Application of OsPLDRP1 protein or coding gene thereof in improving broad-spectrum disease resistance of rice and regulating agronomic traits

Abstract

The invention belongs to the field of molecular biology, and particularly relates to application of OsPLDRP1 protein or a coding gene thereof to improvement of rice broad-spectrum disease resistance and regulation of agronomic traits. According to the application, an OsPLDRP1 knockout mutant and an overexpression transgenic line are constructed under the background of susceptible rice, resistance phenotype analysis is carried out by inoculating various pathogenic bacteria (including pyricularia oryzae, rhizoctonia solani and xanthomonas oryzae), and it is proved that OsPLDRP1 participates in regulation and control of immunoreaction pathways of rice to fungal diseases (rice blast and banded sclerotial blight) and bacterial diseases (xanthomonas oryzae). Meanwhile, it is found that the ear length of a mutant material of the OsPLDRP1 is shorter than that of a wild type, after driving is conducted through a strong promoter ubi, the plant type of an overexpression material of the OsPLDRP1 is looser than that of the wild type, the plant becomes higher, the heading phenotype is early, and the OsPLDRP1 influences normal growth and development of rice while stimulating plant immune response. The invention provides important gene resources and molecular theoretical basis for developing a new variety of broad-spectrum disease-resistant rice.

Description

Technical Field

[0001] The present application belongs to the field of molecular biology, and specifically relates to the application of OsPLDRP1 protein or its encoding gene in improving the broad-spectrum disease resistance of rice and regulating agronomic traits. Background Art

[0002] Rice ( Oryza sativa Rice is the main food crop for more than 50% of the world's population, and its consumption has increased dramatically in many parts of the world. However, the stable production of rice is constrained by various biotic stresses, including the blast fungus ( Magnaporthe oryzae , M. oryzae ) caused by fungal blast, Rhizoctonia solani ( Rhizoctonia solani ) caused by sheath blight, Aspergillus niger ( Ustilaginoidea virens ) caused by false smut, Fusarium moniliforme ( Fusarium fujikuroi ) caused by seedling disease, Xanthomonas oryzae ( Xanthomonas oryzae pv. oryzae , Xoo ) and its pathogenic rice variant ( Xanthomonas oryzae pv. oryzicola , Xoc ) and bacterial leaf streak caused by rice. Among them, rice blast disease, rice bacterial leaf blight, and rice sheath blight are recognized as the three major rice diseases. These diseases prevent normal rice growth and fruiting, ultimately severely impacting rice yield and posing a persistent threat to global food security. Therefore, identifying important broad-spectrum disease-resistance genes and analyzing the immune signaling pathways they mediate can provide a theoretical basis and reference for the design and breeding of artificial rice varieties.

[0003] Phospholipase D (PLD) and its cleavage product, phosphatidic acid (PA), play key roles in plant stress signaling. Although several targets of PLD and PA have been identified, the signaling pathways remain elusive. The rice PLD family comprises 12 members, divided into two subtypes: Ca²⁺-dependent (α / β / γ) and Ca²⁺-independent (δ / ε / ζ), each with distinct C2 domains or PX / PH domains. The target genes of the PLD family in rice remain largely uncharacterized. While known PLD regulatory proteins play a role in abiotic stress responses in the model plant Arabidopsis thaliana, there are no reports on their involvement in resistance to multiple diseases in grasses, specifically whether the disease resistance mediated by PLD regulatory proteins is broad-spectrum.

[0004] To successfully infect rice, different pathogens (such as rice blast, sheath blight, and bacterial blight) have evolved highly specific pathogenic strategies to compromise the rice immune system. Therefore, identifying disease-resistant genes in rice and breeding and cultivating disease-resistant rice varieties are crucial for controlling these diseases and ensuring global food security. Summary of the Invention

[0005] In response to the above problems, this application constructs a OsPLDRP1 Knockout mutants and overexpression transgenic lines. Resistance phenotype analysis was conducted by inoculating with various pathogens (including rice blast, sheath blight, and bacterial blight). OsPLDRP1 Significantly affects rice resistance to three major diseases. OsPLDRP1 While stimulating plant immune responses, it also affects the normal growth and development of rice. This application provides important genetic resources and molecular theoretical basis for the development of new broad-spectrum disease-resistant rice varieties.

[0006] In a first aspect, the present application provides an application of a product, wherein the product is 1) an OsPLDRP1 protein or its encoding gene, or 2) an inhibitor of OsPLDRP1 protein activity or the expression level of its encoding gene, and the application is any of the following: a) Use of OsPLDRP1 protein or its encoding gene as a target in regulating plant resistance to rice blast, sheath blight, and bacterial blight, or in screening for substances that can regulate plant resistance to rice blast, sheath blight, and bacterial blight; b) Use of OsPLDRP1 protein or its encoding gene as a target for regulating plant basal defense response, or for screening substances that can regulate plant basal defense response; c) Use of an inhibitor of OsPLDRP1 protein activity or expression of its encoding gene in regulating plant resistance to rice blast, sheath blight, and bacterial blight; d) Application of inhibitors of OsPLDRP1 protein activity or expression of its encoding gene in regulating plant basal defense response capabilities.

