Pharmaceutical composition and application thereof

Abstract

The present invention discloses a pharmaceutical composition comprising a circular RNA and a drug delivery carrier. Compared with traditional linear 1 * siRNA and annular 1 * siRNA, the number of repeated series connection of positive-sense strands is increased to include but not limited to two or more, it is accidentally found that the silence effect is remarkably enhanced, the expression level of the PCSK9 gene can be remarkably reduced, and degradation of mRNA of PCSK9 protein is mediated. The nano-particles are used for delivering oligonucleotide, so that the stability is improved, the immunogenicity is reduced, the effects of lowering cholesterol, reducing aortic plaque load and resisting atherosclerosis are improved, and the nano-particles are safe and free of obvious liver and kidney toxicity and have a wide application prospect in the aspect of preparing medicines for treating hypercholesterolemia and coronary heart disease.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a pharmaceutical composition and application thereof. Background Art

[0002] Small-interfering RNA (siRNA) is a double-stranded small RNA composed of a sense strand and an antisense strand, characterized by at least two free bases at the 3' end of the antisense strand. After siRNA is recognized by the Argonaute-2 (AGO2) protein, the 5' end of the antisense strand binds to the MID subunit of AGO2. The N subunit of AGO2 unwinds the siRNA, and the 3' end of the antisense strand binds to the PAZ subunit of AGO2. The sense and antisense strands separate, and the antisense strand forms an RNA-induced silencing complex (RISC) with the AGO2 protein. The antisense strand guides the siRNA to the complementary target messenger RNA (mRNA), where it utilizes the endonuclease activity of the AGO2 protein to mediate the degradation of the target mRNA.

[0003] Linear siRNA double strands have strong complementary binding capabilities, making complete unwinding and separation of the sense and antisense strands relatively difficult. Partially unwound siRNAs may bind to non-target mRNAs with similar sequences, mediating nonspecific mRNA degradation, a phenomenon known as off-target effects. Linear RNAs can also be degraded by various RNases through various pathways. For example, RNase A attacks the phosphodiester bonds within RNA from the 3' end, degrading them into single bases, while RNase R unwinds RNA duplexes with higher-order structures, making them more susceptible to degradation. Furthermore, exogenous linear RNAs exhibit significant immunogenicity. Specifically, linear RNAs with 5' triphosphate modifications are readily recognized by RIG-I, activating antiviral responses and clearing exogenous linear RNAs. Furthermore, in vitro synthesized RNAs lack modified nucleotides, increasing their immunogenicity.

[0004] Circular RNA (circRNA) is a covalently closed single-stranded RNA. Its lack of a 5'-terminal triphosphate modification and a 3'-terminal polyadenylated tail prevents innate immune responses and clearance by exogenous nucleic acid sensors such as retinoic acid-induced gene protein I (RIG-I) and MDA5. Consequently, in vitro synthesized circRNAs are believed to have a long half-life in vivo and exert specific functions. Synthetic biology can be used to create novel circRNA molecules that encode target proteins with therapeutic effects. Covalently closed circRNA molecules may also be beneficial for applications such as the production of antisense RNA, aptamers, ribozymes, or siRNAs. Summary of the Invention

[0005] In order to solve at least one of the above technical problems, the present invention discloses a pharmaceutical composition comprising circular RNA and a drug delivery vector, wherein the circular RNA comprises two or more RNA sense chain sequences connected in series, for example, 2 to 8, for example, 2, 3, 4, 5, 6, 7, or 8 RNA sense chain sequences, and any two adjacent RNA sense chain sequences in the RNA sense chain sequences are separated by at least one spacer sequence.

[0006] In some embodiments, the drug delivery carrier is selected from one or more of nanosuspensions, nanoparticles, micelles, liposomes, nanoemulsions, lipid nanoparticles, and in situ gels, preferably nanoparticles.

[0007] In some embodiments, the nanoparticle is selected from lipid nanoparticles (LNPs), core-shell nanoparticles, biodegradable nanoparticles, biodegradable lipid nanoparticles, polymer nanoparticles, polyplexes, or biodegradable polymer nanoparticles.

[0008] In some embodiments, the circular RNA is combined with a drug delivery vehicle.

[0009] In some embodiments, the combination of the circular RNA and the drug delivery carrier includes filling, embedding, coating, covalent conjugation or non-covalent conjugation.

[0010] In some embodiments, the drug delivery vehicle is selected from lipid nanoparticles comprising: 1) cationic lipids or lipid polymers, 2) non-cationic lipids, 3) PEG-modified lipids, and 4) sterols.

[0011] In some embodiments, the sterol is selected from at least one of cholesterol, lanosterol, 5α-cholestane-3β-ol, coprostanol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, or α-tocopherol.

[0012] In some embodiments, the sterol is cholesterol.

[0013] In some embodiments, in the lipid nanoparticles, the molar ratio of cationic lipid:sterol:non-cationic lipid:PEG-modified lipid is (25-100):(20-80):(5-20):(0.4-5), preferably 50:38:10:1.5.

[0014] In some embodiments, in the lipid nanoparticles, the molar ratio of lipid polymer:sterol:non-cationic lipid:PEG-modified lipid is (1-20):(20-80):(5-20):(0.2-5), preferably 4.5:31:10:0.4.

[0015] In some embodiments, the cationic lipid is selected from: ALC-0315 (CAS No.: 2036272-55-4), N,N-dioleoyl-N,N-dimethylammonium chloride (DODAC), N,N-distearoyl-N,N-dimethylammonium bromide (DDAB), 1,2-dioleoyltrimethylammonium chloride propane (DOTAP), C12-200 (CAS No.: 1220890-25-4), DLin-KC2-DMA (CAS No.: 1190197-97-7), DODAP (CAS No.: 127512-29-2) or HGT4003 (CAS No.: 1415795-37-7); and / or, the non-cationic lipid includes a neutral lipid The lipid is selected from distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), or dimyristoylphosphatidylethanolamine (DMPE); and / or the PEG-modified lipid is selected from PEGylated diacylglycerol (PEG-DAG).

[0016] In some embodiments, the PEG-modified lipid is selected from 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (DMG-PEG), PEGylated phosphatidylethanolamine (PEG-PE), and PEG-succinate-diacylglycerol (PEG-S-DAG).

[0017] In some embodiments, the PEG-succinate-diacylglycerol (PEG-S-DAG) is selected from 4-O-(2',3'-di-tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG), PEGylated ceramide (PEG-Cer), or PEG dialkoxypropyl carbamate.

[0018] In some embodiments, the lipid nanoparticles further comprise DMG-PEG2K.

[0019] In some embodiments, the average molecular weight of the PEG moiety in the PEG-modified lipid can range from about 500 to about 8000 Daltons, e.g., 1000, 2000, 3000, 4000, 5000, 6000, 7000, or 8000 Daltons.

[0020] In some embodiments, the lipid nanoparticles further comprise polyethyleneimine (PEI).

[0021] In some embodiments, the lipid polymer is obtained by reacting a compound of formula (I) or polyethyleneimine with a compound of formula (II).

[0022]

[0023] In some embodiments, the compound of formula (II) is selected from:

[0024]

[0025]

[0026] In some embodiments, the lipid polymer is P6-Cit-100, which is obtained by reacting polyethyleneimine and citronellol acrylate.

[0027] In some embodiments, the polyethyleneimine is a branched polyethyleneimine.

[0028] In some embodiments, the molecular weight of the branched polyethyleneimine is 300-10,000.

[0029] In some embodiments, the molecular weight of the branched polyethyleneimine is 400-2000.

[0030] In some embodiments, the molecular weight of the branched polyethyleneimine is 500-1800.

[0031] In some embodiments, the molecular weight of the branched polyethyleneimine is 500-700.

[0032] In some embodiments, the molecular weight of the branched polyethyleneimine is 600.

[0033] In some embodiments, the reaction feed ratio of the compound of formula (I) or polyethyleneimine and the compound of formula (II) is 40 mg: 0.4-1.8 mmoL.

[0034] In some embodiments, the reaction feed ratio of the compound of formula (I) or polyethyleneimine and the compound of formula (II) is 40 mg: 0.7-1.5 mmoL.

[0035] In some embodiments, the reaction feed ratio of the compound of formula (I) or polyethyleneimine and the compound of formula (II) is 40 mg: 0.8-0.9 mmoL, or 40 mg: 1.3-1.4 mmoL.

[0036] In some embodiments, the lipid nanoparticles comprise: (1) C12-200, DOPE, cholesterol, DMG-PEG; or (2) ALC-0315, cholesterol, DSPC, and DMG-PEG; or (3) P6-Cit-100, cholesterol, DSPC, and DMG-PEG.

[0037] In some embodiments, lipid nanoparticles have a diameter of about 50nm to about 300nm, such as about 50nm to about 250nm, for example, about 50nm to about 200nm. In some embodiments, smaller lipid nanoparticles can be used. Such particles can comprise a diameter from 0.1pm to 100nm. In other embodiments, smaller lipid nanoparticles can be used to deliver nucleic acids, for example, a diameter of about 1nm to about 100nm, about 1nm to about 20nm, about 1nm to about 40nm, about 1nm to about 60nm, about 1nm to about 80nm, about 5nm to about 100nm, about 10 to about 50nm, about 20 to about 50nm, about 30 to about 50nm, about 30 to about 60nm, about 40 to about 60nm, about 20 to about 70nm, about 50 to about 70nm, about 60 to about 70nm, about 30 to about 80nm, or about 20 to about 90nm. In some embodiments, the lipid nanoparticles may have a diameter greater than 100 nm, greater than 200 nm, greater than 300 nm, greater than 400 nm, greater than 500 nm, greater than 600 nm, greater than 700 nm, greater than 800 nm, greater than 900 nm, or greater than 1000 nm.

[0038] In some embodiments, the lipid nanoparticles have a particle size of 78.88 nm.

[0039] In some embodiments, the particle size of the pharmaceutical composition is comprised between 100 and 1000 nm.

[0040] In some embodiments, the particle size of the pharmaceutical composition has a diameter of about 200 nm to about 800 nm, such as about 200 nm to about 700 nm. In some embodiments, smaller lipid nanoparticles can be used. Such particles can include a diameter of from 200 nm to 500 nm. In other embodiments, smaller lipid nanoparticles can be used to deliver nucleic acids, for example, a diameter of about 2 nm to about 300 nm. In some embodiments, the lipid nanoparticles can have a diameter greater than 300 nm, greater than 400 nm, greater than 500 nm, or greater than 600 nm.

[0041] In some embodiments, the mass ratio of the drug delivery vector to the circular RNA is selected from 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1 or 20:1.

[0042] In some embodiments, the circular RNA anneals to at least one linear antisense strand to form a circular siRNA.

[0043] In some embodiments, the molar ratio of the linear antisense strand to the circular RNA in the composition is selected from 1:1 to 8:1.

[0044] In some embodiments, the molar ratio of the linear antisense strand to the circular RNA in the composition is selected from 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1 or 8:1.

[0045] In some embodiments, the circular RNA comprises 4 sense strand sequences connected in series. In other embodiments, the circular RNA may also comprise more sense strand sequences connected in series, for example, 5 to 16, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 sense strand sequences. In other embodiments, the circular RNA may also comprise fewer sense strand sequences connected in series, for example, 2 or 3 sense strand sequences. In the case of comprising more than 2 sense strand sequences, preferably, these sense strand sequences are identical to each other, and / or any two adjacent sense strand sequences are separated by at least one spacer sequence. In some embodiments, these sense strand sequences may also be different, for example, different from each other, or at least partially different from the rest.

[0046] In some embodiments, the sense strand sequence has a length of 18 to 24 nucleotides, for example, 18, 19, 20, 21, 22, 23, 24, preferably 21 nucleotides, and / or the linear antisense strand has a length of 21 to 27 nucleotides, for example, 21, 22, 23, 24, 25, 26, 27, preferably 24 nucleotides.

[0047] In some embodiments, the sense strand sequence comprises an RNA sequence corresponding to a DNA sequence as shown in SEQ ID NO. 6 or 42, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto, and / or the antisense strand sequence comprises an RNA sequence corresponding to a DNA sequence as shown in SEQ ID NO. 36 or 41, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

[0048] In some embodiments, the circular RNA and / or the at least one linear antisense strand sequence comprises at least one nucleotide modification and / or at least one chemical modification.

