Application of MEX1 protein and coding gene thereof in enhancing plant disease resistance

The inhibition of MEX1 protein through gene silencing or editing technology is used to enhance plant resistance to viruses and bacteria, and the problem of insufficient regulation of MEX1 gene in plant disease resistance is solved, and high disease resistance breeding and product improvement of tobacco and rice is achieved.

CN120484079APending Publication Date: 2025-08-15NORTHWEST A & F UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510636800.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-17
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

In the prior art, the function of the MEX1 gene in plants is mainly limited to the transport of plastid maltose, and the lack of regulatory research on biological stress, resulting in insufficient plant disease resistance.

Method used

Through gene silencing or gene editing technology, the expression or inactivation of MEX1 protein is inhibited, and the resistance of plants to potato X virus, lilac pseudomonocytes and rice stripe viruses are enhanced.

Benefits of technology

Significantly enhance the resistance of tobacco and rice to viruses and bacteria, improve crop yield and quality, and bring economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005406924340000011
    Figure HDA0005406924340000011
  • Figure HDA0005406924340000021
    Figure HDA0005406924340000021
  • Figure HDA0005406924340000031
    Figure HDA0005406924340000031
Patent Text Reader

Abstract

The invention discloses an application of MEX1 protein and a coding gene thereof in enhancing plant disease resistance. The MEX1 protein is a protein as shown in A1) or A2): A1) a protein composed of an amino acid sequence as shown in SEQ ID No.3 or SEQ ID No.4; a2) a protein which is derived from A1) and is related to improvement of plant disease resistance, wherein the protein is formed by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID No.3 or SEQ ID No.4. The plant MEX1 gene has the effect of negatively regulating the plant disease resistance in tobacco and rice. The gene can be modified by means of gene silencing or gene editing and the like, and the disease resistance of tobacco to potato X virus and clove pseudomonas and the disease resistance of rice to rice stripe virus are improved, so that the yield and quality of crops are increased, and finally actual economic benefits are brought.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the MEX1 protein and its encoding gene and their application in broad-spectrum disease resistance in plants. Background Art

[0002] In plant tissues, all energy originates from photosynthetic carbon assimilation, achieving the fixation of solar energy into biological energy. Starch and sucrose are the primary products of photosynthesis. Starch is synthesized in the chloroplasts of leaf tissues, while sucrose is synthesized in the cytoplasm of leaf cells and is responsible for long-distance transport to the non-photosynthetic tissues of the plant to supply its growth and development. Starch serves as the instantaneous storage form of photosynthesis during the day, while the conversion of starch into sucrose in leaves represents the highest metabolic flux in the organism at night.

[0003] During starch degradation in chloroplasts, maltose is primarily produced. Maltose is transported out of the chloroplast via the plasmid channel protein MEX1, meaning it is the main carbohydrate exported from the chloroplast to the cytoplasm at night. Furthermore, maltose is degraded by superoxide dismutase 2 (DPE2) and glucan phosphorylase, and then used for the biosynthesis of cytoplasmic sucrose (Chia et al., 2004; Lu & Sharkey, 2004; Weber, 2004; Lloyd et al., 2005; Smith et al., 2005). A large amount of maltose in the cytoplasm is converted into sucrose and transported long distances through the phloem to supply the entire plant. Within target cells, sucrose is further converted into glucose and fructose, which are then catabolized through pathways such as EMP-TCA and PPP to provide energy and the metabolic framework for the cell (Smith et al., 2005).

[0004] The MEX1 gene was first reported in Arabidopsis thaliana in 2004. The AtMEX1 (At5g17520) gene is expressed in all parts of Arabidopsis, with high expression in the original leaves. The Arabidopsis mex1 mutant exhibits a unique chlorotic phenotype at leaf maturity, indicating a link between maltose accumulation and chloroplast homeostasis. Microscopic analysis revealed that the number of chloroplasts was less than half that of wild-type cells. Transmission electron microscopy showed autophagy-like chloroplast degradation in both the mex1 and dpe1 / mex1 double mutants. Microarray analysis revealed extensive rearrangements of metabolic and cellular processes, indicating increased organelle protein turnover in mex1 despite the lack of induction of leaf senescence and senescence-related chlorophyll catabolism. These findings suggest that the accumulation of maltose and maltose oligosaccharides leads to chloroplast dysfunction, which may signal and trigger chloroplast degradation through a retrograde signaling pathway (Stettler et al., 2009). The Mex1 mutant Arabidopsis thaliana exhibited excessive accumulation of starch and maltose, and its growth was significantly inhibited. However, ectopic expression of maltose-degrading enzyme in Arabidopsis mex1 significantly reduced maltose accumulation, but the starch content was higher. At this time, the growth-inhibited phenotype of the mex1 mutant was significantly alleviated, the agronomic traits were close to those of the wild type, and the cold resistance of Arabidopsis thaliana was significantly improved. The above studies show that excessive accumulation of maltose significantly affects chloroplast function and growth and development of plants (rather than starch) (Cvetkovic et al., 2021).