[0007] In this application, "OsPLDRP1 protein" refers to rice phospholipase D regulatory protein OsPLDRP1 (Phospholipase D REGULATED PROTEIN 1). The rice PLD family contains 12 members (such as OsPLDα1-3 、 OsPLDβ1-2 、 OsPLDδOsPLDRP1 is a protein that regulates the production of Ca⁺ and is classified into two subtypes: Ca⁺-dependent (α / β / γ) and Ca⁺-independent (δ / ε / ζ). Each subtype possesses a distinct C2 domain or PX / PH domain. Rice phospholipase D regulatory proteins are proteins structurally related to phospholipase D (PLD) but lack catalytic activity. Their functions in rice (Oryza sativa) and other plants have been gradually revealed in recent years, and they participate in various physiological processes within cells. OsPLDRP1 also contains nuclear and membrane localization signals, enabling it to localize within the nucleus and on the cell membrane, thereby regulating the expression of downstream genes and transmitting signals to the cell interior.

[0008] In certain embodiments, in the application a) or c), the activity of the OsPLDRP1 protein or the expression level of its encoding gene is down-regulated, thereby up-regulating the plant's resistance to rice blast, sheath blight, and bacterial blight; the activity of the OsPLDRP1 protein or the expression level of its encoding gene is up-regulated, thereby down-regulating the plant's resistance to rice blast, sheath blight, and bacterial blight.

[0009] In this application, blast resistance refers specifically to the resistance of rice to pathogenic fungi ( Magnaporthe oryzae ) infection. This disease infects rice throughout its entire growth period, affecting organs and tissues such as leaves, stems, and panicles. Typical symptoms include spindle-shaped lesions with grayish-white centers and brown edges on leaves. Infection of the panicle stunts grain development, leading to complete crop failure in severe cases. This disease typically causes yield losses of 10%-30%, and in extreme cases, up to 40%-50%. Some rice varieties carry susceptibility genes, such as ROD1, which suppress the immune response. Resistant varieties, however, lack the corresponding susceptibility genes and are therefore less susceptible to infection.

[0010] In this application, sheath blight resistance refers to the resistance of rice to Rhizoctonia solani ( Rhizoctonia solani ) pathogenic effects. The disease begins to manifest during the tillering stage of rice. Typical symptoms include the initial formation of small, dark green, water-soaked spots on the leaf sheath near the water surface. These spots expand over the course of the disease into oval, cloud-like spots with characteristic brown edges and light brown to grayish-white centers. Severe infections develop large, irregular lesions that can extend to leaves and stems, leading to premature leaf aging, plant lodging, and ultimately yield losses such as reduced seed set and decreased grain plumpness.

[0011] In this application, bacterial blight resistance refers specifically to rice resistance to Xanthomonas Xanthomonas oryzae pv. oryzae,Xoo) pathogenic defense mechanism. Rice bacterial blight caused by this Gram-negative bacterium is an extremely destructive bacterial disease. Its resistance genetic characteristics are controlled by a single gene or a few major effect genes. For example, the rice Xa23 gene is a typical major effect gene for bacterial blight resistance. Bacterial blight can occur at all stages of rice growth, mainly on rice leaves and leaf sheaths. Initially, small translucent yellow spots will appear on the edge of the rice leaves, and then expand along one or both sides of the leaf margin, or along the midrib to form wavy yellow-green or gray-green spots. The boundary between the diseased and healthy parts becomes increasingly obvious. After a few days, the spots will turn grayish white and curl inward. They can be quickly spread in the air by wind, rain, insects or other means, and then infect the entire rice field. From a distance, the rice field appears withered, hence the name bacterial blight.

[0012] In certain embodiments, in the application b) or d), the activity of the OsPLDRP1 protein or the expression of its encoding gene is down-regulated, thereby enhancing the basic defense response ability of the plant; and the activity of the OsPLDRP1 protein or the expression of its encoding gene is up-regulated, thereby weakening the basic defense response ability of the plant.

[0013] In certain embodiments, the plant basal defense response includes phytoalexin production, reactive oxygen species (ROS) production, defense enzyme activation, expression of pathogenesis-related genes, and systemic acquired resistance.