[0049] In yet other embodiments, the number of antisense strand sequences in the circular RNA is different from the number of sense strand sequences, for example, less than the number of sense strand sequences.

[0050] In some embodiments, the circular RNA has low immunogenicity.

[0051] In some embodiments, the linear antisense sequence targets mRNA that translates PCSK9 protein.

[0052] In some embodiments, the circular RNA and / or the at least one linear antisense strand are formed from unmodified, partially modified, or fully modified linear RNA polynucleotides.

[0053] In some embodiments, the circular RNA is formed by unmodified, partially modified, or fully modified linear RNA polynucleotides that are capable of self-splicing under the mediation of guanosine triphosphate (GTP).

[0054] In some embodiments, the circular RNA and / or the at least one linear antisense strand comprises at least one nucleotide modification. In some embodiments, the at least one nucleotide modification is a cytidine modification, a uridine modification, or an adenosine modification. In some embodiments, the at least one nucleotide modification is selected from 5-methylcytosine (m5C), N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ), and 5-methoxyuridine (5moU).

[0055] In some embodiments, the circular RNA and / or the at least one linear antisense strand further comprises at least one chemical modification. The chemical modification may comprise an internucleoside linkage modification, a nucleobase modification, a sugar modification, or a combination thereof.

[0056] In some embodiments, the chemical modification is selected from LNA, ENA, HNA, CeNA, 2'-O-methoxyalkyl (e.g., 2'-O-methoxymethyl, 2'-O-methoxyethyl, or 2'-O-2-methoxypropyl), 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-ON-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-O-aminopropyl (2'-O-AP), 2'-ara-F, L-nucleoside modifications (e.g., 2'-modified L-nucleosides, such as 2'-deoxy-L-nucleosides), BNA racemose, racemic cyclic alkyl, and open chain alkyl, and combinations thereof.

[0057] In some embodiments, the chemical modification is a 2'-modification selected from 2'-O-methyl, 2'-deoxy, 2'-fluoro, and combinations thereof.

[0058] In some embodiments, about 100%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35% or 30% of all nucleotides are modified, i.e., the above proportions of all nucleotides present in the circular siRNA contain modifications as described herein.

[0059] In some embodiments, all nucleotides in the sense strand are modified. In some embodiments, each nucleotide in the sense strand is independently modified with a 2'-modification selected from 2'-O-methyl, 2'-deoxy, 2'-fluoro, and combinations thereof. In some embodiments, all nucleotides in the antisense strand are modified. In some embodiments, each nucleotide in the antisense strand is independently modified with a 2'-modification selected from 2'-O-methyl, 2'-deoxy, 2'-fluoro, and combinations thereof.

[0060] In some embodiments, at least 50% of the nucleotides in the circular siRNA are independently modified with 2'-O-methyl, 2'-O-allyl, 2'-deoxy, or 2'-fluoro.

[0061] In some embodiments, the circular RNA further comprises a 5' exonic element and a 3' exonic element, wherein the 5' exonic element and the 3' exonic element are derived from natural exons of the same self-splicing intron, preferably, the self-splicing intron is selected from Anabaena group I introns, T4 phage group I introns or Azotobacter sp. BH72 group I introns.

[0062] In some embodiments, the circular RNA is derived from a nucleic acid construct comprising, in the following order from 5' to 3' direction, a first circularization element, optionally at least one first restriction enzyme recognition sequence, at least one target sequence, optionally at least one second restriction enzyme recognition sequence, and a second circularization element, wherein the RNA sense strand sequence can be transcribed from the target sequence.

[0063] In some embodiments, the first circularization element comprises a 5' intronic element and a 5' exonic element in sequence, and the second circularization element comprises a 3' exonic element and a 3' intronic element in sequence.

[0064] In some embodiments, the 5' intronic element and the 3' intronic element are derived from the same self-splicing intron, in particular, the 5' intronic element is derived from or contains the 5' terminal portion of the self-splicing intron, and the 3' intronic element is derived from or contains the 3' terminal portion of the self-splicing intron.

[0065] In some embodiments, the 5' intron element comprises a first portion of a group I intron from Anabaena, and the 3' intron element comprises a second portion of a group I intron from Anabaena, or

[0066] The 5' intron element comprises a first portion from a class I intron of bacteriophage T4, and the 3' intron element comprises a second portion from a class I intron of bacteriophage T4, or

[0067] The 5' intronic element includes a first portion of a group I intron from Azotobacter sp. BH72, and the 3' intronic element includes a second portion of a group I intron from Azotobacter sp. BH72.

[0068] In some embodiments, the 5' intron element comprises the sequence shown in SEQ ID NO.4, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto; and / or the 5' exon element comprises the sequence shown in SEQ ID NO.5, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto; and / or the 3' intron element comprises the sequence shown in SEQ ID NO.13, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto; and / or the 3' exon element comprises the sequence shown in SEQ ID NO.12, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

[0069] In some embodiments, the first restriction enzyme recognition sequence is the same as or different from the second restriction enzyme recognition sequence, and at least one of the first restriction enzyme recognition sequence is selected from the recognition sequence of the following restriction endonucleases: Spe I, Age I, HindIII, BglII, Kpn I, Xho I, Sac II, Not I, BamH I, or Xba I;

[0070] In some embodiments, at least one of the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence comprises a sequence selected from the following: ACTAGT (SEQ ID NO.14 (Spe I)), ACCGGT (SEQ ID NO.15 (AgeI)), AAGCTT (SEQ ID NO.43 (Hind III)), AGATCT (SEQ ID NO.44 (Bgl II)), GGTACC (SEQ ID NO.45 (Kpn I)), CTCGAG (SEQ ID NO.46 (Xho I)), CCGCGG (SEQ ID NO.47 (Sac II)), GCGGCCGC (SEQ ID NO.48 (Not I)), GGATCC (SEQ ID NO.49 (BamH I)), TCTAGA (SEQ ID NO.50 (Xba I)).

[0071] In some embodiments, the spacer sequence has a length of 2 to 40 nucleotides, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides.

[0072] In some embodiments, the spacer sequence is a polyAC sequence. In one embodiment, the spacer sequence comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% polyAC content. In one embodiment, the spacer sequence comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% polypyrimidine (C / T or C / U) content. As used herein, "polyAC" refers to a polynucleotide or a portion of a polynucleotide consisting of nucleotides containing adenine or cytosine.

[0073] In some embodiments, the spacer sequence comprises any one of the following sequences or a combination thereof: a sequence shown in SEQ ID NOs. 7 to 11, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

[0074] As used herein, the term "spacer" or "spacer sequence" refers to a non-functional sequence that physically separates two functional sequences from each other. In some embodiments, the nucleic acid construct further comprises at least one spacer sequence. In other embodiments, the nucleic acid construct comprises two or more spacer sequences. In some embodiments, when the nucleic acid construct comprises more than two target sequences, any two adjacent target sequences are separated by at least one spacer sequence.

[0075] In some embodiments, the spacer sequence comprises any one of the following sequences or a combination thereof: a sequence shown in SEQ ID NOs. 7 to 11, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

[0076] In some embodiments, the target sequence comprises a sequence as shown in SEQ ID NO. 6 or SEQ ID NO. 42, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

[0077] In some embodiments, the circular RNA includes, in sequence, a 5' exonic element, optionally a first spacer sequence, optionally a first restriction enzyme recognition sequence, at least one RNA sense strand sequence, optionally a second restriction enzyme recognition sequence, optionally a second spacer sequence, and a 3' exonic element.

[0078] In some embodiments, the linear RNA polynucleotide is transcribed from the nucleic acid construct, for example, by in vitro transcription.

[0079] In some embodiments, the nucleic acid construct comprises, in the following order, a first circularization element, optionally at least one first restriction enzyme recognition sequence, at least one target sequence, optionally at least one second restriction enzyme recognition sequence, and a second circularization element.

[0080] In some embodiments, the nucleic acid construct comprises two or more target sequences linked in series, for example, 2 to 8, for example, 2, 3, 4, 5, 6, 7, or 8 target sequences. In some embodiments, the nucleic acid construct comprises four target sequences linked in series. In other embodiments, the nucleic acid construct may also comprise more target sequences linked in series, for example, 8 to 16, for example, 8, 9, 10, 11, 12, 13, 114, 15, or 16 target sequences. When comprising two or more target sequences, preferably, these target sequences are identical to each other.

[0081] In some embodiments, the target sequence has a length of 18 to 24 nucleotides, such as 18, 19, 20, 21, 22, 23, 24, preferably 21 nucleotides.

[0082] The first and second circularization elements comprise homology region sequences complementary to a nucleic acid and / or protein-based system capable of RNA ligation, the system being selected from RNA ligating DNA enzymes, CRISPR / dCas9-DNA Ligase, and intron-exon mediated ligation.

[0083] The first and second circularization elements are designed to enable the production of circular positive-sense RNA by different methods, including but not limited to DNAse-mediated RNA circularization, CRISPR-dCas9-ligase-mediated RNA circularization, and self-splicing-mediated RNA circularization.

[0084] The most studied circularization strategy currently is self-splicing-mediated RNA circularization, which utilizes the autocatalytic splicing reaction of intronic ribozymes to construct a PIE (permuted intron-exon) system based on different types of introns to achieve RNA circularization. This system excises and replaces the natural introns and exons to form a new intron-exon construct. The target sequence is inserted into this construct, and after transcription, circular RNA is synthesized through in vitro reverse splicing. In this system, the intron fragment is dropped during self-splicing, and the circularization is completed by connecting the two flanking exon fragments.

[0085] Thus, in some embodiments, the first circularization element comprises, in sequence, a 5' intronic element and a 5' exonic element, and the second circularization element comprises, in sequence, a 3' exonic element and a 3' intronic element.

[0086] In some embodiments, the 5' intron element and the 3' intron element are derived from the same self-splicing intron, such as a naturally occurring self-splicing intron. In some embodiments, the 5' intron element is derived from or contains the 5' terminal portion of a self-splicing intron, and the 3' intron element is thus derived from or contains the 3' terminal portion of a self-splicing intron. In some embodiments, the combination of the 5' intron element and the 3' intron element retains the self-splicing activity of the self-splicing intron.

[0087] In some embodiments, the 5' intron element comprises a first portion from an Anabaena group I intron, particularly an enhanced Anabaena group I intron, and the 3' intron element comprises a second portion from an Anabaena group I intron, particularly an enhanced Anabaena group I intron. In still other embodiments, the 5' intron element comprises a first portion from a T4 phage group I intron, particularly an enhanced T4 phage group I intron, and the 3' intron element comprises a second portion from a T4 phage group I intron, particularly an enhanced T4 phage group I intron.

[0088] In some embodiments, the 5' exon region is derived from the 5' native exon of a group I intron of an Anabaena pre-tRNA-Leu gene. The 5' native exon of the group I intron of the Anabaena pre-tRNA-Leu gene comprises the nucleotide sequence of SEQ ID NO. 5. In some embodiments, the 3' exon region is derived from the 3' native exon of a group I intron of an Anabaena pre-tRNA-Leu gene. The 3' native exon of the group I intron of the Anabaena pre-tRNA-Leu gene comprises the nucleotide sequence of SEQ ID NO. 12.

[0089] In some embodiments, the 5' exon region is derived from the 5' native exon of the group I intron of the td gene of T4 phage. The 5' native exon of the td gene of T4 phage comprises the nucleotide sequence of SEQ ID NO. 52. In some embodiments, the 3' exon region is derived from the 3' native exon of the group I intron of the td gene of T4 phage. The 3' native exon of the td gene of T4 phage comprises the nucleotide sequence of SEQ ID NO. 54.

[0090] In some embodiments, the 5' exon region is derived from the 5' native exon of the group I intron of the pre-tRNA-Ile gene of Azotobacter sp. BH72. The 5' native exon of the pre-tRNA-Ile gene of Azotobacter sp. BH72 comprises the nucleotide sequence of SEQ ID NO. 56. In some embodiments, the 3' exon region is derived from the 3' native exon of the group I intron of the pre-tRNA-Ile gene of Azotobacter sp. BH72. The 3' native exon of the pre-tRNA-Ile gene of Azotobacter sp. BH72 comprises the nucleotide sequence of SEQ ID NO. 58.