[0005] Meanwhile, the OsMEX1 gene in rice has also been preliminarily studied. RT-qPCR technology found that OsMEX1 is mainly highly expressed in the stamens of mature flowers. Chromatographic analysis consistently showed that there is a relatively high maltose content in mature flowers. Heterologous expression of OsMEX1 can compensate for the maltose excess and growth-inhibiting phenotype of Arabidopsis mex1 mutant (Ryoo et al., 2013).

[0006] Interestingly, the mutation of MEX1 does not lead to maltose accumulation in all species. In contrast to the Arabidopsis mex1 mutant, the Chlamydomonas mex1 mutant showed impaired starch mobilization but no excessive accumulation of maltose or growth inhibition. This study suggests that the function of this protein is not limited to the export of maltose on the plastid membrane and may have other important biological functions (Findinier et al., 2017).

[0007] In summary, the MEX1 gene mainly functions as a plastid maltose transporter in the model plant Arabidopsis thaliana, but its function in other species is not limited to this and there is still a lack of detailed research reports. Currently, there are no reports on the regulation of biological stress by the MEX1 gene. This patent application is the first to discover that MEX1 negatively regulates plant disease resistance, and the prepared gene silencing and gene editing materials can significantly improve plant disease resistance. Summary of the Invention

[0008] Based on this, the object of the present invention is to provide an application of the MEX1 protein in (1)-(5) below,

[0009] 1) Enhance plant disease resistance;

[0010] 2) Prepare agronomic products that enhance disease resistance.

[0011] 3) Cultivate plants with high disease resistance.

[0012] 4) Prepare plant products with enhanced disease resistance.

[0013] 5) Improve disease-resistant varieties and their products;

[0014] The MEX1 protein is a protein that is either A1) or A2) as follows:

[0015] A1) A protein consisting of the amino acid sequence shown in SEQ ID No. 3 or SEQ ID No. 4;

[0016] A2) Proteins derived from A1) consisting of the amino acid sequence shown in SEQ ID No. 3 or SEQ ID No. 4 with substitution and / or deletion and / or addition of one or more amino acid residues and associated with enhancing plant disease resistance.

[0017] The above applications are achieved by knocking out or silencing the gene encoding the MEX1 protein.

[0018] The present invention also provides the use of the coding gene encoding the above-mentioned MEX1 protein or related biological materials in (1)-(5) below,

[0019] 1) Enhance plant disease resistance;

[0020] 2) Prepare agronomic products that enhance disease resistance.

[0021] 3) Cultivate plants with high disease resistance.

[0022] 4) Prepare plant products with enhanced disease resistance.

[0023] 5) Improve disease-resistant varieties and their products.

[0024] The encoding gene is either B1), B2), or B3):

[0025] B1) DNA molecules with nucleotide sequences as shown in SEQ ID No. 1 or SEQ ID No. 2.

[0026] B2) has 75% or more identity with the nucleotide sequence shown in B1) and is a cDNA molecule or DNA molecule encoding the above-mentioned MEX1 protein;

[0027] B3): A cDNA or DNA molecule that hybridizes with the cDNA or DNA molecules described in B1) and B2) and encodes a protein with the same function.

[0028] The disease resistance refers to the resistance of tobacco (Nicotiana benthamiana) to Potato virus X (PVX) and Pseudomonas syringae (Pst DC3000), and rice (Oryza sativa L.) to Rice stripe virus (RSV). In the application, by silencing, knocking out, or gene editing the genes shown in SEQ ID No. 1 or SEQ ID No. 2 in the plant, the genes are inactivated or their expression levels are reduced, and the plant exhibits stronger disease resistance, thus achieving the application in (1)-(5).