[0014] In certain embodiments, the amino acid sequence of the OsPLDRP1 protein is as shown in any one of (1) to (3): (1) A protein consisting of the amino acids shown in SEQ ID NO. 1; (2) A protein derived from (1) having the same function as the amino acid represented by SEQ ID NO. 1, wherein one or more amino acid residues are substituted and / or deleted and / or added; (3) Proteins or their derivatives derived from other varieties of rice or other species that have at least 95% sequence identity and have the same function as (1).

[0015] In certain embodiments, the nucleotide sequence of the gene encoding the OsPLDRP1 protein is as shown in any one of (4) to (6): (4) A DNA molecule whose coding region is the sequence shown in SEQ ID NO. 2; (5) A DNA molecule that hybridizes with the DNA sequence defined in (4) under stringent conditions and encodes a protein with the same function; (6) A DNA molecule that has at least 95% sequence identity with the DNA sequence defined in (4) and encodes a protein with the same function.

[0016] In certain embodiments, the inhibitor of OsPLDRP1 protein activity or expression of its encoding gene is one or more of sgRNA, dsRNA or siRNA.

[0017] In certain embodiments, the inhibitor is sgRNA, and the sequence of the sgRNA is shown in SEQ ID NO.7.

[0018] On the other hand, the present application also provides an application of a composition, comprising 1) the OsPLDRP1 protein or its encoding gene, or 2) a nucleic acid construct containing the OsPLDRP1 protein or its encoding gene, and the application of the composition as a plant growth promoter in regulating plant agronomic traits.

[0019] In certain embodiments, the regulation is to upregulate the activity of the OsPLDRP1 protein or the expression of its encoding gene, thereby increasing plant height, making the plant shape looser, and causing the plant to ear earlier; or to downregulate the activity of the OsPLDRP1 protein or the expression of its encoding gene, thereby decreasing plant height, making the plant shape more compact, and causing the plant to ear normally.

[0020] In certain embodiments, the amino acid sequence of the OsPLDRP1 protein is as described above, and the nucleotide sequence of the gene encoding the OsPLDRP1 protein is as described above.

[0021] On the other hand, the present application also provides a method for upregulating the resistance of plants to rice blast, sheath blight and bacterial blight, or enhancing the basic defense response ability of plants, comprising the step of contacting the composition as described above with the plant.

[0022] In the present application, the plant may be a grass plant, such as rice.

[0023] Compared with the prior art, this application constructs a OsPLDRP1 The knockout mutants and overexpression transgenic lines were inoculated with a variety of pathogens (including rice blast, sheath blight and bacterial blight) for resistance phenotype analysis. OsPLDRP1 The experiment used the field inoculation method to systematically compare the differences in disease resistance of transgenic materials and confirmed that OsPLDRP1 Participates in regulating the immune response pathway of rice to fungal diseases (rice blast, sheath blight) and bacterial diseases (bacterial blight). OsPLDRP1 The mutant material has shorter spike length than the wild type. When driven by the strong promoter ubi, OsPLDRP1 The overexpression material has a looser plant shape than the wild type, the plant becomes taller, and has an early heading phenotype. OsPLDRP1While stimulating plant immune responses, it also affects the normal growth and development of rice. This application provides important genetic resources and molecular theoretical basis for the development of new broad-spectrum disease-resistant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Overexpressed genes OsPLDRP1 The structure of the recombinant plasmid; A is the plasmid pUN1301- OsPLDRP1 - Flag Map; B is plasmid pUN1301- OsPLDRP1 - GFP Atlas.

[0025] Figure 2 for OsPLDRP1 The genotype identification results of the knockout materials and OsPLDRP1 The results of protein level identification of overexpressed materials were shown.

[0026] Figure 3 Figure 2 is a fluorescence image showing that OsPLDRP1 is localized in the cell membrane and nucleus of rice. A is a transiently transformed rice protoplast showing that OsPLDRP1 is localized in the cell membrane and nucleus. OsNLS As an indicator, the scale bar is 10 μm; B shows transient infection of tobacco cells, revealing that OsPLDRP1 is localized to the cell membrane and the nucleus, and a reported nuclear marker gene tdT As an indication, the scale bar is 10 um.

[0027] Figure 4 for OsPLDRP1 Negative regulation of rice resistance to rice blast fungus. OsPLDRP1 Negatively regulate rice resistance to rice blast fungus. OsPLDRP1 Knockout and overexpression lines of TP309, as well as wild-type TP309, were inoculated with rice blast fungus in vitro. Disease incidence was measured 7-10 days after inoculation. (B) DNA was extracted from rice leaf tissue at the diseased site, and fungal biomass was measured by qPCR to analyze disease incidence in each rice plant. (C) Disease incidence was measured by measuring lesion extension. Data are presented in scatter plots. Two-tailed t-tests were used for data analysis. Asterisks indicate significant differences (**P<0.01, *P<0.05).