[0091] In some embodiments, the 5' intronic element comprises the sequence set forth in SEQ ID NO. 51, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 5' exonic element comprises the sequence set forth in SEQ ID NO. 52, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' intronic element comprises the sequence set forth in SEQ ID NO. 53, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' exonic element comprises the sequence set forth in SEQ ID NO. 54, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto.

[0092] In some embodiments, the 5' intronic element comprises the sequence set forth in SEQ ID NO. 55, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 5' exonic element comprises the sequence set forth in SEQ ID NO. 56, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' intronic element comprises the sequence set forth in SEQ ID NO. 57, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' exonic element comprises the sequence set forth in SEQ ID NO. 58, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto.

[0093] In some embodiments, the 5' intronic element comprises the sequence set forth in SEQ ID NO. 4, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 5' exonic element comprises the sequence set forth in SEQ ID NO. 5, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' intronic element comprises the sequence set forth in SEQ ID NO. 13, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' exonic element comprises the sequence set forth in SEQ ID NO. 12, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto.

[0094] In some embodiments, the 5' exon element and the 3' exon element are covalently linked. In some embodiments, the 5' end of the 5' exon element is covalently linked to the 3' end of the 3' exon element. In some embodiments, the sense strand sequence has a length of 18 to 24 nucleotides, such as 18, 19, 20, 21, 22, 23, 24, and preferably 21 nucleotides.

[0095] The first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence can be the same or different. In some embodiments, the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence are different.

[0096] In some embodiments, at least one of the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence is selected from the recognition sequences of the following restriction endonucleases: Spe I, Age I, HindIII, Bgl II, Kpn I, Xho I, Sac II, Not I, BamHI, and Xba I.

[0097] In some embodiments, at least one of the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence comprises a sequence selected from the group consisting of: A↓CTAGT (SEQ ID NO.14 (Spe I)), A↓CCGGT (SEQ ID NO.15 (Age I)), A↓AGCTT (SEQ ID NO.39 (Hind III)), A↓GATCT (SEQ ID NO.40 (Bgl II)), GGTAC↓C (SEQ ID NO.41 (Kpn I)), C↓TCGAG (SEQ ID NO.42 (Xho I)), CCGC↓GG (SEQ ID NO.43 (Sac II)), GC↓GGCCGC (SEQ ID NO.44 (Not I)), G↓GATCC (SEQ ID NO.45 (Bam HI)), and T↓CTAGA (SEQ ID NO.46 (Xba I)), wherein ↓ represents an enzyme cleavage site.

[0098] Inserting the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence into the nucleic acid construct allows for easy replacement of the at least one target sequence with any desired target sequence, such as a DNA polynucleotide sequence corresponding to a therapeutic RNA, siRNA or miRNA.

[0099] In some embodiments, wherein the nucleic acid construct is contained in the expression vector, the expression vector further comprises at least one RNA polymerase promoter.

[0100] In some embodiments, the at least one RNA polymerase promoter is derived from a virus and is selected from the group consisting of a T7 RNA polymerase promoter, an SP6 RNA polymerase promoter, a T3 RNA polymerase promoter, a T6 RNA polymerase promoter, a T4 RNA polymerase promoter, and a K11 RNA polymerase promoter.

[0101] In some embodiments, the expression vector is a plasmid expression vector, preferably an Escherichia coli plasmid expression vector, such as pET-28a, pET-32a, pGEX4T-1, or pUC57 plasmid expression vector.

[0102] In some embodiments, the RNA polymerase promoter has a sequence as shown in SEQ ID NO. 3, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

[0103] In some embodiments, the expression vector comprises a sequence as shown in SEQ ID NO. 51, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

[0104] In some embodiments, a linear RNA polynucleotide is obtained by transcription of the nucleic acid construct. The linear RNA polynucleotide may be unmodified, partially modified, or completely modified. In some embodiments, the linear RNA comprises at least one nucleotide modification. In some embodiments, up to 100% of the nucleotides of the linear RNA are modified. In some embodiments, the at least one nucleotide modification is a cytidine modification, a uridine modification, or an adenosine modification. In some embodiments, the at least one nucleotide modification is selected from 5-methylcytosine (m5C), N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ), and 5-methoxyuridine (5moU). In some embodiments, the circular RNA comprises less than 100%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 15%, less than 10%, less than 5%, or less than 1% of a specific nucleotide modification. As used herein, the percentage of a particular nucleotide modification refers to the ratio of nucleotides in a sequence that have undergone that particular modification to nucleotides that can undergo that particular modification. In some embodiments, the circular RNA is unmodified. In some embodiments, the circular RNA does not comprise a nucleotide modification.

[0105] In some embodiments, the linear RNA polynucleotide undergoes self-splicing mediated by guanosine triphosphate (GTP) to form a circular or substantially circular structure.

[0106] In some embodiments, the transcription is performed in cells selected from Escherichia coli (E. Coli) cells, particularly BL21 (DE3) competent cells.

[0107] In some embodiments, the method further comprises a step of amplifying the recombinant host cell. In some embodiments, the amplification comprises a step of amplifying the recombinant host cell from 50 ml of bacterial solution to 1 L of bacterial solution, theoretically amplifying the circRNA by 20 times.

[0108] In a second aspect of the present invention, a method for producing the circular RNA is provided, which comprises at least the following steps: a. transforming a host cell with the expression vector; b. subjecting the obtained recombinant host cell to incubation under growth conditions to allow replication of the expression vector; c. adding an inducer to induce expression of the circular RNA; and optionally, d. purifying the obtained circular RNA.

[0109] In some embodiments, the host cell is selected from Escherichia coli cells, particularly BL21 (DE3) competent cells.

[0110] In some embodiments, the inducing agent is selected from isopropylthiogalactoside (IPTG).

[0111] In some embodiments, the step of adding an inducing agent for induction is carried out at 18°C for about 12 to 24 hours, for example, about 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours or any value therebetween, preferably about 18 hours. The inventors have found that long-term induction at 18°C, such as overnight induction, can produce more circular RNA than induction at a higher temperature (such as 37°C) for a short time (such as 3 hours). In some embodiments, induction at 18°C for 18 hours produces at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times or more circular RNA than induction at 37°C for 3 hours.

[0112] In a third aspect of the present invention, a method for inhibiting the expression of a disease-related protein in a cell is provided, the method comprising:

[0113] (a) contacting the cell with the pharmaceutical composition according to the first aspect and maintaining the contact for a period of time, thereby inhibiting the expression of disease-related proteins in the cell.

[0114] In some embodiments, the cell is in a subject.

[0115] In some embodiments, the disease associated protein is inhibited by at least about 50%.

[0116] In a fourth aspect of the present invention, there is provided use of the pharmaceutical composition of the first aspect in preparing a medicament for treating a disease in a subject.

[0117] In some embodiments, the drug mediates degradation of mRNA of a disease-associated protein.

[0118] In some embodiments, the disease-related protein is selected from PCSK9, APOC3, ANGPTL4, LPA, ATN1 protein, ataxia protein, huntingtin protein, and BACE1.

[0119] In some embodiments, the medicament is for treating a disorder mediated by PCSK9 expression in a subject.

[0120] In some embodiments, the disorder comprises hypercholesterolemia, atherosclerosis, hypertriglyceridemia, familial hypercholesterolemia, fatty liver disease, dyslipidemia, hyperlipoproteinemia, atherosclerosis, diabetes and its complications, metabolic syndrome, cardiovascular disease, or elevated cholesterol caused by a genetic condition.

[0121] In some embodiments, the hypertriglyceridemia comprises severe hypertriglyceridemia.

[0122] In some embodiments, the fatty liver disease comprises non-alcoholic fatty liver disease (NFLD) or non-alcoholic steatohepatitis (NASH).

[0123] In some embodiments, the hyperlipoproteinemia includes type I hyperlipoproteinemia and type V hyperlipoproteinemia.

[0124] In some embodiments, the dyslipidemia comprises mixed dyslipidemia.

[0125] In some embodiments, the type I hyperlipoproteinemia includes three subtypes: type Ia, also known as Berger-Glütz syndrome or familial hyperchylomicronemia; type Ib, also known as familial apolipoprotein CII deficiency; and type Ic.

[0126] In some embodiments, the diabetes and its complications include type II diabetes, diabetic nephropathy, diabetic neuropathy, and diabetic retinopathy.

[0127] In some embodiments, the cardiovascular disease comprises coronary artery disease.

[0128] In some embodiments, the subject comprises a mammal.

[0129] In some embodiments, the mammal comprises a primate or a rodent.

[0130] In some embodiments, the primate comprises a human, an ape, or a monkey.

[0131] In some embodiments, the rodent comprises a rat, a mouse, a guinea pig, a hamster, or a vole.

[0132] In some embodiments, the pharmaceutical composition degrades mRNA capable of translating the disease-associated protein.

[0133] In some embodiments, the antisense strand in the pharmaceutical composition can be complementary or reverse complementary to the mRNA of the disease-associated protein.

[0134] In some embodiments, the pharmaceutical composition has one or more of the following effects:

[0135] 1) Reduce the expression level of PCSK9 gene;

[0136] 2) mediate the degradation of PCSK9 protein mRNA;

[0137] 3) Increase LDLR protein levels;

[0138] 4) Lowering LDL-C levels;

[0139] 5) reduce aortic plaque burden;

[0140] 6) No obvious hepatotoxicity or renal toxicity;

[0141] 7) Has low immunogenicity.

[0142] In some embodiments, the low immunogenicity includes not increasing or not significantly increasing the mRNA level of TNF, IFNB1, RIG-I, or IL-6.

[0143] In some embodiments, the drug is in one or more of the following forms: solution, powder, microencapsulated powder, capsule, tablet, paste, lozenge, granule, emulsion, suspension, spray formulation, aerosol, electrostatic spray formulation, suppository, etc.

[0144] In some embodiments, the administration of the drug includes systemic administration and / or local administration.

[0145] In some embodiments, the systemic administration includes oral and parenteral administration methods, such as intravenous administration, intraperitoneal administration, etc.

[0146] In some embodiments, the topical administration includes transdermal, intranasal, and inhalation administration, etc.

[0147] Beneficial effects

[0148] The present invention discloses a pharmaceutical composition comprising circular RNA and a drug delivery vector. Compared with traditional linear 1×siRNA and circular 1×siRNA, the present invention increases the number of sense strand repeats in series to include but not limited to more than 2, and surprisingly found that the silencing effect was significantly enhanced, the expression level of the PCSK9 gene was significantly reduced, and the degradation of the mRNA of the PCSK9 protein was mediated. The use of nanoparticles to deliver oligonucleotides increases stability, reduces immunogenicity, and enhances the cholesterol-lowering, aortic plaque-reducing, and anti-atherosclerotic effects. It is safe and has no obvious hepatotoxicity or renal toxicity, and has broad application prospects in the preparation of therapeutic drugs for hypercholesterolemia and coronary heart disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0149] Figure 1 The design principle of the positive-strand RNA of circular 4×siRNA is exemplified.

[0150] Figure 2 The results showed that after adding IPTG to 50 ml of bacterial solution and inducing at 18°C for 18 hours, the expression level of circular RNA was higher than that of inducing at 18°C for 3 hours, 37°C for 3 hours, and 37°C for 18 hours, indicating that induction at 18°C for 18 hours is most effective in increasing circular RNA production.

[0151] Figure 3It shows that after the circular 4× siRNA is treated with DNase I, RNase R and recovered by gel excision, a significant band can be enriched at the 200nt position.

[0152] Figure 4 This shows that the 5' exon and the 3' exon were successfully linked.

[0153] Figure 5 The bands showing the binding of circular 4× sense strand RNA to linear antisense strands show that as the circular sense strand increases, the charge carried by the double-stranded siRNA increases, and the migration distance of the bands gradually increases.

[0154] Figure 6 Shown are qRT-PCR results, demonstrating that circular 4×siCopGFP reduced CopGFP mRNA expression levels compared to linear siCopGFP, circular and linear negative control siRNAs, and the control group.

