Application of lilium tenuifolium bHLH144 protein in plant stress resistance

Abstract

The invention relates to cloning of a stress-resistant gene LpbHLH144 of Lilium pumilum DC (Lilium pumilum DC.) and application of the stress-resistant gene LpbHLH144 of Lilium pumilum DC. Comprising the following steps: (1) cloning a target gene; (2) constructing an expression vector; and (3) detecting physiological indexes of the transgenic plant. According to the experiment, lilium tenuifolium is taken as a research object, and the LpbHLH144 gene is cloned by applying an RT-PCR technology; transforming tobacco by constructing an overexpression vector; the functions of overexpression of the LpbHLH144 for improving the saline-alkaline and drought stress of the tobacco are identified through transgenic tobacco, the functions of the lilium tenuifolium bHLH gene when the lilium tenuifolium bHLH gene is subjected to adversity stress are disclosed, a foundation is laid for further application of the lilium tenuifolium in lily breeding, and a theoretical basis is provided for the functions and effects of bHLH transcription factors.

Description

Technical Field

[0001] The present invention relates to the field of gene technology, and in particular to a stress resistance gene LpbHLH144 of Lilium truncatum and its application. The invention particularly relates to the cloning of the LpbHLH144 gene of Lilium truncatum, the construction of an expression vector, the transformation of tobacco, and the application of the gene in improving the salt, alkali and drought stress resistance of transgenic plants. Background Art

[0002] bHLH transcription factors are a very important class of transcription factors in plants, playing crucial regulatory roles in plant growth and development, resistance to abiotic stresses such as drought and salinity, signal transduction, and secondary metabolism. Numerous studies have confirmed that bHLH transcription factors play a crucial role in plant development and growth regulation, as well as in the molecular networks involved in stress response. Multiple bHLH proteins have been identified as participating in plant responses to stress, but few have been reported in Lilium truncatum.

[0003] Lilium pumilum DC., also known as mountain lily and curled lotus, is a perennial herbaceous plant with the widest distribution in the genus Lilium of the Liliaceae family, found in northern latitudes. It has considerable edible, medicinal, and ornamental applications, with its ornamental value particularly prominent in landscape gardening. Furthermore, Lilium pumilum exhibits strong salt-alkali and drought tolerance, making it an important high-quality germplasm resource for lily breeding and an ideal material for studying salt-alkali tolerance in lilies, enabling the development of new, stress-resistant lily varieties.

[0004] This experiment used Lilium truncatum as the research object, and used RT-PCR technology to clone the LpbHLH144 gene; by constructing an overexpression vector, it was transformed into tobacco using Agrobacterium-mediated method; and through transgenic tobacco, the ability of LpbHLH144-overexpressing plants to resist salt, alkali and drought stress was identified, laying the foundation for the further application of Lilium truncatum in lily breeding and providing a theoretical basis for the function and role of bHLH transcription factors. Summary of the Invention

[0005] The purpose of the present invention is to provide an excellent stress-resistant gene for Lilium truncatum and verify its function.

[0006] In order to achieve the above tasks, the present invention adopts the following technical solutions:

[0007] A salt-alkali and drought-resistant gene of Lilium tenuifolium is characterized in that the partial nucleotide sequence of the ORF open reading frame of the salt-tolerant gene of Lilium tenuifolium is shown in SEQ ID NO.1, with a length of 726 bp; the cDNA-encoded amino acid sequence thereof is shown in SEQ ID NO.1, encoding 241 amino acids.

[0008] Compared with the prior art, the stress-resistant gene of Lilium truncatum of the present invention has the following technical effects:

[0009] 1. The partial nucleotide sequence of the ORF open reading frame of the salt-alkali and drought resistance gene of Lilium tenuifolia was obtained.

[0010] 2. According to the applicant's experiments, the transfer of the lilium truncatum LpbHLH144 gene into tobacco can significantly improve the tobacco's resistance to salt, alkali and drought, and can be used to improve the salt, alkali and drought stress resistance of transgenic plants.