[0028] Figure 5 for OsPLDRP1 Negative regulation of rice resistance to sheath blight; A is OsPLDRP1 Negatively regulates rice resistance to sheath blight. OsPLDRP1The knockout strains (A) and wild-type TP309 were inoculated with sheath blight pathogens. Seven days after inoculation, disease progression was measured. (B) Lesion extension was measured to reflect disease progression. Each measurement is presented in a scatter plot. Data were analyzed using a two-tailed t-test. Asterisks indicate significant differences (**P<0.01, *P<0.05).

[0029] Figure 6 for OsPLDRP1 Negative regulation of rice resistance to bacterial blight; A is OsPLDRP1 Negatively regulates rice resistance to the bacterial disease bacterial blight by OsPLDRP1 Knockout and overexpression strains, as well as wild-type TP309, were inoculated with bacterial blight race PXO99A. Fourteen days later, disease development was observed. Representative photos of diseased leaves near the average length were selected. (B) Statistical analysis of bacterial blight development was performed. Lesion length extending from the incision was measured as a measure of disease severity. Data are represented by points. Two-tailed t-tests were used for analysis. Asterisks indicate significant differences (**P < 0.01, *P < 0.05).

[0030] Figure 7 for OsPLDRP1 Positively regulates rice yield traits such as plant height and grain shape. OsPLDRP1 A is the morphological photograph of overexpressing plants, with a scale bar of 50 cm; B is the photographic statistics of rice panicles, with a scale bar of 1 cm. DETAILED DESCRIPTION

[0031] The present application is further described in detail below with reference to the accompanying drawings and examples. It is particularly noted that if no specific conditions are specified in the following examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, the raw materials used in the following examples can be obtained from common commercial sources.

[0032] Experimental Materials

[0033] Rice japonica ( Oryza sativa Japonica Group ) variety TP309 wild type (TP309), rice blast fungus ( M. oryzae ): TH12, Rhizoctonia solani ( Rhizoctonia solani Kühn ): Strong pathogenic strain RH-9, bacterial blight pathogen ( Xanthomonas oryzae pv. Oryzae,Xoo ):PXO99A.

[0034] Example 1 Construction OsPLDRP1 Gene knockout plasmid / overexpression plasmid

[0035] 1. OsPLDRP1 Gene and protein structure

[0036] riceOsPLDRP1 The gene has NCBI accession number: LOC4340577, a 2903-bp transcript sequence, of which the CDS coding region is 1146 bp long, and the CDS sequence is shown in SEQ ID NO. 2. This gene encodes 381 amino acids, and the OsPLDRP1 protein sequence is NCBI number XP_015643710.1, and the amino acid sequence is shown in SEQ ID NO. 1.

[0037] 2. Rice OsPLDRP1 Construction of gene knockout plasmid

[0038] against OsPLDRP1 The knockout target of the gene was designed based on the genomic DNA sequence of the gene, and acgacttcgacgagtacgac (SEQ ID NO.3) was selected as the target. The double-stranded DNA sequence was chemically synthesized using primers OsPLDRP1-KO-F: 5'-GGCGgtcgtactcgtcgaagtcgt-3' (SEQ ID NO.4) and OsPLDRP1-KO-R: 5'-AAACacgacttcgacgagtacgac-3' (SEQ ID NO.5). The target was then connected to the OsU3 promoter (SEQ ID NO.6) by enzyme digestion and ligation, and the SgRNA sequence was designed as shown in SEQ ID NO.7. Then, an expression cassette containing OsU3, target sequence, and SgRNA was cloned by PCR and assembled into the binary vector pYLCRISPR / Cas9 using the Golden Gate cloning method. -MTmono On the rice OsPLDRP1 Gene knockout recombinant plasmid pYLCRISPR / Cas9 -OsPLDRP1 , used to transform TP309 plants to obtain knockout OsPLDRP1 materials.

[0039] 3. Rice OsPLDRP1 Construction of gene expression vector

[0040] 3.1 Amplification of target sequence

[0041] Using genomic cDNA as a template, the target fragments were amplified using high-fidelity DNA polymerase KOD FX (TOYOBO, Cat# KFX-101). OsPLDRP1 The PCR system is shown in Table 1.

[0042] Table 1 Amplified target fragments OsPLDRP1 PCR system

[0043] The PCR reaction program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 68°C at 1 kb / min for approximately 35 cycles; extension at 68°C for 10 min; and 16°C for 1 min. The primers used in the PCR reaction are listed in Table 2. The PCR product was purified on agarose gel and used for subsequent expression vector preparation.

[0044] Table 2 Primer sequences used to amplify target fragments

[0045] 3.2 Enzyme digestion and ligation pUN1301- GFP and pUN1301- Flag The plasmid enzyme digestion system is shown in Table 3.

[0046] Table 3 Plasmid enzyme digestion system

[0047] Mix gently and centrifuge briefly, then incubate in a 37°C water bath for 30-60 min.