[0155] Figure 7 The results showed that the circular 4×siCopGFP reduced the green fluorescence density of CopGFP compared with the linear siCopGFP, the circular and linear negative control siRNA and the control group under a fluorescence microscope.

[0156] Figure 8 Shown are qRT-PCR results, which show the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP, and C-4×-siPCSK9 on IL-6, TNF, IFNB1, and RIG-I mRNA.

[0157] Figure 9 Shown are qRT-PCR results showing the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP, and C-4×-siPCSK9 on PCSK9 mRNA on days 3 (A) and 7 (B) of transfection, as well as without and in combination with high-strength atorvastatin (C).

[0158] Figure 10 Western blot results are shown, showing the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP, and C-4×-siPCSK9 on LDLR, PCSK9, and GAPDH on day 3 (A) and day 7 (B) of transfection, as well as the effects on LDLR, PCSK9, and GAPDH in the absence of atorvastatin and in combination with high-intensity atorvastatin (C).

[0159] Figure 11Shown are qRT-PCR results, which show the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP, and C-4×-siPCSK9 on IL-6, TNF, IFNB1, and RGIG-I mRNA on days 3 and 7 of transfection.

[0160] Figure 12 Shown are qRT-PCR results showing the effects of no atorvastatin and high-strength atorvastatin combined with control, AS-siPCSK9, L-1×-siPCSK9, and C-4×-siPCSK9, respectively, on IL-6, TNF, IFNB1, and RGIG-I mRNA.

[0161] Figure 13 The figure shows the inhibitory effect of circular siPCSK9 with different numbers of sense chains in series on PCSK9 mRNA.

[0162] Figure 14 The structural formulas of citronellol acrylate, PEI600, and P6-Cit-100 are shown. Figure 14 A shows the structural formula of citronellol acrylate, Figure 14 B shows the structural formula of PEI600, Figure 14 C shows the structural formula of P6-Cit-100, wherein n=5-50, Figure 14 D shows the NMR spectrum of P6-CIT-100.

[0163] Figure 15 The particle size distribution of LNP-encapsulated linear and cyclic siPcsk9 is shown.

[0164] Figure 16 Shown are the charge changes after LNP encapsulation of linear and cyclic siPcsk9.

[0165] Figure 17 The morphology of LNP-encapsulated linear and circular siPcsk9 under negative staining electron microscopy is shown.

[0166] Figure 18 The results show that LNP-encapsulated linear and circular siPcsk9 can inhibit ApoE in high-fat diet for 8 weeks. - / - Effect of PCSK9 protein concentration in mouse serum.

[0167] Figure 19 The results show that LNP-encapsulated linear and circular siPcsk9 can inhibit ApoE in high-fat diet for 8 weeks. - / - Effect of serum LDL-C concentration in mice.

[0168] Figure 20The results show that LNP-encapsulated linear and circular siPcsk9 can inhibit ApoE in high-fat diet for 12 weeks. - / - Effects of aortic plaque burden on mice.

[0169] Figure 21 Shown are the changes in PCSK9 and LDL-C over time after injection of PBS, circ-siPcsk9 without LNP encapsulation, and circ-siPcsk9 with LNP encapsulation into C57BL6 mice.

[0170] Figure 22 Shown are the serum ALT and creatinine levels of C57BL6 mice 12 weeks after injection of PBS, circ-siPcsk9 without LNP encapsulation, and circ-siPcsk9 with LNP encapsulation. DETAILED DESCRIPTION

[0171] To make the objectives, technical solutions, and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the following examples. The specific embodiments described herein are intended only to illustrate the present invention and are not intended to limit the present invention in any way. In addition, in the following description, descriptions of known structures and technologies are omitted to avoid unnecessary confusion about the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0172] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0173] As used herein, the articles "a," "an," and "an" include plural referents unless the context clearly dictates otherwise.

[0174] As used herein, the terms "include," "comprising," "having," "may," "containing," and variations thereof are generally intended to be open transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. The term "consisting of" generally indicates that no other components (or, similarly, features, integers, steps, etc.) can be present.

[0175] As used herein, the term "about" can be used to encompass variations of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from a particular value.

[0176] The term "nucleic acid" refers to any DNA or RNA molecule.

[0177] As used herein, the terms "ribonucleic acid," "RNA," and "polyribonucleotide" mean a polymer composed of ribonucleotides.

[0178] The terms "circRNA," "circular RNA," and "circular RNA" are used interchangeably throughout this patent.

[0179] The term "DNA" means a polymer composed of deoxyribonucleotides.

[0180] The term "oligonucleotide" refers to a single-stranded or double-stranded nucleotide polymer ranging in length from about 2 to up to about 200 nucleotides. Suitable oligonucleotides can be prepared by chemical methods, such as the phosphoramidite method, or enzymatic methods.

[0181] The term "polynucleotide" refers to a single- or double-stranded polymer composed of nucleotide monomers.

[0182] The term "nucleic acid construct" means a construct which, when introduced into a cell, results in the transcription and / or translation of an RNA or polypeptide.

[0183] In some embodiments, the nucleic acid construct comprises a terminator or termination sequence operably linked to the open reading frame.

[0184] In some embodiments, the nucleic acid construct comprises at least one synthetic or non-natural promoter, at least one synthetic or non-natural coding sequence, and at least one synthetic or non-natural terminator.

[0185] The term "codon optimized" refers to changing the codons in the open reading frame of a nucleic acid sequence to reflect the typical codon usage of a selected organism without changing the polypeptide encoded by the sequence. The optimization includes replacing at least one, or more than one, or a significant number of codons with one or more codons that are more frequently used in the genes of the selected organism.

[0186] A nucleic acid sequence is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.

[0187] As used herein, the term "antisense strand" refers to an oligomeric compound that is substantially or 100% complementary to a target nucleic acid or target sequence. In some embodiments, the antisense strand comprises a length of at least two nucleotides. In some embodiments, the antisense strand comprises a length of at least 40 nucleotides. In some embodiments, each of the antisense strands has a length of about 18 to about 28 nucleotides. The antisense strand sequence can be predicted by consulting previous literature or importing the mRNA sequence of the target protein into the RNAiDesigner website (http: / / rnaidesigner.thermofisher.com / rnaiexpress / ). The target protein can be a protein associated with a specific disease.

[0188] The linear RNA polynucleotides provided herein are capable of self-splicing to form covalently linked closed circular RNA molecules under the action of a cyclization element. The cyclization element comprises a self-splicing intron. The term "self-splicing intron" refers to an intron that has self-splicing ribozyme activity and is capable of self-excision and ligation of two flanking exons. In some embodiments, the splicing is autocatalytic splicing.

[0189] As used herein, "self-splicing introns" include, but are not limited to, class I introns and class II introns. Class I introns include 14 subgroups, and most class I introns belong to the IC3 subgroup. For example, class I introns may be class I introns from Anabaena belonging to the IC3 subgroup, or class I introns from T4 phage belonging to the IA2 subgroup, or class I introns from Azotobacter BH72 belonging to the IC3 subgroup. Other examples of self-splicing introns that can be used in the present invention include, but are not limited to, self-splicing introns derived from the following organisms: Anabaena PCC7120, bacteriophage Twort, bacteriophage SPO1, bacteriophage S3b, Synechococcus elongatus PCC 6301, Enterobacteriophage T4, Bacillus anthracis, Clostridium botulinum, Tetrahymena thermophila, Dunaliella parva, Pneumocystis carinii, Physarum polycephalum, Scytonema hofmanni, Agrobacterium tumefaciens, Synechocystis PCC 6803, and the like.

[0190] As used herein, an "exonic element" is a sequence that is derived from a native exon (ie, an exon flanking a self-splicing intron) and that is capable of being recognized and / or spliced by the self-splicing intron and is therefore required for circularization.

[0191] In some embodiments, the 5' exonic element is derived from the native 5' exon of the self-splicing intron (the exon flanking (or downstream) the 5' end of the self-splicing intron) or a contiguous segment thereof starting from the 3' terminal nucleotide.

[0192] In some embodiments, the 5' exonic element is the entire native 5' exon of the self-splicing intron, or has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, or at least 99% sequence identity thereto, or has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide substitutions, deletions, or additions compared to the entire native 5' exon of the self-splicing intron.

[0193] In some embodiments, the 5' exon element is a continuous segment starting from the 3' terminal nucleotide of the native 5' exon. In some embodiments, the 5' exon element has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99% or at least 99% sequence identity with the continuous segment starting from the 3' terminal nucleotide of the native 5' exon. In some embodiments, the 5' exon element has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more nucleotide substitutions, deletions or additions compared to the continuous segment starting from the 3' terminal nucleotide of the native 5' exon.

[0194] In some embodiments, the continuous segment starting from the 3' terminal nucleotide of the native 5' exon comprises or consists of at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of the nucleotides of the native 5' exon. In some embodiments, the continuous segment starting from the 3' terminal nucleotide of the native 5' exon is at least 1 nucleotide in length, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15 nucleotides, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50 or more nucleotides. In some embodiments, the length of the contiguous segment starting from the 3'-terminal nucleotide of the native 5' exon is 1 nucleotide or up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50 nucleotides, or the total length of the native 5' exon.

[0195] In some embodiments, the 3' exonic element is derived from the native 3' exon of the self-splicing intron (the exon flanking (or downstream) the 3' end of the self-splicing intron) or a contiguous segment thereof starting from the 5' terminal nucleotide.

[0196] In some embodiments, the 3' exonic element is the entire native 3' exon of the self-splicing intron, or has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, or at least 99% sequence identity thereto, or has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide substitutions, deletions, or additions compared to the entire native 3' exon of the self-splicing intron.

[0197] In some embodiments, the 3' exon element is a continuous segment starting from the 5' terminal nucleotide of the native 3' exon. In some embodiments, the 3' exon element has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, or at least 99% sequence identity with the continuous segment starting from the 5' terminal nucleotide of the native 3' exon. In some embodiments, the 3' exon element has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide substitutions, deletions, or additions compared to the continuous segment starting from the 5' terminal nucleotide of the native 3' exon.

[0198] In some embodiments, the continuous segment starting from the 5' terminal nucleotide of the native 3' exon comprises or consists of at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of the nucleotides of the native 3' exon. In some embodiments, the continuous segment starting from the 5' terminal nucleotide of the native 3' exon is at least 1 nucleotide in length, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15 nucleotides, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50 or more nucleotides. In some embodiments, the length of the contiguous segment starting from the 5'-terminal nucleotide of the native 3' exon is 1 nucleotide or up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50 nucleotides, or the total length of the native 3' exon.

[0199] As used herein, "host" means an individual and may include domestic animals such as cats and dogs; livestock such as cows, horses, pigs, sheep and goats; laboratory animals such as mice, rabbits, rats and guinea pigs; mammals such as humans, non-human primates and primates; and other animals such as rodents, birds, reptiles, amphibians and fish.

[0200] As used herein, "gene silencing" of a small interfering RNA molecule refers to a reduction in the mRNA level of a target gene in a cell by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, up to and including 100%. In a preferred embodiment, the mRNA level is reduced by at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, up to and including 100%.

[0201] The term "lipid nanoparticle" is not limited to any particular morphology and includes any morphology produced when a cationic lipid and, optionally, one or more other lipids are combined, for example, in an aqueous environment and / or in the presence of RNA. For example, liposomes, lipid complexes, emulsions, micelles, lipid nanocapsules, nanosuspensions, and the like are all within the scope of lipid nanoparticles. In some embodiments, the LNP comprises (i) at least one cationic lipid; (ii) a neutral lipid; (iii) a sterol, such as cholesterol; and (iv) a PEG-lipid in a molar ratio of about 20-60% cationic lipid: 5-25% neutral lipid; 25-55% sterol; and 0.5-15% PEG-lipid.

[0202] The following examples and accompanying drawings are provided to facilitate understanding of the present invention. However, it should be understood that these examples and accompanying drawings are intended to illustrate the present invention only and are not intended to limit the present invention in any way. The actual scope of protection of the present invention is set forth in the claims. It should be understood that any modifications and variations may be made without departing from the spirit of the present invention.