[0011] Cultivating tobacco varieties with strong salt tolerance can be achieved through the following steps:

[0012] 1) The salt-alkali and drought-resistance genes of Lilium tenuifolium were linked to the plant expression vector GV1300-GFP by homologous recombination to construct an overexpression vector;

[0013] 2) The constructed overexpression vector plasmid was introduced into Agrobacterium tumefaciens EHA105, and the LpbHLH144 gene was transferred into tobacco plants using the Agrobacterium-mediated method. Positive plants were screened with hygromycin, and leaves of positive plants were collected to extract DNA and RNA for molecular identification;

[0014] 3) Seeds of the selected tobacco strains and wild-type tobacco seeds were inoculated into 1 / 2 MS medium, hardened, and transplanted into soil. Tobacco plants of substantially uniform size were selected and subjected to the following treatments: The plants were subjected to 400 mM NaCl salt stress and their growth status was observed. Photos were taken after 0, 7, 14 and 21 days, and healthy leaves at the same position were cut and their physiological indicators were measured. The plants were treated with 300 mM NaHCO3 alkaline stress, and their growth status was observed. Photos were taken after 0, 7, 14 and 21 days, and healthy leaves at the same position were cut and their physiological indicators were measured. Natural drought stress treatment was carried out, and the growth status of the plants was observed. Photos were taken after 0, 7, 14 and 21 days, and healthy leaves at the same position were cut and their physiological indicators were measured. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Electrophoresis results of RNA extraction from Lilium tenuifolia bulbs;

[0016] Figure 2 Electropherogram of sequence verification of the coding region of the LpbHLH144 gene in Lilium tenuifolium;

[0017] Figure 3Electrophoresis diagram of homologous recombination verification of the LpbHLH144 gene in Lilium tenuifolia; A: LpbHLH144 homology arm cloning product; B: linearization of the plant expression vector GV1300;

[0018] Figure 4 Electrophoresis diagram of PCR verification of the recombinant plasmid bacterial solution of Lilium tenuifolia GV1300-LpbHLH144-GFP;

[0019] Figure 5 PCR identification of the bacterial solution after the LpbHLH144 gene of Lilium tenuifolium was transformed into Agro straw;

[0020] Figure 6 Identification of transgenic tobacco plants; A: PCR identification of DNA from transgenic tobacco T0 plants; B: PCR identification of cDNA from transgenic tobacco T0 plants;

[0021] Figure 7 The results of physiological index detection of transgenic tobacco after salt stress treatment are shown as follows: A is the detection result of chlorophyll content after salt stress treatment, B is the detection result of proline content after salt stress treatment, C is the detection result of malondialdehyde content after salt stress treatment, D is the detection result of electrical conductivity after salt stress treatment, E is the detection result of hydrogen peroxide (H2O2) content after salt stress treatment, F is the detection result of superoxide anion (O2 - ) content, G is the detection result of superoxide dismutase (SOD) activity after salt stress treatment, H is the detection result of peroxidase (POD) activity after salt stress treatment, and I is the detection result of catalase (CAT) activity after salt stress treatment;

[0022] Figure 8 The results of physiological index detection of transgenic tobacco after alkaline stress treatment are shown as follows: A is the detection result of chlorophyll content after alkaline stress treatment, B is the detection result of proline content after alkaline stress treatment, C is the detection result of malondialdehyde content after alkaline stress treatment, D is the detection result of electrical conductivity after alkaline stress treatment, E is the detection result of H2O2 content after alkaline stress treatment, F is the detection result of O2 - G is the detection result of SOD activity after alkali stress treatment, H is the detection result of POD activity after alkali stress treatment, and I is the detection result of CAT activity after alkali stress treatment;

[0023] Figure 9The results of physiological index detection of transgenic tobacco after drought stress treatment are shown as follows: A is the detection result of chlorophyll content after drought stress treatment, B is the detection result of proline content after drought stress treatment, C is the detection result of malondialdehyde content after drought stress treatment, D is the detection result of electrical conductivity after drought stress treatment, E is the detection result of H2O2 content after drought stress treatment, F is the detection result of O2 - G is the detection result of SOD activity after drought stress treatment, H is the detection result of POD activity after drought stress treatment, and I is the detection result of CAT activity after drought stress treatment;

[0024] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. DETAILED DESCRIPTION

[0025] Example 1 RNA extraction and cDNA synthesis from Lilium truncatum bulbs Total RNA was extracted from Lilium tenuifolium bulbs using Plant RNA Kit (OMEGA).

[0026] Use DEPC water as blank control to adjust to zero, take 1 μL RNA solution and use UV spectrophotometer to measure A260 / A280 ratio to determine RNA concentration and purity; use 1% agarose gel electrophoresis to detect the quality of extracted RNA. Figure 1 The extracted RNA was stored in a -80°C refrigerator until use.

