 15 ng exogenous fragment gRNA2-LacZ-P U6a and 80 ng Bsa I linearized vector pRC6b and ligated with NEB T4 DNA ligase in a 20 μl reaction system (2 μl 10× NEB T4 DNA ligase buffer, 80 U T4 DNA ligase). PCR was performed at 10°C for 5 min and 20°C for 5 min for 10-15 cycles.

[0070] The ligation product from the previous step was added to a competent DH5α Escherichia coli strain and transformed using the heat shock method. After thawing on a shaker at 37°C for 1 hour, the cells were plated onto LB plates containing kanamycin and incubated at 37°C for 1 day. Four single colonies were randomly selected from the plates and placed into 2 mL sterile EP tubes. 800 μL of liquid LB supplemented with kanamycin was added and shaken for 1 day. The plasmids were then extracted and verified by sequencing. Recombinant positive plasmids were transformed into Agrobacterium tumefaciens EHA105 using a system consisting of 20 μL of Agrobacterium (EHA105) plus 1 μL of plasmid, placed on ice for 5 minutes, snap-frozen in liquid nitrogen for 5 minutes, then water-bathed at 37°C for 5 minutes, and then placed on ice for 5 minutes. 100 μL of antibiotic-free LB was added and the cells were shaken at 200 rpm at 28°C for 2 hours. The cells were then directly plated onto kanamycin-containing plates and incubated at 28°C for two days.

[0071] Verification of positive Agrobacterium monoclones: After two days, a single clone was picked and placed in a 2ml sterile EP tube. 800 μL of the corresponding bacterial antibiotic was added in advance and cultured overnight on a shaking table. The bacterial solution was sent for sequencing the next day. After the sequencing feedback was correct, the prepared Agrobacterium Cri-OsSBR4 could be used for the subsequent transformation experiment. The conventional japonica rice variety G46B callus was transformed using the Agrobacterium-mediated method and screened with hygromycin to obtain transgenic seedlings. Three transgenic lines were selected for sequencing verification and named Cri-1, Cri-2, and Cri-3 ( Figure 2 ).

[0072] 2. The steps for constructing the overexpression vector are as follows: Primers were designed using the cDNA in Example 1: OsSBR4-OE-F: ttacgaacgatagccggtaccATGGGACCTGTGCTGCTGTG (SEQ ID NO. 8); OsSBR4-OE-R: caggtcgactctagaggatccGCGCGGTAGATCTGTCCAAG (SEQ ID NO. 9).

[0073] The gene was cloned using G46B cDNA as a template and amplified using high-fidelity DNA polymerase. OsSBR4 The CDS sequence of the protein is shown in SEQ ID NO.2, and the amino acid sequence is shown in SEQ ID NO.3.

[0074] The PCR amplification system was as follows: DNA 1 μL, 2×KOD×PCR buffer 10 μL, 2 mM dNTPs 2 μL, OsSBR4-OE-F / OsSBR4-OE-R 0.2 μL each, KOD (1 U / μL) 0.3 μL, and ddH2O 6.3 μL.

[0075] The PCR reaction program was as follows: 94°C, 2 min, 1 cycle; 98°C, 10 sec, 55°C, 30 sec, 72°C, 2 min, 30 cycles; 72°C, 1 min, 25°C, 1 min, 1 cycle.

[0076] After the PCR product was confirmed to be of correct size by agarose gel electrophoresis, it was recovered by digging the gel using a DNA recovery kit (FastPureGel DNA Extraction Mini Kit). Kpn Ⅰ and Bam H Ⅰ double enzyme digestion reaction, after agarose electrophoresis detection of complete enzyme digestion, sodium acetate method recovery and purification, the target gene and the linearized vector after enzyme digestion were connected by homologous recombination enzyme (ClonExpress II One Step Cloning Kit reagent from Novozymes). The connected product was introduced into Escherichia coli competent DH5α, and positive plaques were selected on LB medium containing kanamycin and sequenced. After the alignment was correct, the OsSBR4-OE vector was successfully constructed. The above-mentioned plant expression vector was transformed into the rice variety G46B through the above-mentioned Agrobacterium-mediated method. Three independent T0 generation transgenic plant lines were obtained by running gels and qRT-PCR detection, named OE-1, OE-2, and OE-3 ( Figure 1 ). Example 3

[0077] Identification of sheath blight resistance in transgenic rice.

[0078] The resistance of the wild type (G46B), gene-edited knockout lines (Cri-1, Cri-2, Cri-3) and overexpression lines (OE-1, OE-2, OE-3) of this gene to sheath blight was identified using both in vitro and in vivo inoculation methods.

[0079] Cultivation of sheath blight pathogen: 1. The in vitro identification method for sheath blight resistance is as follows: In vitro leaf sampling was performed when rice plants reached the booting stage in the field. A 10-cm-long blade was cut from flag leaves of uniform growth. A 10-mm-diameter cake containing sheath blight pathogens was placed in the center of the leaf. The cake was then placed in a Petri dish containing moistened filter paper and incubated in a 28°C incubator for 3 days. Sterile water was sprayed daily for moisture retention. After 3 days, the length of the lesions was measured.

