Application of GmEDS5a and / or GmEDS5b genes in regulation and control of soybean root nodule size and soybean nitrogenase activity or in soybean breeding

Abstract

The invention provides application of GmEDS5a and / or GmEDS5b genes in regulation and control of soybean root nodule size and soybean nitrogenase activity or in soybean breeding, and belongs to the technical field of gene engineering. The GmEDS5a and / or GmEDS5b genes are / is knocked out, the proportion of root nodules with the particle size larger than 2 mm is increased, the soybean nitrogenase activity is remarkably improved, symbiotic nitrogen fixation is promoted, and great significance is achieved for increasing the soybean yield.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to an application of a GmEDS5a and / or GmEDS5b gene in regulating soybean nodule size and soybean nitrogenase activity or in soybean breeding. Background Art

[0002] As a globally important cash crop and oilseed, soybeans are not only a core source of edible vegetable oil and plant protein, but also a strategic agricultural product with great potential for increased production. As a typical nitrogen-intensive crop, soybeans primarily derive their nitrogen needs from three sources: soil nitrogen, exogenous fertilizers, and symbiotic nitrogen fixation. Symbiotic nitrogen fixation can meet over 70% of the plant's nitrogen needs throughout its growth period, particularly during grain formation, where it contributes up to 85%. This characteristic makes symbiotic nitrogen fixation a key physiological mechanism determining soybean yield.

[0003] The soybean-rhizobium symbiosis establishes a symbiotic relationship through specific molecular recognition mechanisms, ultimately forming nodules, highly efficient nitrogen-fixing organs. This process involves complex genetic regulatory networks and metabolic synergies, and its nitrogen-fixing efficiency directly influences soybean biomass accumulation and seed yield.

[0004] During nodule formation, the plant hormones ethylene, auxin, gibberellins, cytokinins, and brassinosteroids all play a role in soybean nodulation. However, the role of salicylic acid (SA), a plant defense hormone, in soybean nodulation has been rarely reported. Salicylic acid (SA) is a phenolic plant hormone widely present in plants, influencing plant growth and development. In Arabidopsis, EDS5 is a key transporter protein in SA synthesis, located in the chloroplast envelope. Mutations in EDS5 lead to reduced SA levels, thus affecting plant growth and development. In soybeans, exogenous SA has an inhibitory effect on nodulation. To date, studies have examined how EDS5 mutations alter SA levels and thus affect soybean nodulation. Summary of the Invention

[0005] The object of the present invention is to provide an application of GmEDS5a and / or GmEDS5b genes in regulating soybean nodule size and soybean nitrogenase activity or in soybean breeding. The soybean gene editing and knockout GmEDS5a and / or b mutants obtained by genetic transformation can enlarge nodules and significantly improve soybean nitrogenase activity.

[0006] The present invention provides an application of GmEDS5a and / or GmEDS5b genes in regulating soybean nodule size and soybean nitrogenase activity or in soybean breeding, and the proportion of nodules with a diameter greater than 2 mm is increased by knocking out the GmEDS5a and / or GmEDS5b genes.

[0007] Preferably, the gene numbers of the GmEDS5a and GmEDS5b genes are Glyma.11G112100 and Glyma.11G112200, respectively.

[0008] Preferably, the method for knocking out the GmEDS5a and / or GmEDS5b genes is CRISPR / Cas9 gene editing technology, and the target sequences for knocking out the GmEDS5a and / or GmEDS5b genes are shown in SEQ ID No.1 and SEQ ID No.2.

[0009] Preferably, the soybean breeding method comprises: constructing a knockout vector containing the GmEDS5a and GmEDS5b genes, transforming a host using the knockout vector, and then infecting a target plant with the transformed host, thereby screening and obtaining a target plant with the GmEDS5a and / or GmEDS5b gene knockout.

[0010] Preferably, the knockout vector is pKSE401.

[0011] Preferably, the host is a microorganism.

