Monocotyledon anti-glufosinate-ammonium herbicide gene, protein, method and application

Abstract

The invention discloses a monocotyledon anti-glufosinate-ammonium herbicide gene, a protein, a method and application, the nucleotide sequence of the monocotyledon anti-glufosinate-ammonium herbicide gene is shown as SEQ ID NO.1, the mutation site of the gene is single base substitution, and the position of the mutation site is LOCOs04g56170 gene; the amino acid sequence coded by the nucleotide sequence SEQ ID NO. 1 is as shown in SEQ ID NO. 2. A new rice germplasm resistant to glufosinate-ammonium herbicide is obtained through experiments, by spraying glufosinate-ammonium, it is confirmed that rice containing the mutant protein has glufosinate-ammonium resistance after glufosinate-ammonium is applied, and the conservative property of the mutant protein is verified in a hybridization mode.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a monocotyledonous plant glufosinate-resistant herbicide gene, protein, method and application. Background Art With the increasing labor costs of rice cultivation, direct-seeding rice cultivation has been widely promoted. However, because rice seeds and weed seeds often germinate simultaneously during direct-seeding rice cultivation, weed pressure in direct-seeded rice fields is greater than with conventional transplanting. This increased weed pressure, in turn, requires more manpower and time, creating a serious conflict. Furthermore, because weeds compete with rice for resources such as light and nutrients, uncontrolled weeds can lead to significant yield reductions. Herbicides are widely used in various crop applications because they can quickly kill weeds, significantly saving the time and labor of manual weeding. Among these, glufosinate can inhibit the activity of glutamine synthetase in plants, leading to the accumulation of ammonia, which can be cytotoxic and hinder photosynthesis, ultimately causing plant death. Compared to other herbicides, glufosinate offers advantages such as rapid onset of action, high safety, low resistance, and wide applicability, thus promising a promising market. However, most rice varieties are not resistant to glufosinate. Therefore, cultivating varieties with resistance to glufosinate ammonium is of great significance to the current situation of the continuous expansion of direct-seeded rice area. Summary of the Invention

[0002] The purpose of the present invention is to provide a monocotyledonous plant glufosinate herbicide resistance gene, protein, method and application.

[0003] To achieve the above object, the technical solution provided by the present invention is: A monocotyledonous plant glufosinate herbicide resistance gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.

[0004] The mutation site of this gene is a single base substitution, and the mutation site is located in the LOC_Os04g56170 gene (Os04g0656500).

[0005] A monocotyledonous plant resistant to glufosinate herbicide protein is encoded by the nucleotide sequence SEQ ID NO. 1, and its amino acid sequence is shown in SEQ ID NO. 2.

[0006] Preferably, the monocotyledonous plant is rice.

[0007] The present invention also provides a recombinant vector containing the nucleotide sequence SEQ ID NO. 1.

[0008] The present invention also provides a cell containing the nucleotide sequence SEQ ID NO. 1.

[0009] The present invention also provides an expression cassette comprising the nucleotide sequence SEQ ID NO. 1.

[0010] The present invention also provides a method for enabling monocotyledonous plants to acquire resistance to glufosinate herbicide, wherein the monocotyledonous plant is provided with the nucleotide sequence SEQ ID NO. 1 through mutagenesis or gene editing technology.

[0011] It also includes introducing the nucleotide sequence SEQ ID NO. 1 into other varieties of monocotyledonous plants through hybridization, backcrossing or asexual reproduction operations of monocotyledonous plants containing the nucleotide sequence SEQ ID NO. 1.

[0012] The present invention also provides the use of the monocotyledonous plant glufosinate herbicide resistance gene in the cultivation and auxiliary breeding of glufosinate herbicide resistance plants. Compared with the prior art, the present invention has the following beneficial effects: The present invention has obtained a new rice germplasm resistant to glufosinate herbicide through experiments. By spraying glufosinate, it is confirmed that rice containing the mutant protein of the present invention has glufosinate resistance after application of glufosinate. The present invention also verifies the conservation of the mutant protein by hybridization. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Huaidao No. 5 and gain1 Partial nucleic acid and amino acid sequences of the mutant.

[0014] Figure 2 The recommended concentration of glufosinate in the present invention was used to treat Huaidao 5 and gain1 Phenotype and biomass of mutant plants.

[0015] Figure 3 In the embodiment of the present invention gain1 Mutant tolerance concentration test. DETAILED DESCRIPTION

[0016] The above contents of the present invention are further described in detail below in the form of specific implementation methods, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following embodiments. All technologies implemented based on the above contents of the present invention belong to the scope of the present invention.

[0017] The present invention provides a monocotyledonous plant glufosinate herbicide resistance gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.