[0203] Example

[0204] The names and sources of the experimental reagents used in the embodiments of the present disclosure are shown in Table 1, and the main consumables and instruments are shown in Table 2.

[0205] Table 1: Reagents used in the experiment

[0206]

[0207]

[0208]

[0209] Table 2: Main consumables and instruments:

[0210]

[0211]

[0212] Example 1 Construction of circular 4×siRNA vector

[0213] 1.1. Sequence design of circular 4× siRNA

[0214] Circular 4× siRNA consists of a circular 4× sense RNA and a linear 1× antisense RNA. The antisense sequence was predicted by consulting previous literature or importing the target protein mRNA sequence into the RNAi Designer website (http: / / rnaidesigner.thermofisher.com / rnaiexpress / ).

[0215] The lengths of the antisense and sense strands in circular siRNA are 24 and 21 bases, respectively, and the 5' is a monophosphate modification. Taking CopGFP as an example, the antisense strand sequence is 5'GCTCTTCATCTTGTTGGTCATGCG 3' (SEQ ID NO.1), and the sense strand sequence is 5'ATGACCAACAAGATGAAGAGC 3' (SEQ ID NO.2). Circular 4x sense strand RNA consists of four RNA elements: T7 promoter, Anabaena class I intron and exon, and 4x sense strand tandem sequence. There is a spacer sequence of a certain length between the elements ( Figure 1Taking the template DNA sequence corresponding to the positive strand RNA of circular 4×siCopGFP as an example, it is formed by sequentially connecting the sequences shown in Table 3. Those skilled in the art will understand that the positive strand sequence of CopGFP can be replaced by any desired target sequence.

[0216] Table 3: Exemplary DNA template sequences

[0217]

[0218]

[0219] The T7 promoter, recognized by T7 RNA polymerase, initiates in vitro transcription of circular 4×siCopGFP sense-strand RNA. The group I introns and exons at either end of the RNA are cleaved by a ribozyme derived from Anabaena, which undergoes GTP-mediated self-splicing, excising the introns and simultaneously ligating the exons. The 4× sense-strand RNA pairs complementary with the antisense strand, binding the antisense strand to the circular RNA. SpeⅠ (5'A↓CTAGT 3' (SEQ ID NO. 14)) and AgeⅠ (5'A↓CCGGT 3' (SEQ ID NO. 15)) are added to the ends and center of the 4× sense strand, respectively, to facilitate the replacement of sense-strand repeats of varying lengths. The sense-strand repeats can be increased to four or more, depending on the desired number of antisense strands.

[0220] 1.2 Similarly, design a non-functional negative control siRNA

[0221] The 21 nt sense strand sequence of the control siRNA is: 5'-GCAACGATCATGGTTGCACAA-3' (SEQ ID NO. 16), and the 24 nt antisense strand sequence is: 5'-GTGCAACCATGATCGTTGCGGCAG-3' (SEQ ID NO. 17).

[0222] 1.3 Add EcoRI and BamHI sequences to both ends of the circular 4× positive-strand RNA template DNA sequence, and clone it into the corresponding restriction endonuclease sites of the pUC57 vector through EcoRI and BamHI restriction endonuclease digestion and homologous recombination.

[0223] 1.4 Transform the recombinant product into 100 μL of DH5α competent cells and place on ice for 30 minutes. Heat shock the cells in a 45°C water bath for 45 seconds, then add 1 mL of LB medium and incubate at 37°C, 200 rpm, for 1 hour. Centrifuge the cells at 6000 rpm for 3 minutes, resuspend the cells in 50 μL of LB medium, and spread the suspension onto ampicillin-resistant LB agar plates. After incubating the cells overnight at 37°C, use an inoculating loop to pick a single colony and dissolve it in 1.5 mL of ampicillin-resistant LB liquid medium. Incubate the cells at 37°C, 200 rpm, until the suspension becomes turbid. Reserve 20 μL of the suspension and use the remaining suspension for small-scale plasmid extraction. The plasmids are then analyzed by colony PCR on a 1% agarose gel in 1× TAE buffer at 110 V for 30 minutes to determine uniform band size. The bacterial solution transformed with the circular 4× positive chain RNA template vector that has successfully undergone homologous recombination was inoculated into 250 ml of LB liquid medium and incubated at 37°C and 200 rpm until the bacterial solution became turbid. A large amount of plasmid was extracted using a plasmid extraction kit.

[0224] Example 2 In vitro transcription of circular 4× positive strand RNA

[0225] 2.1. Linearization of template DNA

[0226] Take 65 μg of the pUC57 plasmid containing the circular 4× positive-sense RNA, add 25 μL of 10× digestion buffer and 10 μL of SmaⅠ restriction endonuclease to prepare a 250 μL digestion system, and incubate overnight at 37°C, 1000 rpm. Add 1.25 ml of isopropanol to precipitate the DNA, and then recover 200 μL of plasmid DNA via column purification.

[0227] PCR amplification of template DNA

[0228] A 3.2 ml PCR system [3 μg / ml plasmid DNA, 5× reaction buffer, 200 μM dNTPs, 0.5 μM universal forward primer (5'AAACGACGGCCAGTGAATTCTAATACGAC 3' (SEQ ID NO. 18)) and back primer (5'ACGGGCCCGGGATCC 3' (SEQ ID NO. 19))] was prepared and subjected to 35 cycles of unwinding at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 3 minutes. The mixture was then cooled from 72°C to 4°C for 5 minutes and stored at 4°C.

[0229] In vitro transcription

[0230] Transcribe 200 μL of linearized plasmid (or 3.2 mL of PCR product) with 10 μL of T7 RNA polymerase in a system containing 5 mM each of ATP, CTP, GTP, and UTP for 2 hours at 37°C and 1000 rpm. Add 5 μL of DNase I and incubate for 30 minutes. Inactivate the DNase at 65°C for 3 minutes, then immediately place on ice for 5 minutes. Add 10× cyclization buffer and 2 mM GTP and cyclize at 55°C for 15 minutes. Add 2 μL of RNase R to digest the linear RNA precursor. Add 100 μL of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 20,000 rpm for 5 minutes, and carefully extract the supernatant. Precipitate with 0.1 volume of 3 M sodium acetate, pH 5.2, and an equal volume of isopropanol. Add the supernatant to a 2 mL 8-layer nucleic acid purification column and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat the centrifugation until all the solution has passed through the column. Add 600 μL of 80% ethanol and centrifuge at 12,000 rpm for 1 minute to wash the precipitate from the purification column. Repeat twice. Centrifuge at 12,000 rpm for 3 minutes to thoroughly remove the ethanol. Add 120 μL of 1× TE buffer to thoroughly wet the purification column and let it stand for 5 minutes. Centrifuge at 12,000 rpm for 1 minute to recover the filtrate and store at -80°C.

[0231] After digestion of the template DNA with DNase I, digestion of the linear precursor RNA with RNase R, and gel extraction, a significant band of circular 4× positive-sense RNA was enriched at the 200nt position ( Figure 3 ).

[0232] Example 3 Amplification and Extraction of Circular 4× Sense Strand RNA from Escherichia coli

[0233] 3.1 Chemical transformation in E. coli

[0234] Transform 100 μL of BL21(DE3) competent cells with the pUC57 vector containing the T7 promoter and a circular 4x positive-strand RNA template sequence. Place on ice for 30 minutes. Heat shock in a 42°C water bath for 45 seconds, then add 1 mL of LB broth and amplify at 37°C, 200 rpm, for 1 hour. Centrifuge at 6000 rpm for 3 minutes, discard the majority of the supernatant, resuspend the bacterial pellet in approximately 50 μL of culture medium, spread the bacterial suspension on ampicillin-resistant LB agar plates, and incubate overnight at 37°C, 5% CO2.

[0235] 3.2 E. coli amplification and induction

[0236] The next day, use a sterile inoculating loop to pick a single colony from the plate and resuspend it in 50 ml of LB liquid medium containing 0.1% ampicillin. Incubate at 37°C and 200 rpm for 3 hours until the solution becomes turbid. Then transfer the culture to 250 ml to 1000 ml of LB liquid medium and incubate at 37°C and 200 rpm for 3 hours until the solution becomes turbid. Take 800 μL of the culture solution and add 200 μL of glycerol, then store at -30°C. Add 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and induce the culture at 18°C and 200 rpm for 18 hours.

[0237] 3.3 RNA extraction and recovery

[0238] The next day, collect the bacterial pellet (usually approximately 5 ml) by centrifugation at 4000 rpm for 20 minutes. Resuspend the bacteria in 5 ml of bacterial lysis buffer (50 mM NaCl, 250 mM Tris-HCl, pH 8.0). Add 2 ml of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly to lyse the cells. Centrifuge at 12000 rpm for 10 minutes. Collect the supernatant (usually approximately 7.5 ml). Add 300 μL of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 12000 rpm for 10 minutes to precipitate the protein. Collect the supernatant and add 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol to precipitate the supernatant. Transfer 800 μL of the suspension to a 2 ml nucleic acid purification column. Centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension has been filtered. Add 500 μL of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 200 μL of 1× TE buffer to the column and let stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and recover the filtrate.

[0239] To 200 μL of the filtrate, add 50 μL of a 25:24:1 ratio of phenol: RNA-assisted extraction reagent: isoamyl alcohol solution. Mix thoroughly and centrifuge at 12,000 rpm for 10 minutes. Collect the supernatant and add 0.1 volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropanol to the supernatant for precipitation. Transfer the supernatant to a 2 mL nucleic acid purification column. Centrifuge at 12,000 rpm for 1 minute and discard the filtrate. Rinse the column by adding 500 μL of 80% ethanol and centrifuging at 12,000 rpm for 1 minute. Discard the filtrate and repeat this process twice. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 120 μL of 1× TE buffer to the column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and recover the filtrate.

[0240] In 50 ml bacterial solution, after adding IPTG, the expression of circular RNA was highest when induced at 18℃ for 3 hours, 18℃ for 18 hours, 37℃ for 3 hours, and 37℃ for 18 hours. Figure 2 ).

[0241] Example 4 In vitro transcription of linear siRNA antisense and sense strands

[0242] A T7 promoter sequence (SEQ ID NO. 3) was added to the 5' end of both the sense and antisense strands, and two short, reverse-complementary single-stranded DNAs were synthesized. After unwinding at 95°C for 5 minutes, the mixture was gradually cooled and annealed to room temperature to form a double-stranded template DNA. To 400 μL of 500 ng / μL double-stranded template DNA, 25 μL of a transcription reagent (0.5 M HEPES-K pH 7.9, 60 mM MgCl2, 150 mM DTT, and 10 mM spermidine) and 100 μg of T7 RNA polymerase were added. Transcription was performed overnight at 37°C and 1000 rpm. The DNA template was then removed by adding 10 U of DNase I and incubating at 37°C and 1000 rpm for 30 minutes. Add 50 μL of a 25:24:1 ratio of phenol: RNA-assisted extraction reagent: isoamyl alcohol solution and mix thoroughly. Centrifuge at 20,000 rpm for 5 minutes and carefully extract the supernatant. Precipitate with 0.1 volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropanol. Add the solution to a 2 mL 8-layer nucleic acid purification column and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat the centrifugation until all the solution has passed through the column. Wash the column precipitate by adding 600 μL of 80% ethanol and centrifuging at 12,000 rpm for 1 minute. Repeat this process twice. Centrifuge at 12,000 rpm for 3 minutes to thoroughly remove the ethanol. Add 120 μL of 1× TE buffer to thoroughly wet the column and let it stand for 5 minutes. Centrifuge at 12,000 rpm for 1 minute to recover the filtrate and store at -80°C.

[0243] Example 5 Formation of circular siRNA and linear siRNA

[0244] 5.1 Purification of circular 4× positive-sense RNA and linear positive- and antisense-strand RNA

[0245] To purify circular 4× sense RNA, prepare a 1.5 mm thick 5% urea polyacrylamide gel (13 ml / gel): 8.3 M urea, 0.5× TBE buffer, 5% acrylamide / methylene 19:1, and insert a 10-well sample comb. After freezing at room temperature for 30 minutes, perform pre-electrophoresis in 0.5× TBE buffer at 10 W constant power for 30 minutes. Before electrophoresis, rinse the sample wells clean of urea with a pipette tip.