[0012] The present invention significantly enlarges root nodules and increases nitrogenase activity by knocking out GmEDS5a / b. This study demonstrates for the first time that soybean GmEDS5a / b is involved in regulating soybean nodulation and nitrogenase activity. Transgenic plants obtained by transforming recipient soybean plants with the knockout vector constructed in this invention exhibit significantly enlarged root nodules and increased nitrogenase activity, promoting symbiotic nitrogen fixation and having important implications for increasing soybean yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the vector map of pKSE401-GmEDS5a / b in Example 1;

[0014] Figure 2 This is an example diagram of the GmEDS5a / b knockout editing form in Example 3;

[0015] Figure 3 The phenotypes (A) and statistical results (B) of the GmEDS5a / b gene-edited knockout mutant and the control group in Example 4, as well as the nitrogenase activity measurement results (C). DETAILED DESCRIPTION

[0016] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0017] Example 1 Construction of pKSE401-GmEDS5a / b vector

[0018] (1) Target site adapter primer design

[0019] Target selection was performed using the CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Two targets were selected and simultaneously knocked out GmEDS5a (Glyma.11G112100) and GmEDS5b (Glyma.11G112200) using CRISPR-Cas9 technology. Specifically, target prediction was performed on the CRISPR-P website using gene ID or genomic sequence. Based on the website's scoring and off-target potential, candidate targets were comprehensively evaluated, selecting high-scoring targets located in gene coding regions with minimal off-target probability. Target 1 selected in the present invention (sequence shown in SEQ ID No. 1) can simultaneously target Glyma.11G112100 and Glyma.11G112200, and target 2 (sequence shown in SEQ ID No. 2) can also simultaneously target Glyma.11G112100 and Glyma.11G112200. The bold part is the PAM recognition site.

[0020] SEQ ID No.1:GAGTGAAGAGAGCAAAGGAGAGG

[0021] SEQ ID No.2:CCGGAGAGACACGAAGTGGGAGG

[0022] According to the selected target site, the vector construction primers DT1-BsF, DT1-F0, DT2-R0 and DT2-BsR were designed, and their sequences are shown in SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6 respectively:

[0023] SEQ ID No.3:

[0024] ATATATGGTCTCGATTGAGTGAAGAGAGCAAAGGAGGTT;

[0025] SEQ ID No.4:

[0026] TGAGTGAAGAGAGCAAAGGAGGTTTTAGAGCTAGAAATAGC;

[0027] SEQ ID No.5:

[0028] AACCCCACTTCGTGTCTCTCCGCAATCTCTTAGTCGACTCTAC;

[0029] SEQ ID No.6:

[0030] ATTATTGGTCTCGAAACCCACTTCGTGTCTCTCCGCAA;

[0031] The non-bold sequence in the primer sequence is the primer backbone sequence. The bold sequence in primer DT1-F0 / BsF (SEQ ID No. 3 / 4) is the 19-nt sequence obtained by removing one base at the 5' end and the three bases of the PAM recognition site NGG of target 1. The bold sequence in primer DT2-R0 / BsR (SEQ ID No. 5 / 6) is the 19-nt reverse complementary sequence obtained by removing one base at the 5' end and the three bases of the PAM recognition site NGG of target 2.

[0032] (1) Construction of pKSE401-GmEDS5a / b recombinant plasmid

[0033] PCR amplification: Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100-fold as a template. The amplification reaction system is shown in Table 1, the amplification reaction procedure is shown in Table 2, and the amplified product sequence is shown in SEQ ID No. 7. The bold fonts are target 1 and target 2, respectively.

[0034] Table 1 Reaction system

[0035] Components Dosage (50 μL) Buffer 5μL dNTP 5μL pCBC-DT1T2 0.5μL BsF 5μL (10μM) BsR 5μL (10μM) F0 0.25μL (10μM) R0 0.25μL (10μM) KODPlus enzyme 1 μL <![CDATA[ddH2O]]> 28μL

[0036] Table 2 Reaction procedure

[0037]

[0038] SEQ ID No.7:

[0039] ATATATGGTCTCGATTGAGTGAAGAGAGCAAAGGAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTGCAAAATTTTCCAGATCGATTTCTTCTTCCTCTGTTCTTCGGCGTTCAATTTCTGGGGTTTTCTCTTCGTT TTCTGTAACTGAAACCTAAAATTTGACCTAAAAAAAATCTCAAATAATATGATTCAGTGGTTTTGTACTTTTCAGTTAGTTGAGTTTTGCAGTTCCGATGAGATAAACCAATATTAATCCAAACTACTGCAGCCTGACAGA CAAATGAGGATGCAAACAATTTTAAAGTTTATCTAACGCTAGCTGTTTTGTTTCTTCTCTCTGGTGCACCAACGACGGCGTTTTCTCAATCGACTAAGAGATTGCGGAGAGACACGAAGTGGGGTTTAGAGACCAATAAT;

[0040] Gel electrophoresis detection: Take 5 μL of PCR product for electrophoresis detection. The size of the amplified target band should be 473 bp.

