Application of rice OsbHLH083 gene in regulation and control of seed germination capability

Abstract

The invention discloses application of a rice OsbHLH083 gene in regulation and control of seed germination capability, and relates to the technical field of plant genetic engineering. The CDS sequence of the rice OsbHLH083 gene is as shown in SEQ ID NO. 2, and the amino acid sequence of the coded protein is as shown in SEQ ID NO. 3. The molecular biology function of the rice OsbHLH083 gene for regulating rice germination is studied, after the rice OsbHLH083 gene is edited through CRISPR / Cas9, compared with a wild type, the rice OsbHLH083 gene mutant rice seeds germinate slower, the rice OsbHLH083 gene and a protein coded by the rice OsbHLH083 gene can be used for regulating the phenotype of seed germination, and the rice OsbHLH083 gene mutant rice seeds germinate more slowly. And a gene resource is provided for the genetic improvement of rapid germination and seedling formation characters of the direct seeding rice seeds in the field.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to application of rice OsbHLH083 gene in regulating seed germination ability. Background Art

[0002] Rice (Oryza sativa L.) is one of the main grain crops in my country. Direct seeding is an important method of rice cultivation. It is widely used both at home and abroad because of its advantages such as saving labor, time, and cost, and significantly improving the overall benefits of rice cultivation. However, direct seeding rice production often faces problems such as slow seed germination, uneven seedling formation, and poor seedling growth, which seriously affect rice yield and quality. The establishment of seedlings starts from the seed germination stage and continues until the seedlings have the ability to photosynthesize and grow autotrophically. Seed germination and seedling establishment are key events in plant life activities. One of the key issues that need to be overcome in the promotion of direct seeding technology is the seed germination problem.

[0003] Basic-helix-loop-helix (bHLH) transcription factors are a class of transcription factors found widely in eukaryotes. They contain a highly conserved domain consisting of approximately 60 amino acids, consisting of a DNA-binding basic region at the N-terminus and an HLH region at the C-terminus (Carretero-Paulet et al., 2010). As a large family of transcription factors, 162 bHLH transcription factors have been reported in Arabidopsis thaliana and 183 in rice (Carretero-Paulet et al., 2010; Jiang et al., 2021). These bHLH transcription factors play important roles in metabolism, physiological regulation, and growth and development in plants and animals. For example, OsbHLH148 interacts with OsJAZ1 to enhance plant tolerance to drought, while OsPTF1 plays an important role in controlling rice tolerance to phosphate starvation (Seo et al., 2011; Yi et al., 2005). OsbHLH107 regulates grain size by affecting the number of cells in the longitudinal direction of the spikelet shell (Yang et al., 2018). OsbHLH061, OsPRI1, and OsbHLH156 are crucial for iron (Fe) homeostasis (Liang et al., 2020; Wang et al., 2020). However, little research has been conducted on the involvement of bHLH transcription factors in regulating seed dormancy and germination, and their specific regulatory mechanisms remain unclear. Summary of the Invention

[0004] The purpose of the present invention is to overcome the problems existing in the prior art and to propose the application of rice OsbHLH083 gene in regulating seed germination ability.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] The first object of the present invention is to provide an application of the rice OsbHLH083 gene in regulating seed germination ability.

[0007] As a further optimized solution of the present invention, the CDS sequence of the rice OsbHLH083 gene is shown as SEQ ID NO.2.

[0008] The amino acid sequence of the protein encoded by the rice OsbHLH083 gene is shown in SEQ ID NO.3.

[0009] As a further optimization scheme of the present invention, the rice OsbHLH083 gene positively regulates the germination ability of seeds, that is, the expression of the OsbHLH083 gene can improve the germination ability of crop seeds, and the deletion of the OsbHLH083 gene can reduce the germination ability of crop seeds.

[0010] As a further optimization solution of the present invention, the germination ability of the seeds includes any one of germination rate, seedling rate, germination index or seedling index.

[0011] As a further optimized solution of the present invention, the seeds are grass crop seeds.

[0012] As a further optimized solution of the present invention, the seeds are rice seeds.