[0029] The biological material is any one of the following D1) to D10):

[0030] D1) An expression cassette containing the gene encoding as described in claim 2;

[0031] D2) A recombinant vector containing the encoding gene as described in claim 2, or a recombinant vector containing the expression cassette as described in D1);

[0032] D3) A recombinant microorganism containing the encoding gene as described in claim 2, or a recombinant microorganism containing the expression cassette as described in D1), or a recombinant microorganism containing the recombinant vector as described in D2);

[0033] D4) A transgenic plant cell line containing the encoding gene as described in claim 2, or a transgenic plant cell line containing the expression cassette as described in D1);

[0034] D5) Transgenic plant tissue containing the encoding gene as described in claim 2, or transgenic plant tissue containing the expression cassette as described in D2);

[0035] D6) A transgenic plant organ containing the encoding gene as described in claim 2, or a transgenic plant organ containing the expression cassette as described in D2);

[0036] D7) A nucleic acid molecule that inhibits the expression of the gene encoding the gene described in claim 2; preferably, the nucleic acid molecule is a nucleic acid molecule that knocks out the gene encoding the gene described in claim 2, or a nucleic acid molecule that silences the gene encoding the gene described in claim 2;

[0037] D8) Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing or expressing the nucleic acid molecules described in D7).

[0038] The present invention also provides a method for improving plant disease resistance, which involves silencing, knocking out, or gene editing of a gene in a plant as shown in SEQ ID No. 1 or SEQ ID No. 2, thereby inactivating the gene or reducing its expression level, and thus making the plant exhibit stronger disease resistance.

[0039] The disease resistance refers to the resistance of tobacco to Potato virus X (PVX) and Pseudomonas syringae (PstDC3000) and rice to Rice stripe virus (RSV).

[0040] The beneficial effects of this invention are:

[0041] This invention reports the negative regulatory role of the plant MEX1 gene in disease resistance in tobacco and rice. This gene can be modified through gene silencing or gene editing to enhance resistance to potato virus X and syringomyelia in tobacco, and to rice stripe virus in rice, thereby increasing crop yield and quality, ultimately leading to practical economic benefits. Attached Figure Description

[0042] Figure 1 NbMEX1 negatively regulates the resistance of Nicotiana benthamiana to PVX and RSV.

[0043] The symptoms of gene-silenced Nicotiana benthamiana infected with A. TRV-GFP and TRV-NbMEX1 were observed on day 14 after injection, and there was no difference between them. At this time, the systemic leaves of the TRV-NbPDS control group had also turned white, indicating that TRV infection was successful in both cases.

[0044] B. The silencing efficiency was tested 14 days after the NbMEX1 gene was silenced in Nicotiana benthamiana. It was found that the MEX1 gene in the systemic leaves was significantly suppressed at the transcriptional level at this time.

[0045] C. Symptoms 14 days after PVX inoculation: The symptoms of PVX infection were significantly reduced.

[0046] D. Proteins were extracted from the tobacco tissue in Figure C, and Western blot analysis was performed to compare the accumulation level of PVX-CP protein. The upper band represents the detection result of PVX-CP antibody hybridization, with grayscale value comparison after Image J analysis. The lower band represents the total protein result after Coomassie Brilliant Blue staining, serving as an internal reference for comparing protein loading. The results showed that the accumulation level of PVX was significantly reduced in tobacco plants with NbMEX1 gene silencing.

[0047] E. Friction inoculation of RSV virus into gene-silenced plants pre-injected with TRV-GFP and TRV-NbMEX1 revealed a significant reduction in the disease symptoms of the latter.

[0048] F. Proteins were extracted from the tobacco tissue in Figure C, and Western blot experiments were performed to detect and compare the accumulation level of RSV-CP protein. The upper band represents the detection results of RSV-CP antibody hybridization, with gray value comparison after Image J analysis. The lower band represents the total protein result after Coomassie Brilliant Blue staining as an internal control. The results showed that the accumulation level of PVX was significantly reduced in tobacco plants with NbMEX1 gene silencing.

[0049] Figure 2 NbMEX1 negatively regulates the resistance of Nicotiana benthamiana to Pseudomonas syringae Pst.DC3000.

[0050] A. TRV-NbMEX1 plants in *Nicotiana benthamiana* that had NbMEX1 silenced showed significantly reduced symptoms compared to the control on day 4 after inoculation with *Pseudomonas syringae* Pst. DC3000.

[0051] B. The tissue in A was sampled, centrifuged, and the supernatant was extracted for dilution and plate experiments. The bacterial proliferation was measured. The results showed that the bacterial proliferation was significantly reduced, that is, the disease resistance of TRV-NbMEX1 plants that silenced NbMEX1 was significantly enhanced.

[0052] Figure 3 Comparison of resistance of OsMEX1 mutants to rice stripe virus (RSV).

[0053] A. Illustration of mutant sites in rice mutant osmex1.