[0041] PCR product purification: Purification was performed using a PCR product purification kit from Sangon Biotech Co., Ltd. The specific steps are as follows:

[0042] 1) Fill the PCR product to 100 μL, add 5 times the volume of Buffer B3, mix thoroughly, and transfer to the adsorption column;

[0043] 2) Centrifuge at 8000 rpm for 30 seconds and discard the liquid in the collection tube;

[0044] 3) Add 500 μL of Wash Solution to the adsorption column, centrifuge at 8000 rpm for 30 seconds, and discard the liquid in the collection tube;

[0045] 4) Repeat step 3) once;

[0046] 5) Centrifuge the empty column at 9000 rpm for 1 min;

[0047] 6) Place the adsorption column in a new 1.5 mL centrifuge tube. Add 25 μL of Elution Buffer to the center of the column membrane. Let stand at room temperature for 2 minutes, then centrifuge at 9000 rpm for 1 minute. Collect the purified product for subsequent experiments or store at -20°C.

[0048] Enzyme digestion-ligation reaction: The vector is recombined by cutting and ligating at the same time. The reaction system is shown in Table 3, the reaction procedure is shown in Table 4, and the recombinant vector map is shown in Figure 1 shown.

[0049] Table 3 Reaction system

[0050]

[0051]

[0052] Table 4 Reaction procedure

[0053]

[0054] Transform E.coli DH5α competent cells with the enzyme-digested ligation product:

[0055] 1) Take 50 μL of frozen DH5α competent cells, add 10 μL of ligation product, gently stir with a pipette tip to mix, and place on ice for 30 minutes;

[0056] 2) Heat shock at 42°C for 1 min 30 sec, cool on ice for 2 min, add 800 μL of antibiotic-free LB liquid medium, and incubate at 37°C with shaking at 150 rpm for 50 min;

[0057] 3) Collect the cells by centrifugation at 4000 rpm for 5 min, resuspend the cells, and evenly spread them on LB solid medium plates containing 50 mg / L kanamycin. Incubate the plates upside down at 37°C overnight.

[0058] Colony PCR: Single colonies grown on the above plates were identified by colony PCR using vector primers U626-IDF (sequence shown in SEQ ID No. 8) and U629-IDR (sequence shown in SEQ ID No. 9). The reaction system is shown in Table 5. Plaques were picked with a pipette tip and mixed into the system before PCR reaction. The reaction procedure is shown in Table 6. After completion of the PCR reaction, the products were identified by electrophoresis. Positive clones should yield a 726 bp PCR product.

[0059] SEQ ID No.8: TGTCCCAGGATTAGAATGATTAGGC;

[0060] SEQ ID No.9: AGCCCTCTTTCTTTCGATCCATCAAC;

[0061] Table 5 Reaction system

[0062] Components Dosage (10 μL) 2×TaqMix 5μL U626-IDF 0.25 μL U629-IDR 0.25 μL <![CDATA[ddH2O]]> 4.5 μL

[0063] Table 6 Reaction procedure

[0064]

[0065] The positive clone plasmids were extracted and sequenced as follows:

[0066] 1) Pick a single positive colony and culture in LB liquid medium containing 50 mg / L kanamycin at 37°C, 200 rpm, and shake overnight.

[0067] 2) Take 4 mL of bacterial solution and centrifuge at 8000 rpm for 2 min to collect the bacteria;

[0068] 3) Discard the supernatant, add 250 μL of Buffer P1 to the bacterial pellet, and resuspend the cells by pipetting.