[0048] Next, the digested fragments were recovered and their concentrations were determined. Recombination reactions were performed according to the instructions of the ClonExpress® II One Step Cloning Kit (Vazyme, Cat#C112-02) (20 μL, the system is shown in Table 4, and the reaction was incubated in a 37°C water bath for 30 min).

[0049] Table 4 Plasmid recombination reaction system

[0050] Obtain recombinant plasmid pUN1301- OsPLDRP1-Flag The spectrum is as follows Figure 1 As shown in A, the recombinant plasmid pUN1301- OsPLDRP1-GFP The spectrum is as follows Figure 1 As shown in B.

[0051] Example 2 Obtaining gene-edited / overexpressed rice lines

[0052] 1. Induction of Rice Mature Embryo Callus

[0053] 1) The rice seeds were hulled using a thresher and the moldy and deformed seeds were manually screened and discarded.

[0054] 2) Add a small amount of 75% ethanol, shake by hand for about 30 seconds, and rinse with sterile water.

[0055] 3) Add 25-30% (v / v) antiformin solution and shake at 200 rpm for 30 min.

[0056] 4) Rinse with sterile water 5-6 times, 5-10 minutes each time.

[0057] 5) Place the seeds on sterilized filter paper to absorb the moisture from the seed surface. Use sterilized tweezers to sow the seeds on NBD medium to induce callus. NBD rice screening medium (1 L): NB Basal Medium (PhytoTech) 4.1 g, sucrose 30 g, glutamine 0.5 g, proline 0.5 g, hydrolyzed casein 0.5 g, 1 mL 2,4-D solution (1 mg / mL), pH 5.8, solids need to add 4.5 g / L phytagel.

[0058] 6) After about 14 days of dark culture, the endosperm, plumule, and radicle are removed. The resulting callus can be used for genetic modification and subculture. Subculture is performed every two weeks, and the number of subcultures depends on the state of the callus.

[0059] 2. Preparation of Agrobacterium Transformation Medium

[0060] 1) The constructed plasmid (recombinant plasmid pYLCRISPR / Cas9- OsPLDRP1 , recombinant plasmid pUN1301 - OsPLDRP1-Flag , recombinant plasmid pUN1301- OsPLDRP1-GFP ) were chemically transformed into competent EHA105 and cultured at 28°C for two days.

[0061] 2) Pick a single colony and culture it in 5 mL of LB liquid medium containing the corresponding antibiotics. Culture it with shaking at 28°C for 48 hours.

[0062] 3) Transfer 1 mL of overnight culture into 15 mL of AB liquid medium (20 mg / L Rif + 50 mg / L Kan + 100 mg / L AS). Cultivate at 28°C until OD600 reaches approximately 0.5 (approximately 4 h). AB liquid medium (1 L): KH2PO4 3 g, NaH2PO4 1 g, NH4Cl 1 g, MgSO4·7H2O 300 mg, KCl 150 mg, CaCl2 10 mg, FeSO4·7H2O 2.5 mg, glucose 5 g.

[0063] 3. Co-cultivation of Rice Callus with Agrobacterium

[0064] 1) Centrifuge the bacterial solution at 4000 rpm for 10 min and discard the supernatant.

[0065] 2) Resuspend the bacterial pellet in AAM containing 100 mg / L AS until the OD600 of the bacterial solution reaches 0.4-0.6.

[0066] 3) Co-culture the bacterial solution with the rice callus for 20 min, shaking occasionally.

[0067] 4. Screening

[0068] Blot the callus dry with sterile filter paper and transfer to a selection medium containing hygromycin and carbenicillin to screen for resistant callus. Change the medium every two weeks.

[0069] Screening medium: S1: 100 mg / L carbenicillin + 30 mg / L hygromycin, S2: 100 mg / L carbenicillin + 40 mg / L hygromycin, S3: 100 mg / L carbenicillin + 50 mg / L hygromycin.

[0070] 5. Differentiation

[0071] The selected rice callus is transferred to a rice differentiation medium and cultured under light, with the medium replaced every two weeks until it differentiates into seedlings.

[0072] MS rice differentiation medium (1 L): M&SBASAL MEDIUM with VITAMINS (PhytoTech) 4.43 g, sucrose 30 g, 6-BA 3 mg / L, NAA 0.5 mg / L, pH 6.3, solids need to add 4.5 g / L phytagel.

[0073] 6. Rooting

[0074] Transfer the seedlings on the differentiation medium to the rooting medium. After growing for about 2 weeks, take out the seedlings, wash off the agar medium, and culture in water for 7 days before transplanting them into the soil.

[0075] 1 / 2MS Rice Rooting Medium (1 L): M&SBASAL MEDIUM with Vitamins (PhytoTech) 2.165 g, sucrose 20 g, pH 6.3, solids need to add 4.5 g / L plant gel.