[0018] The mutation site of this gene is a single base substitution, and the mutation site is located in the LOC_Os04g56170 gene (Os04g0656500).

[0019] In a preferred embodiment, the monocotyledonous plant is rice.

[0020] In some embodiments, the present invention also provides a monocotyledonous plant glufosinate herbicide-resistant protein, encoded by the nucleotide sequence SEQ ID NO. 1, and its amino acid sequence is shown in SEQ ID NO. 2.

[0021] In some embodiments, the present invention further provides a recombinant vector comprising the nucleotide sequence SEQ ID NO.1.

[0022] In some embodiments, the present invention also provides a cell comprising the nucleotide sequence SEQ ID NO. 1.

[0023] In some embodiments, the present invention further provides an expression cassette comprising the nucleotide sequence SEQ ID NO. 1.

[0024] In some embodiments, the present invention also provides a method for enabling monocotyledonous plants to acquire resistance to glufosinate herbicide, wherein a monocotyledonous plant containing the nucleotide sequence SEQ ID NO. 1 is obtained by mutagenesis or gene editing technology.

[0025] It also includes introducing the nucleotide sequence SEQ ID NO. 1 into other varieties of the monocotyledonous plant through hybridization, backcrossing or asexual reproduction operations.

[0026] In some embodiments, the present invention also provides the use of a monocotyledonous plant glufosinate herbicide-resistant gene in the cultivation and auxiliary breeding of glufosinate herbicide-resistant plants. In one embodiment, the present invention uses EMS mutagenesis technology to obtain a stable heritable mutant, named gain1 : Using EMS to induce mutation of Huaidao No. 5, a mutant protein that makes rice resistant to glufosinate is provided. gain1 The mutant's amino acid sequence mutated from valine to methionine at position 206. Currently, there is no report that this mutation can confer glufosinate resistance in rice. The nucleic acid sequence shows that gain1 The mutant gene mutated from G to A at nucleotide position 616 in the coding region, e.g. Figure 1 The glufosinate-resistant gene obtained by the present invention belongs to a new mutation type. gain1 The mutant showed resistance to glufosinate herbicide, and rice containing the mutant protein had glufosinate resistance after glufosinate was applied at the 4-leaf seedling stage. The present invention also verified the resistance of indica rice by hybridization. gain1 Conservation of mutant proteins.

[0027] The technical solution of the present invention is further described in detail below with reference to specific embodiments: Example 1 Obtaining Glufosinate-Resistant Rice Germplasm Glufosinate, a broad-spectrum herbicide, is widely used in rice fields, but conventional rice varieties generally lack resistance to it. Huaidao No. 5, due to its wide applicability and rapid grain filling rate, was selected for EMS mutagenesis and screening to obtain new glufosinate-resistant rice germplasm.

[0028] Specifically, the present invention puts 1 kg of Huai rice No. 5 seeds into a net bag, disinfects it, and soaks it in a plastic bucket filled with clean water for 6 hours. After pouring out the clean water, drain the water as much as possible; adds 1.0% EMS solution for mutagenesis for about 12 hours, and shakes it slowly at room temperature during the period; then carefully and slowly pours the EMS solution into a container containing 5 M NaOH, washes the seeds twice with 100 mM Na2S2O3 (each time for at least 20 minutes), then pours the seeds into the NaOH solution, soaks and rinses them with clean water for about 3 hours multiple times, drains the water, and sows them in rice seedling trays; when the rice grows to the age of five leaves, transplants them to the field for planting; in the autumn of the same year, all the rice plants are mixed and harvested, threshed, dried, and then stored at low temperature; in the spring of the following year, the preserved rice seeds are taken out, and seedlings are raised in batches, and when the rice grows to the age of three leaves, 1 g / L (recommended concentration) of glufosinate-ammonium solution; after spraying, the growth of most rice was significantly inhibited, and the leaves turned yellow and withered. The present invention discovered a rice variety that is tolerant to glufosinate-ammonium and named it gain1 (Glufosinate-ammonium insensitive1) mutant, transplanted it into the field, and harvested seeds through self-pollination.

[0029] Example 2 Obtaining mutation sites The TPS method was used to extract the wild type of Huaidao 5 and gain1 Design PCR amplification primers for mutant genomic DNA: gain1 Mutant-Genomic-F: CGCGTCCTCTCTTCCATACC; gain1 Mutant-Genomic-R:CCAACTAGCCTCTTGTGGCA; Use KOD one for amplification, and the reaction procedure is: Pre-denaturation at 94°C for 2 min; 35 cycles of denaturation at 98°C for 10 s, annealing at 55°C for 10 s, and extension at 68°C for 40 s; final extension at 68°C for 5 min; and hold at 15°C.