[0069] 4) Add 250 μL of Buffer P2, gently invert and mix 8 times, and let stand at room temperature for 3 minutes;

[0070] 5) Add 350 μL of Buffer P3, gently invert to mix, and centrifuge at 12,000 rpm for 10 min;

[0071] 6) Use a pipette to transfer the supernatant to the adsorption column, centrifuge at 12,000 rpm for 30 seconds, discard the liquid in the collection tube, and replace the adsorption column;

[0072] 7) Add 500 μL of Buffer DW1 to the adsorption column, centrifuge at 9000 rpm for 30 seconds, discard the liquid in the collection tube, and replace the adsorption column;

[0073] 8) Add 500 μL of Wash Solution to the adsorption column, centrifuge at 9000 rpm for 30 seconds, discard the liquid in the collection tube, and replace the adsorption column;

[0074] 9) Repeat step 8) once;

[0075] 10) Place the empty adsorption column and collection tube into a centrifuge and centrifuge at 9000 rpm for 1 min.

[0076] 11) After the residual alcohol on the adsorption column membrane evaporates, add 35 μL of Elution Buffer to the center of the membrane, let it stand for 2 minutes, and centrifuge at 9000 rpm for 1 minute to collect the plasmid;

[0077] 12) Take 5 μL of the obtained plasmid for sequencing. The sequencing primer is U626-IDF. The plasmid with correct sequencing is used for subsequent experiments.

[0078] Example 2 Stable transformation of soybean cotyledonary nodes using the pKSE401-GmEDS5a / b vector

[0079] 1. Plasmid transformation of Agrobacterium EHA105:

[0080] 1) Remove 50 μL of frozen EHA105 competent cells, thaw on ice, add 1 μL of the above-mentioned correctly sequenced plasmid, gently stir with a pipette tip to mix, and place on ice for 30 minutes;

[0081] 2) After quick freezing in liquid nitrogen for 5 minutes, heat shock at 37°C for 5 minutes, and then cool in ice for 2 minutes;

[0082] 3) Add 800 μL of LB liquid medium without antibiotics and incubate at 28°C, 150 rpm, and shake for 4 h;

[0083] 4) Spread 100 μL of the shake-cultured bacterial solution evenly on LB solid medium (containing 50 mg / mL kanamycin and streptomycin) and incubate at 28°C for about 2 days until a single colony grows.

[0084] 5) Colony PCR was used to detect whether the plasmid was successfully transformed into Agrobacterium EHA105. The reaction system and reaction procedure are shown in Tables 5 and 6, respectively. The PCR identification results were detected by electrophoresis.

[0085] 6) Select positive colonies and inoculate them into 5 mL of LB liquid medium containing the corresponding antibiotics. Shake the culture at 28°C and 200 rpm overnight. Add an equal volume of 30% glycerol to the culture medium for preservation and freeze at -80°C for stable transformation of soybean cotyledonary nodes.

[0086] 2. Stable transformation of cotyledonary node soybean:

[0087] The creation of stable transgenic soybean GmEDS5a / b knockout mutants utilizes the cotyledonary node transformation method as follows:

[0088] 1) Seed Sterilization: The soybean variety being transformed is Williams 82. Select plump, disease-free soybean seeds and place them in an open Petri dish. Place this Petri dish (with lid) in a desiccator with a sealed lid. Place a beaker containing 96 mL of bleach in the desiccator and add 4 mL of concentrated hydrochloric acid dropwise along the sides of the beaker. Close the lid of the desiccator and sterilize for 14 hours. After sterilization, remove the Petri dish, cover it, and air-dry it in a clean bench for 30 minutes to evaporate any residual chlorine.

[0089] 2) Germination: Place the sterilized seeds in sterilized water (the water just covers 2 / 3 of the soybean seeds) and culture in a 26°C incubator for 1 day.

[0090] 3) Co-cultivation:

[0091] (1) Preparation of bacterial solution: Streak the transformed Agrobacterium on YEP solid medium containing antibiotics and culture in a 28°C incubator for 2 days. Then pick and identify the correct single colony and inoculate it into 5 mL of YEP culture medium. Shake on a shaker at 28°C, 220 r / min, for 16 hours to adjust the OD value to 0. 600 When the OD value reaches 1.0, 500 μL of bacterial solution was spread on YEP solid medium supplemented with corresponding antibiotics and cultured overnight at 28°C. After 1 day of culture, the bacterial moss was scraped off with a disposable surgical blade sterilized by high temperature and resuspended in liquid CCM (co-culture medium) in a triangular flask until the OD value reaches 1.0. 600 =0.7;

[0092] (2) Explant infection: Healthy germinating soybeans were selected, and the radicle was removed using a scalpel. The soybeans were then cut longitudinally along the hypocotyl to produce two explants, each with a growth point. The explants were then immersed in a bacterial solution resuspended in CCM for infection and placed on a horizontal shaker at room temperature at 80 rpm / min for infection for 8 h.