[0027] RNA stored at -80°C was used to detect RNA concentrations of approximately 400 ng / ul. The reverse transcription kit ReverTraAce qPCR RT Kit (TOYOBO) was used according to the instructions. The total reaction volume was 50 ul, including:

[0028] The reverse transcription procedure was as follows: 37°C for 15 min; 98°C for 5 min. Immediately after the reaction, the sample was cooled on ice and stored in a -20°C refrigerator until use.

[0029] Example 2 Cloning of the coding region sequence of the LpbHLH144 gene of Lilium tenuifolium Based on the coding region sequence of the Lilium truncatum gene, specific primers were designed using Primer Premier 5: LpbHLH144-F:CTGACCTTTTCGCTTCACTTG LpbHLH144-R:AGACCCCTTGCCTCTACCTG

[0030] Cloning of the coding region sequence: Using Lilium tenuifolia cDNA as a template, PCR amplification was performed according to the instructions of the high-fidelity enzyme KOD-Plus-Neo (TOYOBO). The reaction system was: The total reaction system is 50 μl, including: The PCR amplification procedure was as follows: 95°C pre-denaturation for 2 min, 95°C denaturation for 30 sec, 55.5°C annealing for 1 min, 72°C extension for 1 min, 35 cycles, 72°C final extension for 5 min, 4°C forever; the PCR amplification results were as follows: Figure 2 The product was recovered by gel and stored in a -20℃ refrigerator.

[0031] Example 3 Construction of a plant expression vector for the Lilium truncatum LpbHLH144 gene Construction of the cloning vector: After gel recovery of the PCR product, ligate it to the pEASY-Blunt cloning vector (TransGen). Add 4 μL of gel recovery product and 1 μL of the pEASY-Blunt cloning vector to a 0.2 mL PCR tube, and gently pipette to mix. The PCR reaction was performed at 37°C for 5 minutes. Transform 5 μL of the ligated product into E. coli DH-5α. After overnight incubation, single colonies were selected for PCR verification. Bacteria with bright and clear bands were selected and sent to the company for sequencing. Plasmids from bacteria with correct sequencing results were extracted and stored in a -20°C refrigerator. Construction of plant overexpression vector: 1) Based on the LpbHLH144 gene sequence of Lilium tenuifolia and the GV1300 plant expression vector map, homologous recombination primers were designed using SnapGene software: LpbHLH144-ty-F: TTTGAACATATGCCCGTCGACATG ATGCAAAGCG LpbHLH144-ty-R: CCCTTGCTCACCATGGATCC ATTCTCGAAATTATG; 2) Using the correctly sequenced full-length cDNA plasmid as a template, the target fragment containing the homology arms was amplified by PCR, and the amplified product was recovered after 1% agarose gel electrophoresis ( Figure 3 A) After the recovered product is confirmed by electrophoresis, it is stored at -20℃. 3) Remove the GV1300 empty vector E. coli culture from the -80°C freezer and activate it. Perform PCR verification of the culture using GV1300 vector universal primers. Extract the plasmid from the GV1300 empty vector culture with the correct band position and store it at -20°C until use. GV1300-F:AACTTGTGGCCGTTTACGTCG GV1300-R:TTTGGAGAGAACACGGGGGAC; 4) The GV1300 empty vector plasmid was linearized using restriction endonucleases Sal I and BamH I (TaKaRa). The enzyme digestion system was as follows, and the PCR reaction conditions were 37°C for 20 min. The total reaction system is 50 μl, including: 5) After the reaction, the linearized vector was detected by 1.5% agarose gel electrophoresis ( Figure 3 B), the detected correct fragments were recovered using a gel recovery kit. 6) Using the ClonExpress II One-Step Cloning Kit (Novizan), the gel-recovered GV1300 linearized vector plasmid fragment and the pEASY-Blunt-LpbHLH144 insert fragment containing homology arm primers were homologously recombined. The reaction mixture was incubated in a PCR machine at 37°C for 30 minutes and then cooled on ice. The total reaction system is 20 μl, including: 7) The ligation product was transformed into E. coli DH-5α competent cells. 8) Screen on LB solid medium containing 50 mg / L kanamycin, pick out single clones and shake them for PCR identification ( Figure 4 ) all showed the target band. Bacterial cultures with the correct band location were sequenced and the results compared with the LpbHLH144 sequence. Plasmids were extracted from the correct bacterial cultures and stored at -20°C. The plant expression vector was successfully constructed and named GV1300-LpbHLH144-GFP.