[0030] The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0031] The sequencing results showed that gain1 The mutant underwent a point mutation in the first exon, i.e., the nucleotide at position 616 mutated from G to A. Its genomic sequence is shown in SEQ ID NO.1, resulting in the corresponding amino acid mutation from valine (V) to methionine (M). The amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0032] Example 3 Glufosinate resistance identification Select plump and clean wild-type seeds of Huaidao No. 5 and M3 generation gain1 Mutant seeds were disinfected with 30% sodium hypochlorite and then washed with sterile water. They were then incubated in the dark at 37°C for germination. When the rice seeds turned white, they were regularly placed on a float and cultured with 1 / 2 Yoshida nutrient solution until they had two leaves and one heart. They were then transferred to a 1 L small black box. When they grew to three leaves and one heart, they were sprayed with 1 g / L glufosinate solution and cultured for another two weeks. The seeds were photographed and their biomass was counted ( Figure 2 ).

[0033] The results showed that after spraying glufosinate ammonium, the growth of wild type Huaidao No. 5 was significantly inhibited and the leaves turned yellow. gain1 There was no significant difference in the biomass of the mutant compared with the unsprayed treatment, which indicated that gain1 The mutant is resistant to glufosinate ammonium.

[0034] Example 4 gain1 Identification of mutant tolerance concentration Select plump and clean wild-type seeds of Huaidao No. 5 and M3 generation gain1 Mutant seeds were disinfected with 30% sodium hypochlorite and then washed with sterile water. They were then incubated in the dark at 37°C for germination. When the rice seeds turned white, they were placed in pots. When they grew to three leaves and one heart, they were sprayed with 0 g / L, 1 g / L, 2 g / L, and 4 g / L glufosinate ammonium solutions. After two weeks of cultivation, photos were taken. Figure 3 ).

[0035] The results showed that after spraying glufosinate ammonium, the wild type of Huaidao No. 5 gradually turned yellow and died; gain1 Although the growth of the mutant was partially inhibited, it was still able to survive and its resistance concentration was 4 g / L.

[0036] Example 5 Identification of glufosinate resistance in different rice varieties To further explore gain1 The application value of the mutant in glufosinate resistance, the present invention will gain1 The mutant was hybridized with the indica rice variety 9311, and the F1 generation seeds were harvested and then backcrossed for two generations to obtain BC2F1 seeds, which were then self-pollinated to obtain gain1 BC2F2 seeds of the homozygous mutant were germinated according to the above method, and sprayed with the recommended concentration of glufosinate-ammonium solution together with 9311 wild-type plants when they had three leaves and one heart. The growth of rice was observed after two weeks of cultivation.

[0037] The results showed that after the 9311 rice was sprayed, the plants gradually died, but the gain1 The mutant plants still survived, indicating that the method has potential applications in indica rice. The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Any simple modification, equivalent substitution, or improvement made by a person skilled in the art to the above embodiments, without departing from the scope of the present invention and in accordance with the technical essence of the present invention, shall fall within the scope of protection of the present invention.

Claims

1. A monocotyledonous plant glufosinate-ammonium herbicide resistance gene, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The monocotyledonous plant glufosinate-resistant herbicide gene according to claim 1, characterized in that: The mutation site of this gene is a single base substitution, and the mutation site is located in the LOC_Os04g56170 gene.

3. The monocotyledonous plant glufosinate-resistant herbicide gene according to claim 1, characterized in that: The monocotyledonous plant is rice.

4. A monocotyledonous plant resistant to glufosinate herbicide protein, characterized in that: Encoded by the nucleotide sequence SEQ ID NO. 1 according to claim 1, its amino acid sequence is shown in SEQ ID NO.

2.

5. A recombinant vector, characterized in that: Containing the nucleotide sequence SEQ ID NO. 1 according to claim 1.

6. A cell, characterized in that: Containing the nucleotide sequence SEQ ID NO. 1 according to claim 1.

7. An expression cassette, characterized in that: Containing the nucleotide sequence SEQ ID NO. 1 according to claim 1.

8. A method for imparting glufosinate-ammonium resistance to monocotyledonous plants, characterized in that: The nucleotide sequence SEQ ID NO. 1 according to claim 1 is obtained from a monocotyledonous plant through mutagenesis or gene editing technology.

9. The method for imparting glufosinate-ammonium resistance to monocotyledonous plants according to claim 8, wherein: The method also includes introducing the nucleotide sequence SEQ ID NO. 1 into other varieties of monocotyledonous plants through hybridization, backcrossing or asexual reproduction of the monocotyledonous plant containing the nucleotide sequence SEQ ID NO. 1 according to claim 1.

10. Use of the monocotyledonous plant glufosinate herbicide resistance gene according to claim 1 in the cultivation and auxiliary breeding of glufosinate herbicide-resistant plants.

Images