[0054] B. Symptoms of RSV infection with NIP (control) at room temperature and after transitioning from room temperature to high temperature, and after infection with osmex1-1 and osmex1-2. The upper layer is a wide-angle schematic diagram, and the lower layer is a detailed schematic diagram.

[0055] C. Comparison of RSV disease incidence rates after RSV infection of NIP (control), osmex1-1 and osmex1-2 at room temperature and at room temperature to high temperature.

[0056] D. Comparison of RSV symptom severity levels after RSV infection with NIP (control) at room temperature and at room temperature followed by high temperature, and after osmex1-1 and osmex1-2.

[0057] E. Western blot detection of RSV virus after infection with NIP, osmex1-1, and osmex1-2 under different temperature conditions, with grayscale value comparison after Image J analysis below. The following figure shows the CBB internal reference. Figure 4 The mutation status of two rice gene OsMEX1 knockout mutants, osmex1-1 and osmex1-2. Detailed Implementation

[0058] The main discovery of this invention is that the plant maltose channel protein MEX1 has the function of negatively regulating plant disease resistance. By modifying this gene through gene silencing or gene editing techniques, the disease resistance of plants can be improved.

[0059] The present invention will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the invention and not intended to limit its scope. The following embodiments can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0060] The materials for the following implementation cases are sourced from the following sources:

[0061] Tobacco and rice plant materials were cultivated in our laboratory. Potato virus X (PVX) (strain NC_011620.1) was isolated from potato plants in Yulin City, Shaanxi Province. Pseudomonas syringae pv. tomatoDC3000 was kindly provided by Professor Ma Qing's research group at Northwest A&F University. The strain source and usage method can be found in the literature Xin, XF, & He, SY (2013). Pseudomonas syringae pv. tomatoDC3000: a model pathogen for probingdisease susceptibility and hormone signaling in plants. Annual review of phytopathology, 51(1), 473-498. The data processing and statistical analysis of the following implementation cases were performed using GraphPadprism 6 software. The One-way AVOVA method was used to detect the significance level. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, P < 0.001 (***) indicates a highly significant difference, and P < 0.0001 (****) indicates a highly significant difference.

[0062] Example 1: Gene-silenced tobacco and detection of antiviral activity in tobacco

[0063] (1) Construction of gene silencing plasmid pTRV2-NbMEX1

[0064] This patent first utilizes pTRV2 plasmid-mediated gene silencing technology to silence NbMEX1 in Nicotiana benthamiana, and the primers are designed as follows:

[0065] F-Nb-TRV2-MEX1-623:

[0066] gtgagctcggtaccggatccTGAACTACTTCTACTTGCTC

[0067] R-Nb-TRV2-MEX1-922:

[0068] tgagtaaggttaccgaattcCTGGATTTAGAAGGTTTGTC

[0069] Using this primer, cDNA from Nicotiana benthamiana was amplified. After obtaining a specific fragment, it was constructed via homologous recombination into the BamHI and EcoRI recognition sites of the pTRV2 vector (preserved in our laboratory; information on this vector is publicly available in the literature Liu, Y., Schiff, M., & Dinesh-Kumar, SP (2002). Virus-induced gene silencing intomato. The Plant Journal, 31(6), 777-786). This yielded a recombinant expression vector containing a silenced fragment of the NbMEX1 gene, named pTRV2-NbMEX1. pTRV2-NbMEX1 is a recombinant vector obtained by replacing the segment between the BamHI and EcoRI recognition sites on the pTRV2 vector with the silenced fragment of the NbMEX1 gene, while maintaining the other nucleotide sequences on the pTRV2 vector unchanged.

[0070] The gene silencing plasmid pTRV2-NbMEX1 for NbMEX1 was obtained, and the CDS region >best_target_region_(623-922) was targeted for silencing. The silencing sequence of the specific amplified fragment is shown in Sequence 5 of the sequence listing.

[0071] (2) Preparation of recombinant Agrobacterium:

[0072] The vectors pTRV1 (preserved in our laboratory, information on which was published in the literature Liu, Y., Schiff, M., & Dinesh-Kumar, SP (2002). Virus-induced gene silencing in tomato. The Plant Journal, 31(6), 777-786), pTRV2-GFP (constructed using the same method as the recombinant plasmid pTRV2-NbMEX1, with the silencing fragment of the NbMEX1 gene replaced by a silencing fragment of eGFP of the same size, the GenBank number of eGFP being OR061321.1), and pTRV2-NbMEX1 were transformed into Agrobacterium tumefaciens GV3101 competent cells to obtain recombinant Agrobacterium. The recombinant Agrobacterium was named GV3101 / pTRV1, GV3101 / pTRV2-GFP, and GV3101 / pTRV2-NbMEX1, respectively.