[0080] 2. The method of inoculating rice plants with sheath blight is as follows: Rice plants were planted in the field using a seed soaking and germination method. Five plants of each material were planted. Plants that had naturally developed disease, died, and had small or redundant tillers were pruned before inoculation. Inoculation was performed manually using the toothpick insertion method. A toothpick containing cultured mycelium of Rhizoctonia solani YN-7 (sufficiently covered with mycelium) was carefully placed between the sheath and stem of the third fully expanded leaf from the top. Three stems of relatively consistent growth stages were inoculated per seedling. Lesion length was measured 7 days after inoculation.

[0081] 3. When using rice in vitro inoculation of sheath blight, if Figure 5 and Figure 6 The average lesion lengths of the three transgenic overexpression lines (9.13 cm, 9.5 cm, and 8.7 cm, respectively) were significantly higher than those of the wild type (6.1 cm) ( Figure 6 A), the average lesion lengths of the three gene-edited lines (2.7 cm, 3.18 cm, and 1.65 cm, respectively) were significantly lower than those of the wild type (6.1 cm) ( Figure 6 B).

[0082] 4. When using live rice plants to inoculate sheath blight, if Figure 7 and Figure 8 The average lesion lengths of the three transgenic overexpression lines (4.19 cm, 4.38 cm, and 4.52 cm, respectively) were significantly higher than those of the wild type (2.75 cm) ( Figure 8 A), the average lesion lengths of the three gene-edited lines (2.7 cm, 3.18 cm, and 1.65 cm, respectively) were significantly lower than those of the wild type (26.26 cm) ( Figure 8 B) These results indicate that the gene OsSBR4 Negative regulation of rice sheath blight resistance can be achieved by knocking out OsSBR4 The gene significantly improves rice's resistance to sheath blight. Example 4

[0083] Statistics of agronomic traits of OsSBR4 transgenic materials and controls.

[0084] When the rice reached maturity, five consecutive individual plants with consistent growth in the middle of each plot were selected to examine agronomic traits, including plant height, number of panicles, panicle length, and 1000-grain weight. The phenotypic values of each trait were entered using Excel. After checking the accuracy of the data, a one-way analysis of variance was performed to obtain the differences between the phenotypic groups of the experimental and control groups. GraphPad Prism 8 was used to statistically analyze the phenotypes and visualize the differences. Figure 3 and Figure 4As shown, some agronomic traits (plant height, panicle length, panicle number, and 1000-grain weight) were not significantly different between the overexpression and knockout transgenic materials and the G46B control. These results indicate that OsSBR4 does not affect agronomic traits in rice during its participation in rice sheath blight resistance, and thus has great potential breeding value.

[0085] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A gene for regulating disease resistance in rice, characterized in that: The gene is selected from at least one of the following (a), (b), and (c): (a), the nucleotide sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2 OsSBR4 Gene; (b), same as (a) OsSBR4 The nucleotide sequence of the gene has a nucleotide sequence with more than 90% similarity; (c) can be described in (a) OsSBR4 Genes are hybridized and have regulatory OsSBR4 The nucleotide sequence of a gene's active function.

2. The gene for regulating rice disease resistance according to claim 1, characterized in that: The gene has the ability to directly or indirectly regulate rice disease resistance; Preferably, the rice disease resistance is resistance to sheath blight.

3. A protein for regulating disease resistance in rice, characterized in that: It is encoded by the gene regulating rice disease resistance according to claim 1 and has the same rice disease resistance regulating ability as the gene regulating rice disease resistance.

4. The protein for regulating rice disease resistance according to claim 3, characterized in that Its amino acid sequence is shown in SEQ ID NO.

3.

5. Biomaterial, characterized in that The biological material contains the gene for regulating rice disease resistance according to claim 1 and has the ability to express the gene for regulating rice disease resistance; Preferably, the biological material is an overexpression vector, or a recombinant microorganism or transgenic plant cell line containing the overexpression vector; More preferably, the overexpression vector is OsSBR4 The CDS sequence of the gene was amplified, connected to the overexpression vector pCAMBIA1301, and obtained after transformation and plasmid extraction.

6. Biomaterial, characterized in that The biological material is a gene knockout vector, or a recombinant microorganism or transgenic plant cell line containing the gene knockout vector; characterized in that the gene knockout vector comprises a target sequence and a CRISPR / Cas9 vector; the nucleotide sequence of the target sequence is the sequence shown in SEQ ID NO.4 and / or SEQ ID NO.

5.

7. Use of the gene regulating rice disease resistance according to claim 1 or 2, the protein regulating rice disease resistance according to claim 3 or 4, or the biological material according to claim 5 or 6 in regulating rice disease resistance.

8. The application according to claim 7, characterized in that: The application includes at least one of the following: (1) Knockout in rice OsSBR4 Genes to improve sheath blight resistance in rice; (2) Overexpression in rice OsSBR4 Genes to reduce resistance to sheath blight in rice.

9. Use of the gene regulating rice disease resistance according to claim 1 or 2, or the protein regulating rice disease resistance according to claim 3 or 4, or the biomaterial according to claim 5 or 6 in cultivating rice germplasm with enhanced resistance to sheath blight.

10. A method for transgenic rice, characterized in that: include: Enhance or reduce the receptor rice OsSBR4 The expression level and / or activity of the gene-encoded protein are controlled to obtain transgenic rice.

Citation Information

Cited By

  • OsLRK19 gene and application thereof in enhancing sheath blight resistance of rice

    CN119913176A

  • OsLRK19 gene and its application in enhancing rice resistance to sheath blight

    CN119913176B