[0093] (3) Explant co-culture: After infection, the explants were placed on sterile filter paper to absorb excess bacterial liquid; a piece of sterile filter paper was spread flat on the CCM solid culture medium, and the explants were placed face down on the filter paper after removing the seed coat. After sealing, they were placed in a 24°C incubator for dark culture for 5 days.

[0094] 4) Shoot Induction: After co-cultivation, excise the swollen hypocotyls, leaving approximately 0.5 cm of the remaining length. Insert the cells into shoot induction medium (SIM) with the wound facing downward and the cotyledonary plane facing upward, tilted at approximately 45°. Place approximately 3 × 6 explants per tissue culture box and culture in a light-sensitive culture room (24°C, 18 h light / 6 h dark) for 14 days. After 14 days, transfer to SIM medium in the same manner and continue culture for another 2 weeks.

[0095] 5) Elongation of clustered shoots: After bud induction is completed, use a scalpel to remove 1 / 2 of the cotyledons of the explants and remove the black necrotic tissue on the explants; insert the explant cotyledon wound downwards and the clustered buds downwards into the shoot elongation medium (SEM, shootelongation medium) for culture, and insert about 3×4 explants into each tissue culture box. Place in a light culture room (24℃, 18h Light / 6h Dark) and culture for 14 days. After 14 days, transfer to SEM culture medium in the same way and continue to culture for 2 weeks. If the cotyledons are still green, keep the green cotyledons, make a cross-section at the old wound of the cotyledons, and make a fresh wound on the hypocotyl; insert the wound downwards and the clustered buds upwards into SEM for culture, and subculture every 2 weeks thereafter.

[0096] 6) Transplanting seedlings: Rinse the induced seedlings with clean water to remove the residual culture medium, remove the aging leaves and blackened callus tissue, and carefully move them into small flower pots. Add vermiculite and water them with a light green manure. Cover with a ventilated lid and grow for about 10 days after transplanting. Observe the growth of the seedlings frequently and keep them moist to allow them to get used to the new soil environment. The temperature in the culture room should be less than 25°C. When the new leaves grow and the seedlings are in a fresh state, move the seedlings and vermiculite as a whole to a large white flower pot, continue to cultivate in a long-day growth room, and water with plenty of green manure. When the seedlings have grown at least 3 nodes, move them to a short-day culture room for breeding.

[0097] Example 3 Identification of Gene Editing Forms in GmEDS5a / b Gene Editing Knockout Soybean Mutants

[0098] 1. CTAB method to extract soybean leaf DNA:

[0099] 1) Grinding the soybean leaves obtained in Example 2 into powder using a tissue grinder;

[0100] 2) Add 650 μL of CTAB DNA extraction buffer, shake to mix, and incubate at 65°C for 20 min;

[0101] 3) Add 0.5 times the volume of chloroform, shake vigorously to mix, and centrifuge at 12000 rpm for 10 min;

[0102] 4) Take the supernatant and place it in a new 1.5 mL centrifuge tube. Add 2 volumes of anhydrous ethanol and incubate at -20°C for 30 minutes.

[0103] 5) Centrifuge at 12000 rpm for 10 min, discard the supernatant, air dry at room temperature, dissolve in 50 μL ddH2O, and store at 4°C until use.

[0104] 2. Identification of gene editing:

[0105] Specific primers (primer sequences are shown in SEQ ID No. 10 to 13) were designed upstream and downstream of the target gene for PCR, and the PCR products were sent to a sequencing company for editing identification. The PCR reaction system is shown in Table 7, the reaction procedure is shown in Table 6, and the editing form example is shown in Table 7. Figure 2 shown.