[0013] As a further optimization scheme of the present invention, the application approach is to screen crop varieties with normal expression of the rice OsbHLH083 gene in natural ecotypes during plant breeding, or to use genetic engineering technology to create homozygous crop varieties that overexpress the rice OsbHLH083 gene, thereby obtaining crop varieties with strong seed germination ability.

[0014] As a further optimized solution of the present invention, the crop is rice.

[0015] The present invention has the following beneficial effects:

[0016] Experiments conducted in this study have confirmed that the rice OsbHLH083 gene is associated with rice seed germination. After editing the rice OsbHLH083 gene using CRISPR / Cas9, the mutated rice OsbHLH083 gene caused slower rice seed germination compared to wild-type rice. The rice OsbHLH083 gene and the protein it encodes can be used to regulate seed germination phenotypes. Therefore, the rice OsbHLH083 gene or protein can be applied in plant breeding, significantly addressing the difficulty in seed germination during direct seeding of rice seeds and possessing broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The genome structure and target sites of rice OsbHLH083 are shown in Figure 1. A shows the genome structure and target site locations of rice OsbHLH083; B shows the base sequences of three mutation types.

[0018] Figure 2 This is a biostatistical analysis of the seed germination phenotype of WT and OsbHLH083 mutants; A is a photo of rice seeds germinated in water for 3 days; B is a statistical graph of the germination rate of rice seeds germinated in water for 7 days; C is a statistical graph of the seedling rate of rice seeds germinated in water for 7 days;

[0019] Figure 3 is the transcription level of OsbHLH083 gene during rice seed germination; DETAILED DESCRIPTION

[0020] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0021] 1. Materials and Reagents

[0022] Unless otherwise specified, the materials and reagents used in this example can be obtained through commercial channels.

[0023] 2. Methods

[0024] Specific experimental methods are not specified in this example and can be carried out according to conventional methods.

[0025] 2.1 Construction of OsbHLH083 gene knockout vector and generation of rice gene knockout plants

[0026] (1) Construction of OsbHLH083 homozygous mutant plants

[0027] The CRISPR / Cas9 genome editing system was used to edit the OsbHLH083 gene in wild-type rice (Zhonghua 11) to generate gene knockout mutant plants. The details are as follows:

[0028] Using the website http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html, we analyzed the exon sequences of the target gene, OsbH LH083 (genomic sequence shown in SEQ ID NO. 1, CDS sequence shown in SEQ ID NO. 2, full-length 1020 bp CDS sequence, and encoded protein sequence shown in SEQ ID NO. 3). We identified a specific target site, GGCGACAACAAATGGGTGCCTGG (SEQ ID NO. 4). We then used the website http: / / www.rgenome.net / cas-offinder / to assess off-target effects. We constructed a knockout vector, pCRISPR-OsbHL H083, and transformed it into Agrobacterium tumefaciens GV3101 competent cells. Plasmids from positive clones were extracted and sent to a company for sequencing. The correct knockout vector was selected and used to screen rice calli for successful OsbH LH083 knockout, regenerating knockout mutant plants.

[0029] (2) Identification of OsbHLH083 homozygous mutant plants

[0030] Total genomic DNA from a single T0 transgenic plant was extracted and used as a template. Primers flanking the OsbHLH083 target site were used. The primer information is as follows: the upstream primer is CCATGGCGGCCTATGAGTAT (SEQ ID NO. 5); the downstream primer is TCCAGGTTTTGGGTAGATTT (SEQ ID NO. 6);

[0031] The target sequence was amplified by PCR, and the amplified product with a single and clear target band was recovered and sent to the company for sequencing. The sequencing results were compared with the OsbHLH083 genome sequence, and three homozygous OsbHLH083 gene knockout mutant lines, Osbhlh083-1, Osbhlh083-2, and Osbhlh083-3, with different independent mutation sites were selected for subsequent experiments ( Figure 1 ).