[0073] (3) Inoculation with Agrobacterium invasive clones:

[0074] GV3101 / pTRV1, GV3101 / pTRV2-GFP, and GV3101 / pTRV2-NbMEX1 were prepared into OD concentrations using tobacco infiltration buffer (10 mM MgCl2, 10 mM MES, 200 μM acetylsalicylic acid, all in sterile water). 600 =1.0 inoculation solution.

[0075] The experiment was repeated three times, with two replicates each time: pTRV1+pTRV2-GFP and pTRV1+pTRV2-NbMEX1. For each treatment, healthy *Nicotiana benthamiana* seedlings (1-2 weeks old) were selected, and the lower leaves were injected with either the experimental or control group bacterial suspension. Three leaves were inoculated per plant, with the same inoculation amount for both groups. The inoculated *Nicotiana benthamiana* seedlings were then cultured at 25°C in a greenhouse with a 16h / 8h light / dark cycle. Systematic leaves were collected from the plants after 21 days for later use. The experimental and treatment groups were set up as follows:

[0076] pTRV1+pTRV2-NbMEX1 experimental group bacterial solution: a liquid prepared by mixing GV3101 / pTRV1 inoculation bacterial solution and GV3101 / pTRV2-NbMEX1 inoculation bacterial solution at a volume ratio of 1:1;

[0077] pTRV1+pTRV2-GFP treatment group bacterial solution: a liquid prepared by mixing GV3101 / pTRV1 inoculated bacterial solution and GV3101 / pTRV2-GFP inoculated bacterial solution at a volume ratio of 1:1.

[0078] (4) RTqPCR detection of NbMEX1 gene silencing efficiency:

[0079] The test sample was the aforementioned spare blade, and the specific steps are as follows:

[0080] Total RNA was extracted from 0.1g of leaf tissue. 10μL of total RNA was reverse transcribed using RNase-free DNase I (Promega) according to the instructions. PCR was performed using a 2×Es Taq MasterMix (Dye) (Kangwei Century) to detect NbMEX1 gene expression. The 18S gene of Nicotiana benthamiana (primers 18S-F and 18S-R in Table 1) was used as an internal control. The NbMEX1 gene-specific detection primers were (NbMEX1-rt-F and NbMEX1-rt-R in Table 1), and their sequences are shown in Table 1.

[0081] Table 1. Primer sequences for internal control and NbMEX1 gene-specific detection.

[0082] Primer name Primer sequence 18S-F CGGCTACCACATCCAAGGAAGG 18S-R GAGCTGGAATTACCGCGGCTG NbMEX1-rt-F TAATACTCAATGCTCGTAACCT NbMEX1-rt-R AATGACCACCTCTGTCTCCCTC

[0083] The results showed that, compared with the tobacco plants inoculated with the pTRV1+pTRV2-NbMEX1 experimental group, the NbMEX1 gene expression level of the tobacco plants inoculated with the pTRV1+pTRV2-GFP treatment group was significantly reduced, proving that the NbMEX1 gene was successfully suppressed in tobacco. Figure 1 ).

[0084] (5) Potato virus X (PVX) and rice stripe virus (RSV) and methods of inoculating tobacco with the virus.

[0085] This protocol uses friction inoculation to inoculate the virus onto tobacco. Plant tissues containing Potatovirus X (PVX) and Rice Stripe Virus (RSV) were placed separately in a mortar, and an appropriate amount of 0.01 mol / L PBS solution was added. The mixture was ground on ice until thoroughly ground, then mixed with quartz sand. The sap was then evenly rubbed onto the lower leaves of the tobacco plants. After a period of time, the plants were allowed to develop symptoms. The inoculation method is described in the reference Hull, R. (2009), Mechanical Inoculation of Plant Viruses. Current Protocols in Microbiology, 13:16B.6.1-16B.6.4.

[0086] (6) Western blot

[0087] 14 days (PVX) or 30 days (RSV) after virus inoculation, the differences in symptoms were observed. Diseased leaf tissue was obtained and protein tissue was extracted. Total protein was loaded using SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and stained with Coomassie Brilliant Blue. Rubisco Large subunit protein of about 46 kDa was selected as an internal control. CBB (Coomassie Brilliant Blue) labeled bands can be seen in the attached figure.

[0088] The extracted plant protein was added to an equal volume of protein loading buffer (100 mM Tris [pH = 6.8], 20% glycerol, 4% SDS, 0.2% bromophenol blue) and boiled at 100°C for 10 min.