[0246] Add an equal volume of 2× RNA loading buffer (containing xylene cyanol) to 120 μL of RNA sample, heat at 70°C for 3 minutes, and place on ice for 5 minutes. Rinse the urea from the loading wells with a pipette tip, load 30 μL of sample into each well, and run electrophoresis at 10W constant power until the xylene cyanol reaches the bottom of the urea gel, approximately 35 minutes.

[0247] The urea gel was completely scooped off and placed on a thin layer chromatography silica gel plate covered with transparent plastic wrap. The black band on the upper part of the urea gel was observed under 254 nm ultraviolet light of a handheld ultraviolet analyzer. The gel corresponding to the band was cut off, placed in a 5 ml centrifuge tube and crushed with a pipette tip. 5 ml of sol buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) was added and vortexed to mix. The mixture was placed at room temperature overnight.

[0248] Divide the urea gel suspension into four 1.5ml centrifuge tubes and centrifuge at 12,000 rpm for 1 minute. Collect the supernatant into new 1.5ml centrifuge tubes and discard the gel layer. Add 50 μL of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 12,000 rpm for 10 minutes to precipitate impurities. Collect the supernatant into a new 5ml centrifuge tube and add 0.1 volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropanol to the supernatant for precipitation. Transfer 800 μL of the suspension to a 2ml nucleic acid purification column. Centrifuge at 12,000 rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension has been filtered. Add 500 μL of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the filter column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 20 μL of 1× TE buffer to the filter column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and recover the filtrate. Measure the RNA concentration using a Nanodrop analyzer and store at -80°C.

[0249] Take 1 μg of circular 4× positive strand RNA, design primers at the 5' and 3' ends of the circularization site, add 1.25 μM of the forward primer (5'ACCGGTAAAAAGGCGAGACG 3' (SEQ ID NO.20)), the rear primer (5'CGACCGTTTAAGGTCAACGGATTTT 3' (SEQ ID NO.21)) and 1 μL of reverse transcriptase, and incubate in a conventional PCR instrument with program heating at 25°C for 5 minutes, 42°C for 30 minutes and 85°C for 5 minutes. The cDNA product is stored at 4°C. Send it for Sanger sequencing to verify the presence of the circularization site. Figure 4 As shown, the circular 4× positive chain RNA gel recovery product was designed with primers before and after the circularization site, and the cDNA fragment was obtained by reverse transcription and Sanger sequencing. The intron sequence was cut and not detected, and the 5' exon and 3' exon were successfully connected.

[0250] In the present disclosure, taking siCopGFP as an example, “circular 4×siCopGFP” is written as “C-4×-siCopGFP”, “linear 1×siCopGFP” is written as “L-1×-siCopGFP”, the positive chain of siCopGFP is written as “S-siCopGFP”, and the antisense chain of siCopGFP is written as “AS-siCopGFP”.

[0251] 5.2 Binding of Sense and Antisense Strands

[0252] Mix equal amounts of circular 4× sense chain and linear antisense chain (such as 60pmol linear antisense chain mixed with 60pmol circular 4× sense chain), and equal amounts of linear sense chain and linear antisense chain (such as 60pmol linear antisense chain mixed with 60pmol linear sense chain), and add enzyme-free water to make the volume up to 60μL. After heating at 95℃ for 5 minutes to fully open the RNA higher-order structure, gradually cool to room temperature to allow the sense chain and antisense chain to fully complement each other and pair. Briefly centrifuge for 10 seconds to collect the liquid to the bottom of the centrifuge tube, store at 4℃, and use within 24 hours. Non-denaturing agarose gel electrophoresis shows that the bands of circular 4× sense chain and linear antisense chain increase with the increase of circular sense chain, the charge carried by double-stranded siRNA increases, and the migration distance of the band gradually increases, indicating that the free antisense chain decreases ( Figure 5 ).

[0253] Example 6 Evaluation of the effectiveness and immunogenicity of circular 4×siCopGFP

[0254] Inoculate 1 × 10 5HEK293 human embryonic kidney cell line (ATCC CRL-1573) was cultured in 500 μL of high-glucose DMEM complete medium supplemented with 10% fetal bovine serum at 37°C and 5% CO2 for one day. The next day, after the HEK293 cells had adhered, the medium was discarded and the cells were rinsed twice with PBS to remove the serum. 1.25 mL of Opti-MEM was mixed with 25 μL of transfection reagent and incubated at room temperature for 5 minutes. Then, 600 μL of Opti-MEM was mixed with 6 μg of pCDH-CopGFP plasmid and 6 μg of pmCherry-N1 plasmid. Five tubes of 100 μL Opti-MEM were mixed with C-4×-siCopGFP containing 60 pmol of antisense strand, L-1×-siCopGFP containing 60 pmol of antisense strand, AS-siCopGFP containing 60 pmol of antisense strand, C-4×-negative control containing 60 pmol of antisense strand, and L-1×-negative control containing 60 pmol of antisense strand, respectively. 200 μL of Opti-MEM containing transfection reagent was mixed with 100 μL of Opti-MEM containing siRNA. A control tube was added with 100 μL of Opti-MEM and incubated for 25 minutes. Add 75 μL of Opti-MEM containing siRNA encapsulated with transfection reagent to each well, then add 25 μL of Opti-MEM containing pCDH-CopGFP plasmid and pmCherry-N1 plasmid, mix gently, add serum-free DMEM high-glucose medium to make up the volume to 500 μL, culture at 37°C for 6 hours, replace the medium with DMEM high-glucose complete medium containing 10% serum, and continue incubation for 24 hours.

[0255] The next day, cells expressing the green fluorescent protein CopGFP were observed under an inverted fluorescence microscope using a green filter, and cells expressing the red fluorescent protein mCherry were observed using a red filter. ImageJ software (National Institutes of Health, V1.8.0) was used to count the areas of green and red fluorescence and calculate the ratio of the two to compare the proportion of green fluorescence in different groups.

[0256] After 48 hours, discard the culture medium and rinse twice with PBS. Add 200 μL of total RNA extraction reagent to each well, mix well by pipetting, let stand on ice for 5 minutes, and transfer to an enzyme-free 1.5 ml centrifuge tube. Add 40 μL of chloroform, carefully cover the 1.5 ml centrifuge tube, mix by inverting until the mixture turns light pink, and let stand for 2-3 minutes. Centrifuge at 12000×g and 4°C for 15 minutes. The liquid will separate from top to bottom into a colorless transparent layer, a milky white precipitate layer, and a pink organic layer. Carefully aspirate the colorless transparent layer into another enzyme-free 1.5 ml centrifuge tube, being careful not to aspirate the milky white precipitate layer. Add an equal volume of isopropanol, mix well, and let stand in a 4°C refrigerator for 10 minutes. Transfer 800 μL of the suspension to a 2 ml nucleic acid purification column. Centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension is filtered. Add 500 μL of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the filter column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 15 μL of 1× TE buffer to the filter column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and collect the filtrate. Measure RNA concentration using a Nanodrop.

[0257] Take 1 μg of total RNA sample, 2 μL of 5×gDNA digestion buffer and 1 μL of gDNA digestion enzyme and add enzyme-free water to 10 μL, incubate at 42°C for 2 minutes. Ⅱ Buffer plus, 2 μL ⅡEnzyme Mix, 1.25μM random primer N6 and 1.25μM Oligo(dT) 18 Add enzyme-free water to make up to 20 μL. Incubate in a conventional PCR instrument at 25°C for 5 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. Store the cDNA product at 4°C.

[0258] Prepare 500 μL of CopGFP and mCherry qPCR reaction system: add 200 μL of enzyme-free water, 25 μL of forward primer, 25 μL of rear primer and 250 μL of 2×SYBR Green qPCR Mix. Add 9 μL of qPCR reaction system to each of 24 wells of a 384-well plate, and add 1 μL of cDNA product of different samples. Set up two duplicate wells for each sample. Set up the real-time quantitative PCR instrument with 95°C pre-denaturation for 2 minutes, 1 cycle; 95°C denaturation for 10 seconds, 60°C annealing for 20 seconds, 72°C extension for 1 minute, 45 cycles; melt for 2 minutes. The difference (ΔCt) between the average Ct value of the intervention group samples amplified by the target primers and the average Ct value amplified by the internal reference mCherry primers was calculated by the second-order derivative method. 干预) and the difference between the average Ct value of the control group samples amplified by the target primers and the average CT value amplified by the internal reference mCherry primers (ΔCt 对照 ) is subtracted to obtain the difference (ΔΔCt). (-ΔΔCt) It is the multiple of the change in mRNA level in the intervention group compared with the control group.

[0259] qRT-PCR showed that circular C-4×-siCopGFP reduced the expression level of CopGFP mRNA compared with linear L-1×-siCopGFP, circular C-4×-NC siRNA (circular negative control RNA), linear L-1×-NC siRNA (linear negative control RNA) and control groups ( Figure 6 Fluorescence microscopy showed that the cyclic C-4×-siCopGFP group significantly reduced the green fluorescence density of CopGFP compared with other groups ( Figure 7 Prepare 500 μL of IL-6, TNF, IFNB1, and RIG-Ⅰ qPCR reaction system, setting up two replicate wells for each sample. Set the real-time quantitative PCR instrument to perform one cycle of pre-denaturation at 95°C for 2 minutes, followed by 45 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 20 seconds, and extension at 72°C for 1 minute, followed by melting for 2 minutes. (-ΔΔCt) It is the multiple of the change in mRNA level in the intervention group compared with the control group.

[0260] qRT-PCR showed that the transfection of HEK293 cells with circular 4×siCopGFP and linear siCopGFP modified with pseudouridine did not affect the expression of intracellular innate immune factors interleukin-6 (IL-6), tumor necrosis factor (TNF), interferon β1 (IFNB1) and retinoic acid-induced gene protein I (RIG-Ⅰ mRNA), and there was no significant difference in immunogenicity ( Figure 8 ). The primers used in Example 6 are shown in Table 4.

[0261] Table 4: Primers used in Example 6

[0262]

[0263] Example 7 Preparation of Circular 4×siPCSK9 Targeting Human PCSK9 mRNA

[0264] The circular 4×siPCSK9 targeting human Pcsk9 mRNA was designed and prepared according to the method of Example 1.

[0265] The 21-base sense strand sequence of PCSK9 is: 5'CCAAGATCCTGCATGTCTTCC 3' (SEQ ID NO. 6). The 24-base antisense strand sequence is: 5'GGAAGACATGCAGGATCTTGGTGA 3' (SEQ ID NO. 36). Spe I (5'A↓CTAGT 3' (SEQ ID NO. 14)) and Age I (5'A↓CCGGT 3' (SEQ ID NO. 15)) were added to either end of the 4× siPCSK9 sense strand and ligated into the pUC57-circRNA expression vector, which had been double-digested with Spe I and Age I, via homologous recombination.

[0266] Circular 4× sense-strand siPCSK9 was then amplified and extracted using E. coli using the method of Example 3, and circular 4× siPCSK9 and the corresponding linear siPCSK9 were prepared using the method of Example 5. Specifically, equal amounts of linear L-1×-AS-siPCSK9 and cyclic C-4×-S-siPCSK9 (e.g., 60 pmol L-1×-AS-siPCSK9 mixed with 60 pmol C-4×-S-siPCSK9) and equal amounts of linear L-1×-AS-siPCSK9 and linear L-1×-S-siPCSK9 (e.g., 60 pmol L-1×-AS-siPCSK9 mixed with 60 pmol L-1×-S-siPCSK9) were mixed, heated at 95°C for 5 minutes, and gradually annealed to room temperature. Controls of linear L-1×-siCopGFP and circular C-4×-siCopGFP were prepared using the same steps as those for linear L-1×-siPCSK9 and circular C-4×-siPCSK9.