[0076] 7. PCR Identification

[0077] The leaves of the obtained regenerated plants were taken to extract genomic DNA, and PCR amplification was performed on the regenerated plants using the primers listed in Table 5, and the amplified products were sequenced.

[0078] Table 5 Primers for identification of regenerated rice plants

[0079] Through the above identification, two mutant plants were screened from the regenerated plants and named as plants CR-Ospldrp1#1 and plants CR-Ospldrp1#2 Design of sgRNA pairs OsPLDRP1 The coding region of TP309 was targeted for knockout, and the target was selected on the first exon. After sequencing, it was compared with the genomic DNA of the wild type of TP309. Figure 2 As shown in Figure A, the plant CR-Ospldrp1#1 A base A was inserted into the gene encoding the OsPLDRP1 protein (causing a frameshift mutation and premature termination), and the plant CR-Ospldrp1#1 A single T was inserted into the gene encoding the OsPLDRP1 protein (causing a frameshift mutation and premature termination). OsPLDRP1 Overexpression material, Ubi :: OsPLDRP1#1-#6 ,like Figure 2 As shown in Figure B, WB identification Ubi :: OsPLDRP1#1-#6 Has high expression.

[0080] Example 3 OsPLDRP1 is localized in the cell membrane and nucleus of rice

[0081] 1) After hulling and disinfecting, rice seeds were sown in 1 / 2MS and grown at 28℃ for 9-11 days.

[0082] 2) Remove the rice seedlings, cut off the roots and leaves, and retain the leaf sheath tissue (about 5-6g).

[0083] 3) Use a single-edged blade to cut the leaf sheath tissue into 0.5-1 mm segments. Transfer the chopped leaf sheaths to a conical flask and rinse the chopped leaf sheaths in the culture dish with 5 ml of 0.6 M D-Mannitol solution. Place the chopped leaf sheaths in a dark place.

[0084] 4) Prepare 15 ml of Enzyme Solution and add it to the chopped leaf sheath tissue. Wrap the conical flask containing the leaf sheath tissue with tin foil and incubate the enzyme solution in the dark for 3-4 hours.

[0085] 5) Filter the protoplasts through a 40 μm filter and carefully transfer them to a 50 ml round-bottom centrifuge tube. Rinse and filter the rice tissue several times with W5 solution. Combine the filtrates, gently invert to mix, and centrifuge at 60 g for 5 min.

[0086] 6) Remove the supernatant, add 10 ml of W5 solution to resuspend, and centrifuge at 60 g for 5 min.

[0087] 7) Remove the supernatant, add 5 ml of W5 solution to resuspend, place on ice, protect from light, and allow to settle naturally for 30 minutes.

[0088] 8) Centrifuge at 60 g for 5 min to collect the protoplasts and remove as much of the W5 solution as possible from the upper layer.

[0089] 9) Add an appropriate amount of MMG solution (100 μl / tube), gently resuspend, and examine under a microscope.

[0090] 10) Add 10 μl of plasmid DNA (1 μg / μl) to a 2 ml round-bottom centrifuge tube, then add 100 μl of protoplasts, mix gently, and finally add 110 μl of PEG-Ca 2+ The transformation solution was flicked with fingers to mix well. The transformation time was 15 min.

[0091] 11) After transformation, add 440 μl of W5 solution, mix thoroughly by inversion to terminate the reaction, and centrifuge at 100 g for 2 min.

[0092] 12) Remove the supernatant, add 1 ml of W5 solution to resuspend the cells, and incubate them flat at 25°C overnight.

[0093] 13) The next day, centrifuge at 100 g for 2 min, retain 100 μl of W5 solution to suspend the protoplasts, and observe fluorescence using a Confocal microscope.

[0094] like Figure 3 As shown, OsPLDRP1 is localized in the cell membrane and nucleus of rice. A shows transiently transformed rice protoplasts revealing that OsPLDRP1 is localized in both the cell membrane and the nucleus. OsPLDRP1 The complete open reading frame C-terminus was fused with a GFP tag and transiently transformed into rice protoplasts. The fluorescence distribution was observed after 16 hours. This is a reported nuclear marker gene. OsNLS As an indicator, the scale bar is 10 μm; B shows transient infection of tobacco cells, revealing that OsPLDRP1 is localized to both the cell membrane and the nucleus. OsPLDRP1 The complete open reading frame was fused to the C-terminus of the GFP tag. The tobacco was infected with Agrobacterium and the fluorescence distribution was observed after 48 hours of transient expression. This is a reported nuclear marker gene. tdT As an indication, scale bar 10 μm.