[0089] The processed protein samples were sequentially processed onto PAGE gels (Omni-Easy). TM The sample was spotted in a one-step stain-free PAGE gel rapid preparation kit, with 5 μL of each sample, and the electrophoresis conditions were 200V for 45 min.

[0090] After electrophoresis, the PAGE gel was removed and placed flat on the PVDF membrane for transfer. The transfer conditions were 25V for 30 minutes.

[0091] After the transfer was completed, the PVDF membrane was placed in 20 mL of 5% skim milk powder and sealed at room temperature for 2 hours at 50 rpm.

[0092] Discard the blocking solution, add 15 mL TBST (5 M NaCl, 1 M Tris [pH = 7.4], 0.05% Tween 20) and 3 μL @PVX-CP or @RSV-NCP antibody (the specific antiserum obtained by expressing specific viral proteins in prokaryotes and immunizing rabbits in our laboratory; the specific operation method is described in the literature Jia, M., Liu, X., Xue, H., Wu, Y., Shi, L., Wang, R., ... & Yu, F. (2019). Noncanonical ATG8–ABS3 interaction controls senescence in plants. Nature Plants, 5(2), 212-224.), and let stand overnight at 4℃.

[0093] After discarding the antibody incubation solution, wash five times with TBST at 50 rpm for five minutes each time;

[0094] Add 15 mL TBST and 3 μL HRP-labeled goat anti-rabbit IgG (Goat anti-rabbit immunoglobulin G-horseradish peroxidase (IgG-HRP; 1:5000; Proteintech)) and incubate at room temperature for 1 h;

[0095] After discarding the antibody incubation solution, wash five times with TBST at 50 rpm for five minutes each time;

[0096] After adding the chromogenic and enhancement solutions, the samples were detected and analyzed using a protein molecular imaging system with a high-sensitivity ECL chemiluminescent substrate. Specific operational details can be found in the article: Sun LY, Suzuki N (2008) Intragenic rearrangements of a mycoreovirus induced by the multifunctional protein p29 encoded by the prototypic hypovirus CHV1-EP713.RNA14:2557–2571. ImageJ was used to analyze the grayscale values ​​of the virus CP-specific bands.

[0097] For detailed operational information, please refer to the article description: Sun LY, Suzuki N (2008) Intragenic rearrangements of a mycoreovirus induced by the multifunctional protein p29 encoded by the prototypic hypovirus CHV1-EP713. RNA 14:2557–2571. Image J was used to perform grayscale analysis on the virus CP-specific bands.

[0098] (7) Results

[0099] Observations on the obtained silent tobacco plants revealed that the pTRV2-NbPDS indicator plants showed signs of chlorosis after 14 days, indicating that gene silencing had reached the upper leaves. At this point, the growth and development of the pTRV2-NbMEX1 group was no different from the control group. Silencing efficiency testing of the pTRV2-NbMEX1 group showed that the total mRNA content of NbMEX1 was reduced to approximately 40% (see...). Figure 1 B), three independent biological replicates, showed a highly significant reduction. Virus inoculation results showed that NbMEX1-silenced plants exhibited enhanced resistance to PVX and RSV viruses, manifested in a significant reduction in symptoms (see [link to relevant documentation]). Figure 1 C in the middle Figure 1 In the control group (E), the symptoms of viral infection were more severe, with more pronounced typical viral symptoms such as mosaic and leaf curl. In contrast, the pTRV2-NbMEX1 group showed weaker symptoms, with only a few mosaic symptoms and almost no leaf curling. Furthermore, the CP / NCP-specific bands of the virus were significantly weakened in the western blot results (see [link to article]). Figure 1 D, Figure 1 In the middle F), grayscale analysis showed that CP accumulation decreased by at least 50%, while CBB staining showed consistent total protein loading. Plants with NbMEX1 gene silenced exhibited good resistance to both PVX and RSV viruses. Specifically, the accumulation level of PVX coat protein CP in NbMEX1-silenced tobacco decreased to 45.8% compared to the control group, and the accumulation level of RSV coat protein NCP decreased to 49.4% compared to the control group.