[0032] 2.2. Phenotypic analysis of OsbHLH083 - transgenic plant seed germination analysis test

[0033] Seeds of wild-type rice (WT) and OsbHLH083 knockout mutants (Osbhlh083-1, Osbhlh083-2, and Osbhlh083-3) were placed in 9-cm-diameter Petri dishes containing two layers of qualitative filter paper. The dishes were then incubated with 10 mL of distilled water and placed in a 25°C light incubator (12 h light / 12 h dark) for 7 days for seed germination. Three biological replicates were performed, with 30 rice seeds per replicate. Seedlings were defined as germinated when the radicle broke through the seed coat by approximately 2 mm. Seedlings were defined as established when the root length was greater than or equal to the seed length and the sprout length was half the seed length. The number of seeds that germinated and established as seedlings was counted daily, and the germination percentage (GP), seedling percentage (SP), and germination index (GI) were calculated.

[0034] GP = number of germinations / total number*100%;

[0035] SP = number of seedlings / total number*100%.

[0036] GI was calculated using the following formula: GI = ∑(Gt / Dt); where Dt is the number of days of germination and Gt is the number of seeds germinated per day corresponding to Dt;

[0037] SI was calculated using the following formula: SI = ∑(St / Dt), where Dt is the number of germination days and St is the number of seedlings per day corresponding to Dt.

[0038] The experimental results showed that under normal conditions, the germination rate, seedling rate, germination index and seedling index of the OsbHLH083 gene knockout mutant were significantly lower than those of the wild type ( Figure 2 ).

[0039] 2.3. PCR analysis of OsbHLH083 mRNA expression during rice seed germination

[0040] Total RNA was extracted from seeds of Japonica rice Zhonghua 11 at different germination times (0h, 4h, 12h, 24h, 36h, 48h, 60h). cDNA was obtained by reverse transcription using II Reverse Transcriptase system kit (Vazyme Biotech Co., Ltd). qPCR Green Master Mix instructions were used to perform qRT-PCR experiments. Specific amplification primers were designed using PrimerPremier5.

[0041] The upstream and downstream primers of OsbHLH083 gene are:

[0042] OsbHLH083-F: TGAAGCTTGCCTCCTTAGC (SEQ ID NO. 7);

[0043] OsbHLH083-R: TGCACCATCTCATGTGGCAT (SEQ ID NO.8);

[0044] The internal reference gene OsActin (Gene ID: Os10g0510000) in rice seeds was used as a control, and its upstream and downstream primers were:

[0045] OsActin-F: AGGAAGGCTGGAAGAGGACC (SEQ ID NO.9);

[0046] OsActin-R: CGGGAAATTGTGAGGGACAT (SEQ ID NO. 10).

[0047] The expression characteristics of the OsbHLH083 gene were analyzed. The results showed that the expression level of OsbHLH083 increased and then decreased with the imbibition of rice seeds, and reached the highest expression level at 16 hours of imbibition.

[0048] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. Application of rice OsbHLH083 gene in regulating seed germination ability.

2. The use according to claim 1, characterized in that The CDS sequence of the rice OsbHLH083 gene is shown as SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The amino acid sequence of the protein encoded by the rice OsbHLH083 gene is shown in SEQ ID NO.

3.

4. The use according to claim 1, characterized in that The rice OsbHLH083 gene positively regulates the germination ability of seeds, that is, the expression of the OsbHLH083 gene can improve the germination ability of crop seeds, and the deletion of the OsbHLH083 gene can reduce the germination ability of crop seeds.

5. The use according to claim 1, characterized in that The germination ability of the seeds includes any one of germination rate, seedling rate, germination index or seedling index.

6. The use according to claim 1, characterized in that The seeds are grass crop seeds.

7. The use according to claim 1, characterized in that The seeds are rice seeds.

8. The use according to claim 1, characterized in that The application approach is to screen crop varieties with normal expression of the rice OsbHLH083 gene in natural ecotypes during plant breeding, or to use genetic engineering technology to create homozygous crop varieties that overexpress the rice OsbHLH083 gene, thereby obtaining crop varieties with strong seed germination ability.

9. The use according to claim 8, characterized in that The crop is rice.

Images