[0095] Example 4 OsPLDRP1 Negative regulation of rice resistance to rice blast fungus

[0096] 1) Field-harvested seeds should be oven-dried at 42°C for 4-7 days and exposed to sunlight for one week. Then, soak in water at room temperature for 24 hours. Discard the soaking water and rinse three times with clean water. Spread the seeds on a damp paper towel to retain moisture. Leave them at room temperature for two days for germination. When the seeds are approximately 0.5 cm in diameter, they can be planted in greenhouse soil or hydroponic boxes. The rice incubator should be maintained at 28°C with 12 hours of light and 12 hours of darkness.

[0097] 2) Activate rice blast fungus race TH12 using CM medium. Place the filter paper containing the rice blast fungus in the center of the CM solid medium. Incubate at 28°C for 7-10 days to allow sporulation (12 days light / 12 days dark). Once the surface of the CM medium is covered with hyphae, wash the spores with purified water containing 0.02% Tween 20, filter through a double layer of gauze, and prepare a spore suspension. The spore concentration for inoculation is 5×10 5 / ml, under a 10×10 microscope, there are an average of 30-50 spores per field of view.

[0098] 3) Yes OsPLDRP1 The knockout and overexpression lines of TP309 and the wild type TP309 were inoculated with rice blast fungus in vitro. The disease occurrence was investigated 7-10 days after inoculation. The disease occurrence and lesion size of each rice plant were recorded by counting the lesion length and calculating the fungal growth on the leaves.

[0099] The results are as follows Figure 4 As shown, knockout lines CR-Ospldrp1#1 and plants CR-Ospldrp1#2 The length of rice blast lesions on leaves of the overexpression lines was significantly reduced compared with the wild type TP309, and the fungal growth was also lower; Ubi :: OsPLDRP1# 1-#2 The length of rice blast spots on leaves of TP309 was significantly increased compared with wild type TP309, and the fungal growth was also higher. OsPLDRP1 Negative regulation of rice resistance to the fungal disease Magnaporthe grisea.

[0100] Example 5 OsPLDRP1 Negative regulation of rice resistance to sheath blight

[0101] 1) Take laboratory-stored sclerotia of Rhizoctonia solani and grow them on PDA solid medium at 28°C. PDA medium (1 L): 200 g potatoes (cut into small pieces, boil until soft, and filter through four layers of cheesecloth), 20 g glucose, and 15 g / L agar powder added to the solid medium.

[0102] 2) When new hyphae grow from the sclerotia, cut off the well-grown and uncontaminated hyphae at the front end with a sterilized blade and place them on new PDA culture medium for cultivation.

[0103] 3) Repeat step 2 until the culture medium is free of contamination from other bacteria and continue culturing for 2-3 days until sclerotia form.

[0104] 4) Cut the toothpicks into small pieces of about 2 cm and sterilize them.

[0105] 5) Remove the sclerotia and place them on PDA culture medium. After 1-2 days of culture, cover them with sterilized toothpicks and continue to grow for 2-3 days. When the mycelium covers the toothpicks, they can be used to inoculate the sheath blight pathogen.

[0106] 6) Rice can be inoculated with sheath blight from about two months into its growth until heading. To inoculate, remove a toothpick with tweezers and insert it into the second and third leaf sheaths of the rice plant.

[0107] 7) The incidence of sheath blight can be observed 7 days after inoculation.

[0108] The results are as follows Figure 5 As shown, knockout lines CR-Ospldrp1#1 and plants CR-Ospldrp1#2 The length of lesions on the leaf sheath of TP309 was significantly reduced compared with that of wild type TP309, indicating that OsPLDRP1 Negative regulation of rice resistance to the fungal disease Sheath Blight.

[0109] Example 6 OsPLDRP1 Negative regulation of rice resistance to bacterial blight

[0110] 1) Activate laboratory-stored Xoo strains 2-3 times on PSA plates and incubate at 28°C for 48-72 hours.

[0111] 2) After a single colony has grown, pick a single colony and transfer it to PSA liquid culture medium and shake for 1-2 days.

[0112] 3) Pipette 100 μl of bacterial solution onto a PSA plate, spread it evenly with a clean spreader stick, and incubate it upside down at 28°C for 48-72 hours. The grown bacterial blight bacteria can be used for rice inoculation.

[0113] 4) Scrape the grown bacterial blight fungus on the PSA medium with sterile water and dilute it to an OD value of 1.0.

[0114] 5) Dip a pair of scissors in the bacterial solution and cut the rice leaf 1-2 cm from the tip diagonally downward.

[0115] 6) Measure the length of the leaf spots 12-14 days after inoculation.

[0116] The results are as follows Figure 6 As shown, knockout lines CR-Ospldrp1#1 and plants CR-Ospldrp1#2 The length of lesions on leaves of the overexpression lines was significantly reduced compared with that of wild-type TP309. Ubi :: OsPLDRP1#1-2The length of lesions on the leaves of TP309 was significantly increased compared with that of wild type TP309, thus proving that OsPLDRP1 Negative regulation of rice resistance to the bacterial disease Xanthomonas syringae.