[0100] Example 2: Detection of antibacterial pseudomonad activity of NbMEX1 gene-silenced tobacco against syringomyelin

[0101] (1) The inoculation of Pseudomonas syringae pv. tomato DC3000 and the detection of bacterial proliferation units are described in the literature: Yang YX, Wang MM, Yin YL et al (2015) RNA-seq analysis reveals the role of red light resistance against Pseudomonas syringae pv. tomato DC3000 in tomato plants. BMCGenomics 16:120. In short, Pst DC3000 was cultured in LB medium at 28°C for 24 h until OD... 600 The concentration was then increased to 1.0. Bacteria were collected by centrifugation, resuspended in infiltration buffer (10 mM MgCl2), and adjusted to OD600 = 0.002. The infiltrates were then injected into plant leaves using a syringe. Infected plants were placed under high humidity (greater than 95%) conditions and allowed to develop symptoms for 4 days. To quantify the PstDC3000 bacterial population, the infiltrated plant leaves were surface-sterilized in 75% ethanol, rinsed with sterile water, and perforated into the leaves (1 cm²). These tissues were ground in sterile water, serially diluted, and plated on LB agar plates for colony multiplication units (CFU) calculation. The experiment was repeated 9 times, with 3 technical replicates for each bioassay.

[0102] (2) Results analysis showed that four days after inoculation with syringomyelin Pst DC3000, the silent NbMEX1 plants exhibited weaker symptoms (see [link to results]). Figure 2 In Figure A), the control group pTRV2-GFP showed obvious water-soaked and necrotic symptoms, while this group showed no necrotic symptoms, only a small amount of water-soaked symptoms. Simultaneously, the number of *Pseudomonas benthamiana* Pst DC3000 bacterial colonies in the NbMEX1-silenced plants was significantly lower than that in the control group. This indicates that silencing NbMEX1 enhanced the resistance of *Nicotiana benthamiana* plants to *Pseudomonas benthamiana* Pst DC3000.

[0103] Example 3: Enhanced resistance of rice osmex1 mutant to rice stripe virus (RSV)

[0104] (1) Construction of gene editing vector for rice MEX1 gene

[0105] CRISPR-Cas9-mediated gene editing in rice was performed by designing specific sgRNAs. The editing target was designed for the rice gene LOC_Os04g51330.1 (see [link to article]). Figure 3 Medium A): GTCCTATTTCGCTAAGAAGAAGG,

[0106] Construction of gene editing plasmid pYL-OSMEX1

[0107] This patent first utilizes CHOPCHOP The website design uses the target sites of OSMEX1. CRISPR-GE (GenomeEditing)-LiuYG Lab Website design for gene editing primers. Primers are as follows:

[0108] U3F-OsMEX1:ggcaGTCCTATTTCGCTAAGAAGAAGG

[0109] U3R-OSMEX1:aaacCCTTCTTCTTAGCGAAATAGGAC

[0110] The procedure was based on the CRISPR-Cas9 knockout mutant from Professor Liu Yaoguang's laboratory (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y et al: A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and DicotPlants. Mol Plant 2015, 8(8):1274-1284.), to obtain the OsMEX1 gene editing plasmid pYL-OsMEX1. This plasmid was then transformed into the japonica rice variety ZH11.

[0111] (2) Obtaining rice mutants osmex1-1 and osmex1-2

[0112] After editing the rice gene OsMEX1 using CRISPR-Cas9 technology using the above method, two rice gene OsMEX1 knockout mutants, osmex1-1 and osmex1-2, were obtained. Specific mutation details are as follows: Figure 4 As shown: from top to bottom, they are osmex1-1, osmex1-2, and wild-type NIP, respectively.

[0113] (3) The mutant was inoculated with RSV virus and its antiviral activity was tested.

[0114] Wild-type NIP and osmex1 mutant RSV were inoculated by planthoppers. After a period of time, the symptoms and the accumulation level of viral NCP protein were counted to quantify the resistance of different transgenic rice to RSV virus.

[0115] (4) Results Analysis

[0116] The symptoms of the osmex1-1 and osmex1-2 mutants were significantly reduced after RSV inoculation compared to NIP (see...). Figure 3(B) It was found that, regardless of whether at room temperature or at a temperature change from room temperature to high temperature, wild-type rice NIP showed a significantly lower plant growth rate and shorter plants after disease onset compared to the other two transgenic groups. Figure 3 The leaf details below section B show significant yellowing of the leaves after NIP infection, with more pronounced striped yellow spots. Statistical analysis of incidence and disease index also yielded the same conclusion (see...). Figure 3 C and Figure 3 (D) Figure 3 The incidence of RSV in osmex1-1 was significantly lower than that in the control group NIP, both at normal and high temperatures. Figure 3 As observed in the D-samples, at normal temperature, the proportion of leaves with the weakest Grade I symptoms in both mutants was higher than that in the control group NIP, while at high temperature, the proportion of leaves with weaker Grade I and II symptoms in both mutants was significantly higher than that in the control group NIP. Protein extraction and Western blot analysis of diseased leaf tissue revealed that the protein accumulation of RSV-NCP was significantly reduced in both OsMEX1 mutants (see...). Figure 3 Gray-scale analysis revealed that the NCP accumulation in the mutant was only 34%-35% of that in the control group at room temperature, and approximately 58% of that in the control group at a high temperature of 37℃ after the temperature change from room temperature. This indicates that the accumulation level of RSV in the mutant rice was significantly reduced. These results suggest that the two mutants, osmex1-1 and osmex1-2, exhibit significantly enhanced resistance to rice stripe virus (RSV) and possess disease resistance breeding value.