[0032] Example 4 Plant expression vector transformation of Agrobacterium Freeze-thaw method for transformation of Agrobacterium tumefaciens: (1) Take competent EHA105 stored in a -80°C refrigerator, place it at room temperature or in your hand to partially melt it, and insert it into ice when it is in an ice-water mixture state; (2) Add 1 μL of recombinant plasmid to 100 μL of Agrobacterium tumefaciens and mix gently; place on ice for 5 min, freeze in liquid nitrogen for 5 min, bath in 37°C water for 5 min, and place on ice for 5 min; (3) Add 500 μl of liquid YEP medium to the centrifuge tube and incubate at 28°C, 200 rpm, and shake for 2-3 h; (4) Centrifuge at 6000 rpm for 1 min at room temperature; discard part of the supernatant and retain about 250 μl to resuspend the cells. Spread the resuspended liquid onto a YEP solid medium plate (containing 50 mg / L Kana and 30 mg / L Rif) and incubate inverted at 28°C for 2-3 days.

[0033] Pick a single colony and shake it, take 1 μl of bacterial solution for PCR identification ( Figure 5 ), the correctly detected bacterial solution was mixed with 50% glycerol and bacterial solution at a volume ratio of 1:1 to preserve the Agrobacterium bacterial solution, and stored in a -80°C refrigerator for later use.

[0034] Example 5 Positive Verification of Transgenic Tobacco The constructed overexpression vector was infected into tobacco leaves by leaf disc infection method, and transgenic tobacco resistant plants were selected by hygromycin. The resistant plants were transplanted into soil after seedling hardening and PCR detection was performed on them ( Figure 5 ).

[0035] Example 6 Verification of salt tolerance of transgenic plants Salt stress treatment: T1 transgenic tobacco was treated with 100 ml of 400 mM NaCl solution. Samples were taken at 0, 7, 14 and 21 days to measure chlorophyll, proline, malondialdehyde, conductivity, H2O2 content, O2 - Content and activity of SOD, POD and CAT. The results are as follows Figure 7 shown.

[0036] Example 7 Verification of Alkali Tolerance of Transgenic Plants Salt stress treatment: T1 transgenic tobacco was subjected to alkaline stress treatment using 100 ml of 300 mM NaHC3 solution. Samples were taken at 0, 7, 14 and 21 days to measure chlorophyll, proline, malondialdehyde, conductivity, H2O2 content, O2 - Content and activity of SOD, POD and CAT. The results are as follows Figure 8 shown.

[0037] Example 8 Verification of Drought Resistance of Transgenic Plants Drought stress treatment: The T1 transgenic tobacco was subjected to drought stress treatment using the natural drought stress treatment method. Samples were taken at 0, 7, 14 and 21 days to measure the chlorophyll, proline, malondialdehyde, conductivity, H2O2 content, and o2 - Content and activity of SOD, POD and CAT. The results are as follows Figure 9 shown.

[0038] The results showed that the transgenic tobacco plants had stronger resistance to salinity, alkali and drought. SEQ ID NO.1 Nucleotide sequence Amino acid sequence

Claims

1. Application of a stress-resistant gene of Lilium tenuifolium for improving the resistance of transgenic plants to salt, alkali and drought stress. The amino acid sequence of the protein encoded by the stress-resistant gene of Lilium tenuifolium is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that Follow these steps: 1) The salt-tolerance gene of Lilium tenuifolium and the plant expression vector GV1300-GFP were digested with double enzymes and then ligated by homologous recombination to construct a tobacco overexpression vector; 2) The tobacco overexpression vector plasmid was introduced into Agrobacterium tumefaciens EHA105 using the Agrobacterium-mediated method. The tobacco leaves were infected using the Agrobacterium-mediated method. Positive plants were selected using hygromycin. The leaves of the positive plants were collected to extract DNA and RNA for molecular identification. 3) Seeds of the selected tobacco lines and wild-type tobacco seeds were inoculated into 1 / 2 MS medium, hardened, and transplanted into soil. Tobacco plants of substantially uniform size were selected and subjected to 400 mM NaCl salt stress, 300 mM NaHCO3 alkaline stress, and natural drought stress, respectively; 4) Observe the growth status of tobacco treated with three stresses, take samples at 0, 7, 14 and 21 days, and measure the chlorophyll, proline, malondialdehyde content, conductivity, H2O2 content, O2 - The content and activities of SOD, POD and CAT.

3. Application of the LpbHLH144 gene of Lilium tiliaceum in heterologous expression to improve the salt-alkali and drought stress resistance of transgenic tobacco. The amino acid sequence of the protein encoded by the LpbHLH144 gene of Lilium tiliaceum is shown in SEQ ID NO.1.

Images