[0106] GmEDS5a gene editing identification primers:

[0107] SEQ ID No.10: CAACCAGAGTTAGACACCGA;

[0108] SEQ ID No.11: TCTTGGCTTCGAGCGGTTAC;

[0109] GmEDS5b gene editing identification primers:

[0110] SEQ ID No.12: GGCTTTGAAACTCTCGTCAC;

[0111] SEQ ID No.13:TCTCGTCACTATCTCTTCAC;

[0112] Table 7 Reaction system

[0113]

[0114]

[0115] like Figure 3 As shown, the gene editing results of the Cas9-eds5a-1 mutant caused a deletion of 5 bases at positions 36-40 of the GmEDS5a exon sequence, resulting in a frameshift mutation in the GmEDS5a protein sequence starting from amino acid position 12 and premature termination at amino acid position 21; the gene editing results of the Cas9-eds5a-2 mutant caused a deletion of 10 bases at positions 31-40 of the GmEDS5a exon sequence, resulting in a frameshift mutation in the GmEDS5a protein sequence starting from amino acid position 11 and premature termination at amino acid position 59; the gene editing results of the Cas9-eds5a / b-1 mutant caused a deletion of 3 bases at positions 35-37 of the GmEDS5a exon sequence, resulting in a deletion of amino acid position 12 of the GmEDS5a protein sequence, but no frameshift. The Cas9-eds5a / b-1 mutant gene editing results in a four-base deletion at positions 119-122 of the GmEDS5b exon sequence, leading to a frameshift mutation in the GmEDS5b protein sequence starting from amino acid position 40 and premature termination at amino acid position 58.

[0116] Example 4 Identification of the epirhizodal phenotype of the GmEDS5a / b mutant

[0117] 1. Plasmid transformation into Agrobacterium K599:

[0118] 1) The three GmEDS5a / b mutants and their wild-type soybean W82 were planted in vermiculite soaked with nitrogen-free B&D (Broughton and Dilworth) nutrient solution.

[0119] 2) Inoculation of Rhizobia: The soybean Bradyrhizobium strain USDA110 was cultured in TY medium until the exponential growth phase, centrifuged at 4500 rpm for 10 min to collect the bacteria, and diluted with distilled water to an OD of 600 ≈0.08, inoculate newly planted soybeans at a rate of 30 mL / plant;

[0120] 3) Nodule phenotype statistics: 24 days after inoculation with rhizobia, the number of nodules per plant, the ratio of nodules of different sizes and the nitrogenase activity were counted. The nodulation phenotype and statistical results are shown in Figure 2. Figure 3 The results showed that compared with W82, the number of single nodules in the three mutants was reduced, but the nodules were significantly larger, especially the proportion of nodules larger than 2 mm in size, and their nitrogenase activity was greatly increased.

[0121] From the above examples, it can be seen that the present invention provides a method for changing the number and size of nodules and increasing the activity of soybean nitrogenase by editing and knocking out GmEDS5a / b, which is of great significance for promoting symbiotic nitrogen fixation in soybeans and increasing soybean yield.

[0122] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of GmEDS5a and / or GmEDS5b genes in regulating soybean nodule size and soybean nitrogenase activity or in soybean breeding, characterized in that: The proportion of nodules larger than 2 mm in size was increased by knocking out the GmEDS5a and / or GmEDS5b genes.

2. The use according to claim 1, characterized in that The gene numbers of the GmEDS5a and GmEDS5b genes are Glyma.11G112100 and Glyma.11G112200 respectively.

3. The use according to claim 2, characterized in that The method for knocking out the GmEDS5a and / or GmEDS5b genes is CRISPR / Cas9 gene editing technology, and the target sequences for knocking out the GmEDS5a and / or GmEDS5b genes are shown in SEQ ID No. 1 and SEQ ID No.

2.

4. The use according to claim 3, characterized in that The soybean breeding method comprises: constructing a knockout vector containing GmEDS5a and GmEDS5b genes, transforming a host with the knockout vector, and then infecting a target plant with the transformed host, thereby screening and obtaining the target plant with GmEDS5a and / or GmEDS5b gene knockout.

5. The use according to claim 4, characterized in that The knockout vector is pKSE401.

6. The use according to claim 4, characterized in that The host is a microorganism.

Images