[0267] Example 8 Evaluation of the effectiveness and immunogenicity of circular 4×siPCSK9 targeting human PCSK9 mRNA

[0268] Inoculate 1 × 10 5HepG2 human hepatocellular carcinoma cell lines were cultured in 500 μL of high-glucose DMEM complete medium supplemented with 10% fetal bovine serum for one day at 37°C and 5% CO2. The next day, after the HepG2 cells had adhered, the medium was discarded and the cells were rinsed twice with PBS to remove the serum. 1.25 mL of Opti-MEM was mixed with 25 μL of transfection reagent and incubated at room temperature for 5 minutes. Five tubes of 200 μL of Opti-MEM were mixed with 60 pmol of antisense strands of C-4×-siPCSK9, 60 pmol of antisense strands of L-1×-siPCSK9, 60 pmol of antisense strands of AS-siPCSK9, 60 pmol of antisense strands of C-4×-siCopGFP, and 60 pmol of antisense strands of L-1×-siCopGFP. 200 μL of Opti-MEM containing transfection reagent was mixed with 200 μL of Opti-MEM containing siRNA. A control group was treated with 200 μL of Opti-MEM and incubated for 25 minutes. Add 100 μL of Opti-MEM containing siRNA encapsulated with transfection reagent to each well, mix gently, add serum-free DMEM high-glucose medium to make up the volume to 500 μL, culture at 37°C for 6 hours, replace the medium with DMEM high-glucose complete medium containing 10% serum, and continue incubation for 72 hours or 168 hours.

[0269] Separately, five tubes of 300 μL of Opti-MEM were mixed with 90 pmol of antisense strands of C-4×-siPCSK9, 90 pmol of antisense strands of L-1×-siPCSK9, and 90 pmol of antisense strands of AS-siPCSK9, respectively. 200 μL of Opti-MEM containing transfection reagent was mixed with 200 μL of Opti-MEM containing siRNA. A control group was treated with 200 μL of Opti-MEM and incubated for 25 minutes. 100 μL of Opti-MEM containing transfection reagent-encapsulated siRNA was added to each well, gently mixed, and the volume was brought to 500 μL with serum-free DMEM high-glucose medium. Three wells in each group were then added with 22 μM atorvastatin calcium and incubated for up to 72 hours.

[0270] After the incubation time is up, discard the culture medium and rinse twice with PBS. Add 200 μL of total RNA extraction reagent to each well, mix thoroughly by pipetting, let stand on ice for 5 minutes, and transfer to an enzyme-free 1.5 ml centrifuge tube. Add 40 μL of chloroform, carefully cap the 1.5 ml centrifuge tube, and mix by inverting until the mixture turns light pink. Let stand for 2-3 minutes. Centrifuge at 12,000 × g at 4°C for 15 minutes. The liquid will separate from top to bottom into a colorless transparent layer, a milky white precipitate layer, and a pink organic layer. Carefully aspirate the colorless transparent layer into another enzyme-free 1.5 ml centrifuge tube, and aspirate the pink organic layer into another enzyme-free 1.5 ml centrifuge tube, taking care not to aspirate the milky white precipitate layer. Add an equal volume of isopropanol to the colorless transparent layer and mix thoroughly. Let stand in a refrigerator at 4°C for 10 minutes. Transfer 800 μL of the suspension to a 2 ml nucleic acid purification column. Centrifuge at 12,000 rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension has been filtered. Add 500 μL of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the filter column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 15 μL of 1× TE buffer to the filter column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and collect the filtrate. Measure RNA concentration using a Nanodrop.

[0271] Take 1 μg of total RNA sample, 2 μL of 5×gDNA digestion buffer and 1 μL of gDNA digestion enzyme and add enzyme-free water to 10 μL, incubate at 42°C for 2 minutes. Ⅱ Buffer plus, 2 μL II Enzyme Mix, 1.25 μM random primer N6, and 1.25 μM Oligo(dT)18 were added to 20 μL of the tube and the tube was incubated in a standard PCR instrument at 25°C for 5 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. The cDNA product was stored at 4°C.

[0272] A 500 μL qPCR reaction system for PCR products of PCSK9, LDLR, IL-6, TNF, IFNB1, RIG-I, and ACTB was prepared by adding 200 μL of enzyme-free water, 25 μL of forward primer, 25 μL of back primer, and 250 μL of 2×SYBR Green qPCR Mix. 9 μL of the qPCR reaction system was added to each of 24 wells of a 384-well plate, and 1 μL of cDNA product from each sample was added. Two replicate wells were set for each sample. The real-time quantitative PCR instrument was set to perform a pre-denaturation at 95°C for 2 minutes for 1 cycle; followed by 45 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 20 seconds, and extension at 72°C for 1 minute; followed by a melting step of 2 minutes. The difference (ΔCt) between the average Ct value of the intervention group samples amplified by the target primers and the average Ct value amplified by the internal reference ACTB primers, as calculated by the second-order derivative method, was calculated. 干预) and the difference between the average Ct value of the control group samples amplified by the target primers and the average CT value amplified by the internal reference ACTB primers (ΔCt 对照 ) is subtracted to obtain the difference (ΔΔCt). (-ΔΔCt) It is the multiple of the change in mRNA level in the intervention group compared with the control group.

[0273] Add 1.5 times the volume of isopropanol to the pink organic layer and let it stand on ice for 20 minutes. Centrifuge at 4°C, 12,000 rpm for 15 minutes until a white precipitate is visible. Discard the pink supernatant. Add 200 μL of 0.3 M guanidine hydrochloride in 95% ethanol and let it stand on ice for 10 minutes. Centrifuge at 4°C, 7,500 rpm for 5 minutes and discard the supernatant. Repeat once. Add 200 μL of anhydrous ethanol and let it stand on ice for 10 minutes. Centrifuge at 4°C, 7,500 rpm for 5 minutes and discard the supernatant. Dissolve the protein in 50 μL of 10% SDS solution heated at 99°C for 10 minutes.

[0274] Take 4 μL of each histone solution and dilute it 5-fold with 16 μL of deionized water. Add 200 μL of BCA working solution (solution A: solution B = 50:1). Incubate at 37°C for 30 minutes and measure the absorbance at 562 nm using a multifunctional microplate reader. Fit a linear function curve between the absorbance of the standard and the protein concentration value. The fitting coefficient R 2 ≥0.99, and calculate the protein concentration of each well according to the curve equation. Adjust the concentration of each protein solution to the same volume by adding deionized water. Add 0.25 volumes of 5× SDS loading buffer to each group and mix thoroughly. Heat at 99°C for 10 minutes, centrifuge at 12,000 rpm for 10 minutes, and store at -80°C.

[0275] Prepare ten wells of a 10% SDS-polyacrylamide gel, loading 100 μg of protein per well. Electrophoresis was performed at 80 V for 25 minutes in an electrophoresis buffer consisting of 3.03 g / L Tris, 14.40 g / L glycine, and 1.00 g / L SDS. After the protein markers were clearly separated, electrophoresis was continued at 120 V for 80 minutes. In an electrotransfer buffer consisting of 2.42 g / L Tris, 11.52 g / L glycine, and 20% methanol, two outer layers of sponge, two middle layers of filter paper, an inner layer of gel, and a methanol-activated 0.45 μm filter were clamped together. Electrodes were inserted into the correct positions for the electrophoresis direction. The membranes were transferred at a constant current of 230 mA for 160 minutes. The membranes were washed twice with TBST for 10 minutes each. Blocked with protein-free rapid blocking buffer for 30 minutes. The membranes were then washed three times with TBST for 8 minutes each. The filters of the 95kD and above, 55-95kD, and 33-46kD bands were incubated with 1:1000 diluted primary antibodies to LDLR, PCSK9, and GAPDH, respectively, at 4°C overnight.

[0276] The next day, the primary antibody was removed. The membrane was washed three times with TBST (8 minutes each time). The secondary antibody was incubated for 1 hour at a dilution of 1:5000. The membrane was washed three times with TBST (8 minutes each time). The filter membrane treated with chemiluminescent solution was exposed on an imager. Background correction was performed using ImageJ, and the grayscale of the bands was measured. The grayscale ratios of the LDLR, PCSK9, and GAPDH bands in each group were compared.

[0277] On the third day after HepG2 transfection, qRT-PCR experiments showed that cyclic C-4×siPCSK9 transfection caused a significant decrease in PCSK9 mRNA levels compared with the linear siPCSK9 group, the negative control group (L-1×-siCopGFP and C-4×-siCopGFP), and the positive control group (AS-siPCSK9). The reduction in PCSK9 mRNA levels by cyclic C-4×-siPCSK9 transfection lasted until the seventh day after transfection. High-intensity atorvastatin increased PCSK9 mRNA levels in HepG2 cells. Only cyclic C-4×-siPCSK9 could significantly reduce PCSK9 mRNA levels in HepG2 cells. Neither AS-siPCSK9 nor linear L-1×-siPCSK9 could reduce the increase in PCSK9 mRNA levels in HepG2 cells caused by high-intensity atorvastatin. Figure 9 ). Western blot experiments showed that on the third day after cyclic C-4×-siPCSK9 transfection, the LDLR protein level in HepG2 hepatocytes was higher than that in other groups, while the PCSK9 protein level was lower. On the seventh day after transfection, the LDLR protein level in HepG2 hepatocytes was still higher than that in other groups, while the difference between the PCSK9 protein level and other groups was smaller. High-intensity atorvastatin caused an increase in the PCSK9 protein level in HepG2 cells, and the PCSK9 protein level in the combination of high-intensity atorvastatin and cyclic C-4×-siPCSK9 was lower than that in the combination of linear L-1×-siPCSK9 ( Figure 10 ). This indicates that cyclic C-4×-siPCSK9 can reduce the PCSK9 protein level in HepG2 cells on day 3 and increase the LDLR level. The effect of increasing the LDLR level can last until day 7. In addition, only cyclic C-4×-siPCSK9 can avoid the increase in PCSK9 caused by high-intensity atorvastatin.

[0278] On day 3 of HepG2 transfection, qRT-PCR experiments showed that cyclic C-4×-siPCSK9 transfection caused a significant increase in IL-6 mRNA levels compared with the linear siPCSK9 group and the negative control group. On day 7 of cyclic C-4×-siPCSK9 transfection, IL-6 mRNA levels decreased to no significant difference from the control group. On day 3 of transfection, cyclic C-4×-siPCSK9 transfection did not cause an increase in TNF, IFNB1, and RIG-Ⅰ mRNA levels. On day 7 of transfection, cyclic C-4×-siPCSK9 transfection significantly decreased IFNB1 mRNA compared with the cyclic C-4×-negative control siRNA group and the remaining negative control groups, and significantly decreased RIG-Ⅰ mRNA compared with the cyclic C-4×-negative control siRNA group ( Figure 11 ).

[0279] High-intensity atorvastatin combined with cyclic C-4×-siPCSK9 significantly increased IL-6 levels compared with cyclic C-4×-siPCSK9 alone, and these two groups had higher IL-6 levels than the other groups. High-intensity atorvastatin combined with cyclic C-4×-siPCSK9 did not increase TNF, IFNB1, and RIG-I levels compared with the control group. Since cyclic C-4×-siPCSK9 transiently increased IL-6 levels on the third day of transfection, the IL-6 levels increased by high-intensity atorvastatin combined with cyclic C-4×-siPCSK9 may return to normal on the seventh day. Therefore, high-intensity atorvastatin combined with cyclic C-4×-siPCSK9 has little effect on immunogenicity ( Figure 12 ).

[0280] Example 9 Comparison of the inhibition of PCSK9 mRNA levels by circular siPCSK9 targeting human PCSK9 mRNA with different numbers of positive chains in series

[0281] Inoculate 1 × 10 5HepG2 human hepatoma cell lines were cultured in 500 μL of high-glucose DMEM complete medium supplemented with 10% fetal bovine serum for one day at 37°C and 5% CO2. The next day, after the HepG2 cells had adhered, the medium was discarded and the cells were rinsed twice with PBS to remove the serum. 1.25 mL of Opti-MEM was mixed with 25 μL of transfection reagent and incubated at room temperature for 5 minutes. Five tubes of 200 μL of Opti-MEM were mixed with 60 pmol of linear L-1×-siPCSK9 antisense strand, 60 pmol of circular C-1×-siPCSK9 antisense strand (containing only one sense strand sequence), 60 pmol of circular C-4×-siPCSK9 antisense strand (containing four repeats of the sense strand sequence), 120 pmol of C-4×-siPCSK9 antisense strand, and 60 pmol of C-8×-siPCSK9 antisense strand (containing eight repeats of the sense strand sequence). Mix 200 μL of Opti-MEM containing transfection reagent with 200 μL of Opti-MEM containing siRNA. Add 200 μL of Opti-MEM to the control group and incubate for 25 minutes. Add 100 μL of Opti-MEM containing siRNA encapsulated with transfection reagent to each well, mix gently, and add serum-free DMEM high-glucose medium to bring the volume to 500 μL. After incubation at 37°C for 6 hours, replace the medium with DMEM high-glucose complete medium containing 10% serum and continue incubation for up to 72 hours.