[0117] Example 7 OsPLDRP1 Positively regulating agronomic traits such as rice plant height and early heading

[0118] observe OsPLDRP1 The effects on agronomic traits of rice were found to be Figure 7 As shown, OsPLDRP1 The overexpressing plants were looser than the wild type, and the rice became taller and had the agronomic trait of early heading. OsPLDRP1 The ear length of the knockout mutant plant is smaller than that of the wild type, which indicates that OsPLDRP1 While stimulating plant immune response, it also affects the normal growth and development of rice.

[0119] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.

Claims

1. An application of a product, wherein the product is 1) an OsPLDRP1 protein or its encoding gene, or 2) an inhibitor of OsPLDRP1 protein activity or the expression level of its encoding gene, characterized in that: The application is any of the following, a) Use of OsPLDRP1 protein or its encoding gene as a target in regulating plant resistance to rice blast, sheath blight, and bacterial blight, or in screening for substances that can regulate plant resistance to rice blast, sheath blight, and bacterial blight; b) Use of OsPLDRP1 protein or its encoding gene as a target for regulating plant basal defense response, or for screening substances that can regulate plant basal defense response; c) Use of an inhibitor of OsPLDRP1 protein activity or expression of its encoding gene in regulating plant resistance to rice blast, sheath blight, and bacterial blight; d) Application of inhibitors of OsPLDRP1 protein activity or expression of its encoding gene in regulating plant basal defense response capabilities.

2. The use according to claim 1, characterized in that In the application a) or c), the activity of the OsPLDRP1 protein or the expression level of its encoding gene is down-regulated, thereby up-regulating the plant's resistance to rice blast, sheath blight, and bacterial blight; the activity of the OsPLDRP1 protein or the expression level of its encoding gene is up-regulated, thereby down-regulating the plant's resistance to rice blast, sheath blight, and bacterial blight.

3. The use according to claim 1, characterized in that In the application b) or d), the activity of the OsPLDRP1 protein or the expression of its encoding gene is down-regulated, thereby enhancing the basic defense response ability of the plant; the activity of the OsPLDRP1 protein or the expression of its encoding gene is up-regulated, thereby weakening the basic defense response ability of the plant.

4. The use according to claim 1, characterized in that The basic plant defense response includes the production of phytoalexins, the production of reactive oxygen species (ROS), the activation of defense enzymes, the expression of pathogenesis-related genes and systemic acquired resistance.

5. The use according to any one of claims 1 to 4, characterized in that: The amino acid sequence of the OsPLDRP1 protein is shown in any one of (1) to (3) below: (1) A protein consisting of the amino acids shown in SEQ ID NO. 1; (2) A protein derived from (1) having the same function as the amino acid represented by SEQ ID NO. 1, wherein one or more amino acid residues are substituted and / or deleted and / or added; (3) Proteins or their derivatives derived from other varieties of rice or other species that have at least 95% sequence identity and have the same function as (1); The nucleotide sequence of the gene encoding the OsPLDRP1 protein is shown in any one of (4) to (6) below: (4) A DNA molecule whose coding region is the sequence shown in SEQ ID NO. 2; (5) A DNA molecule that hybridizes with the DNA sequence defined in (4) under stringent conditions and encodes a protein with the same function; (6) A DNA molecule that has at least 95% sequence identity with the DNA sequence defined in (4) and encodes a protein with the same function.

6. The use according to claim 1, characterized in that The inhibitor of OsPLDRP1 protein activity or the expression of its encoding gene is one or more of sgRNA, dsRNA or siRNA.

7. The use according to claim 6, characterized in that The inhibitor is sgRNA, and the sequence of the sgRNA is shown in SEQ ID NO.

7.

8. Use of a composition comprising 1) the OsPLDRP1 protein or its encoding gene, or 2) a nucleic acid construct containing the OsPLDRP1 protein or its encoding gene, characterized in that: The composition is used as a plant growth promoter in regulating plant agronomic traits.

9. The use according to claim 8, characterized in that The regulation is to upregulate the activity of the OsPLDRP1 protein or the expression of its encoding gene, thereby increasing plant height, making the plant shape looser, and causing the plant to ear earlier; and to downregulate the activity of the OsPLDRP1 protein or the expression of its encoding gene, thereby reducing plant height, making the plant shape more compact, and causing the plant to ear normally.

10. The use according to claim 9, characterized in that The amino acid sequence of the OsPLDRP1 protein is as described in claim 5 , and the nucleotide sequence of the gene encoding the OsPLDRP1 protein is as described in claim 5 .

Images