Claims

1. A use of a MEX1 protein in the following (1)-(5), 1) Enhance plant disease resistance, 2) Preparation of agricultural products that enhance disease resistance, 3) Cultivate plants with high disease resistance, 4) preparing plant products with enhanced disease resistance, 5) Improved high disease-resistant varieties and their products; The MEX1 protein is the protein of A1) or A2) below: A1) a protein consisting of the amino acid sequence shown in SEQ ID No. 3 or SEQ ID No. 4; A2) A protein derived from A1) with one or more amino acid residues substituted and / or deleted and / or added to the amino acid sequence shown in SEQ ID No. 3 or SEQ ID No. 4 and associated with improving plant disease resistance.

2. Use of a gene encoding the MEX1 protein according to claim 1 or a biological material related thereto in the following (1) to (5), 1) Enhance plant disease resistance, 2) Preparation of agricultural products that enhance disease resistance, 3) Cultivate plants with high disease resistance, 4) preparing plant products with enhanced disease resistance, 5) Improve highly disease-resistant varieties and their products.

3. The use according to claim 2, characterized in that: The coding gene is as follows B1) or B2) or B3): B1) A DNA molecule represented by the nucleotide sequence shown in SEQ ID No. 1 or SEQ ID No.

2. B2) a cDNA molecule or a DNA molecule that has 75% or more identity with the nucleotide sequence shown in B1) and encodes the above-mentioned MEX1 protein; B3): cDNA molecules or DNA molecules that hybridize with the cDNA molecules or DNA molecules described in B1) and B2) and encode proteins having the same functions.

4. The use according to any one of claims 1 to 3, wherein the disease resistance is resistance of tobacco (Nicotiana abenthamania) to Potato virus X (PVX) and / or Pseudomonas syringae, and / or resistance of rice (Oryza sativa L.) to Rice stripe virus (RSV).

5. The use according to any one of claims 1 to 3, wherein the gene shown in SEQ ID No. 1 or SEQ ID No. 2 in a plant is silenced or knocked out, thereby inactivating the gene or reducing its expression level, and the plant exhibits stronger disease resistance, thereby achieving the use in (1) to (5).

6. The use according to claim 2, characterized in that The biological material is any one of the following D1) to D10): D1) an expression cassette containing the encoding gene according to claim 2; D2) a recombinant vector containing the encoding gene according to claim 2, or a recombinant vector containing the expression cassette according to D1); D3) a recombinant microorganism containing the encoding gene according to claim 2, or a recombinant microorganism containing the expression cassette according to D1), or a recombinant microorganism containing the recombinant vector according to D2); D4) a transgenic plant cell line containing the encoding gene according to claim 2, or a transgenic plant cell line containing the expression cassette according to D1); D5) transgenic plant tissue containing the encoding gene of claim 2, or transgenic plant tissue containing the expression cassette of D2); D6) a transgenic plant organ containing the encoding gene according to claim 2, or a transgenic plant organ containing the expression cassette according to D2); D7) a nucleic acid molecule that inhibits the expression of the gene encoding the gene according to claim 2; preferably, the nucleic acid molecule is a nucleic acid molecule that knocks out the gene encoding the gene according to claim 2, or a nucleic acid molecule that silences the gene encoding the gene according to claim 2; D8) An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing or expressing the nucleic acid molecule described in D7).

7. A method for improving plant disease resistance, comprising silencing or knocking out a gene as shown in SEQ ID No. 1 or SEQ ID No. 2 in a plant, thereby inactivating the gene or reducing its expression level, thereby making the plant exhibit stronger disease resistance.

8. The method according to claim 7, characterized in that The disease resistance is the resistance of tobacco (Nicotiana benthamiana) to potato virus X (PVX) and / or Pseudomonas syringae, or the resistance of rice (Oryza sativa L.) to rice stripe virus (RSV).