[0282] After the incubation time is up, discard the culture medium and rinse twice with PBS. Add 200 μL of total RNA extraction reagent to each well, mix thoroughly by pipetting, let stand on ice for 5 minutes, and transfer to an enzyme-free 1.5 ml centrifuge tube. Add 40 μL of chloroform, carefully cap the 1.5 ml centrifuge tube, and mix by inverting until the mixture turns light pink. Let stand for 2-3 minutes. Centrifuge at 12,000 × g at 4°C for 15 minutes. The liquid will separate from top to bottom into a colorless transparent layer, a milky white precipitate layer, and a pink organic layer. Carefully aspirate the colorless transparent layer into another enzyme-free 1.5 ml centrifuge tube, and aspirate the pink organic layer into another enzyme-free 1.5 ml centrifuge tube, taking care not to aspirate the milky white precipitate layer. Add an equal volume of isopropanol to the colorless transparent layer and mix thoroughly. Let stand in a refrigerator at 4°C for 10 minutes. Transfer 800 μL of the suspension to a 2 ml nucleic acid purification column. Centrifuge at 12,000 rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension has been filtered. Add 500 μL of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the filter column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 15 μL of 1× TE buffer to the filter column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and collect the filtrate. Measure RNA concentration using a Nanodrop.

[0283] Take 1 μg of total RNA sample, 2 μL of 5×gDNA digestion buffer and 1 μL of gDNA digestion enzyme and add enzyme-free water to 10 μL, incubate at 42°C for 2 minutes. Ⅱ Buffer plus, 2 μL II Enzyme Mix, 1.25 μM random primer N6, and 1.25 μM Oligo(dT)18 were added to 20 μL of the tube and the tube was incubated in a standard PCR instrument at 25°C for 5 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. The cDNA product was stored at 4°C.

[0284] Prepare 500 μL of qPCR reaction system for PSK9 and ACTB: add 200 μL of enzyme-free water, 25 μL of forward primer, 25 μL of rear primer, and 250 μL of 2×SYBR Green qPCR Mix. Add 9 μL of qPCR reaction system to each of 24 wells of a 384-well plate, and add 1 μL of cDNA product from different samples. Set up two duplicate wells for each sample. Set up the real-time quantitative PCR instrument with 95°C pre-denaturation for 2 minutes, 1 cycle; 95°C denaturation for 10 seconds, 60°C annealing for 20 seconds, 72°C extension for 1 minute, 45 cycles; and melting for 2 minutes. The difference (ΔCt) between the average Ct value of the intervention group samples amplified by the target primers and the average Ct value amplified by the internal reference ACTB primers was calculated by the second-order derivative method. 干预 ) and the difference between the average Ct value of the control group samples amplified by the target primers and the average CT value amplified by the internal reference ACTB primers (ΔCt 对照 ) is subtracted to obtain the difference (ΔΔCt). (-ΔΔCt) It is the multiple of the change in mRNA level in the intervention group compared with the control group.

[0285] Cyclic C-4×-siPCSK9 reduced PCSK9 levels the most after 3 days of transfection. Using twice the dose of cyclic C-4×-siPCSK9 or cyclic C-8×-siPCSK9 did not reduce PCSK9 levels better than a single dose (15 pmol) of cyclic C-4×-siPCSK9. Cyclic C-1×-siPCSK9 was unable to inhibit PCSK9 expression levels ( Figure 13 The test results showed that four tandem repeats of the positive strand had the best silencing effect.

[0286] Example 10 Preparation of circ-siRNA targeting mouse Pcsk9 mRNA

[0287] ① Sequence design of circular circ-siPcsk9

[0288] The circular RNA targeting mouse Pcsk9 mRNA was designed and prepared according to the method of Example 1.

[0289] The circular 4× siRNA consists of a circular 4× sense RNA and a linear 1× antisense RNA. The antisense sequence was predicted by querying the mouse Pcsk9 mRNA sequence (NM_153565.2) and importing it into the RNAi Designer website (http: / / rnaidesigner.thermofisher.com / rnaiexpress / ). The antisense strand of the circular siRNA is 24 bases long and contains a 5' monophosphate modification. The sense strand is 21 bases long and has the following sequence: (SEQ ID NO: 42). The antisense strand sequence is: (SEQ ID NO: 41). The 3' end of the antisense strand is free of three bases. The circular 4x positive-sense RNA is composed of four RNA elements: a T7 promoter, an Anabaena group I intron and exon, and a 4x positive-sense tandem sequence. Spacer sequences of a certain length exist between the elements. For example, the template DNA sequence corresponding to the circular 4x siCopGFP positive-sense RNA is:

[0290]

[0291] The T7 promoter initiates in vitro transcription of the positive-strand RNA of circ-siPcsk9 through recognition by T7 RNA polymerase. The class I introns and exons at either end of the RNA are bound by a ribozyme derived from Anabaena, which undergoes GTP-mediated self-splicing, excising the introns and simultaneously circumscribing the exons.

[0292] ② Amplification of the positive chain of circular siRNA in E. coli

[0293] EcoRI and BamHI sequences were added to both ends of the circular 4×siPcsk9 positive strand template DNA sequence. The recombinant product was digested with EcoRI (5'G↓AATTC 3') and BamHI (5'G↓GATCC 3') restriction endonucleases and cloned into the corresponding restriction sites of the pUC57 vector via homologous recombination. The recombinant product was transformed into 100 μL of BL21 competent cells and incubated on ice for 30 minutes. Heat shock was performed in a 45°C water bath for 45 seconds, followed by the addition of 1 ml of LB medium and incubation at 37°C, 200 rpm, for 1 hour. After centrifugation at 6000 rpm for 3 minutes, the cell suspension was resuspended in 50 μL of LB medium and plated onto ampicillin-resistant LB agar plates. Incubation was carried out overnight at 37°C in a 5% CO2 incubator. Use a sterile inoculating loop to pick a single colony from the plate and resuspend it in 30 ml of LB liquid medium containing 0.1% ampicillin. Incubate at 37°C, 200 rpm for 3 hours until the solution becomes turbid. Then transfer the colony to 250 ml of LB liquid medium and incubate at 37°C, 200 rpm for 3 hours until the solution becomes turbid. Add 800 μL of the solution to 200 μL of glycerol and store at -30°C. Add 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and induce the culture at 18°C, 200 rpm for 18 hours.

[0294] The next day, collect the bacterial pellet (usually approximately 5 ml) by centrifugation at 4000 rpm for 20 minutes. Resuspend the bacteria in 5 ml of bacterial lysis buffer (50 mM NaCl, 250 mM Tris-HCl, pH 8.0). Add 2 ml of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly to lyse the cells. Centrifuge at 12000 rpm for 10 minutes. Collect the supernatant (usually approximately 7.5 ml). Add 300 μL of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 12000 rpm for 10 minutes to precipitate the protein. Collect the supernatant and add 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol to precipitate the supernatant. Transfer 800 μL of the suspension to a 2 ml nucleic acid purification column. Centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension has been filtered. Add 500 μL of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 200 μL of 1× TE buffer to the column and let stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and recover the filtrate.

[0295] To 200 μL of the filtrate, add 50 μL of a 25:24:1 ratio of phenol: RNA-assisted extraction reagent: isoamyl alcohol solution. Mix thoroughly and centrifuge at 12,000 rpm for 10 minutes. Collect the supernatant and add 0.1 volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropanol to the supernatant for precipitation. Transfer the supernatant to a 2 mL nucleic acid purification column. Centrifuge at 12,000 rpm for 1 minute and discard the filtrate. Rinse the column by adding 500 μL of 80% ethanol and centrifuging at 12,000 rpm for 1 minute. Discard the filtrate and repeat this process twice. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 120 μL of 1× TE buffer to the column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and recover the filtrate.

[0296] ③ In vitro transcription of linear siRNA antisense strand

[0297] A T7 promoter sequence (5'TAATACGACTCTATAGG 3', SEQ ID NO: 3) was added to the 5' end of the antisense sequence, and two short, reverse-complementary single-stranded DNAs were synthesized. After unwinding at 95°C for 5 minutes, the mixture was gradually cooled and annealed to room temperature to form a double-stranded template DNA. To 400 μL of 500 ng / μL double-stranded template DNA, 25 μL of a transcription reagent (0.5 M HEPES-K pH 7.9, 60 mM MgCl2, 150 mM DTT, and 10 mM spermidine) and 100 μg of T7 RNA polymerase were added. Transcription was performed overnight at 37°C and 1000 rpm. The DNA template was then removed by adding 10 U of DNase I and incubating at 37°C and 1000 rpm for 30 minutes. Add 50 μL of a 25:24:1 ratio of phenol: RNA-assisted extraction reagent: isoamyl alcohol solution and mix thoroughly. Centrifuge at 20,000 rpm for 5 minutes and carefully extract the supernatant. Precipitate with 0.1 volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropanol. Add the solution to a 2 mL 8-layer nucleic acid purification column and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat the centrifugation until all the solution has passed through the column. Wash the column precipitate by adding 600 μL of 80% ethanol and centrifuging at 12,000 rpm for 1 minute. Repeat this process twice. Centrifuge at 12,000 rpm for 3 minutes to thoroughly remove the ethanol. Add 120 μL of 1× TE buffer to thoroughly wet the column and let it stand for 5 minutes. Centrifuge at 12,000 rpm for 1 minute to recover the filtrate and store at -80°C.

[0298] ④Purification of circular positive-sense RNA and linear positive-sense and antisense RNA

[0299] To purify circular sense RNA, prepare a 1.5 mm thick 5% urea polyacrylamide gel (13 ml / gel): 8.3 M urea, 0.5× TBE buffer, 5% acrylamide / methylene 19:1, and insert a 10-well sample comb. After freezing at room temperature for 30 minutes, perform pre-electrophoresis in 0.5× TBE buffer at 10 W constant power for 30 minutes. Before electrophoresis, rinse the sample wells clean of urea with a pipette tip.

[0300] Add an equal volume of 2× RNA loading buffer (containing xylene cyanol) to 120 μL of RNA sample, heat at 70°C for 3 minutes, and place on ice for 5 minutes. Rinse the urea from the loading wells with a pipette tip, load 30 μL of sample into each well, and run electrophoresis at 10W constant power until the xylene cyanol reaches the bottom of the urea gel, approximately 35 minutes.

[0301] The urea gel was completely scooped off and placed on a thin layer chromatography silica gel plate covered with transparent plastic wrap. The black band on the upper part of the urea gel was observed under 254 nm ultraviolet light of a handheld ultraviolet analyzer. The gel corresponding to the band was cut off, placed in a 5 ml centrifuge tube and crushed with a pipette tip. 5 ml of sol buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) was added and vortexed to mix. The mixture was placed at room temperature overnight.

[0302] Divide the urea gel suspension into four 1.5ml centrifuge tubes and centrifuge at 12,000 rpm for 1 minute. Collect the supernatant into new 1.5ml centrifuge tubes and discard the gel layer. Add 50 μL of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 12,000 rpm for 10 minutes to precipitate impurities. Collect the supernatant into a new 5ml centrifuge tube and add 0.1 volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropanol to the supernatant for precipitation. Transfer 800 μL of the suspension to a 2ml nucleic acid purification column. Centrifuge at 12,000 rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension has been filtered. Add 500 μL of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the filter column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 20 μL of 1× TE buffer to the filter column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and recover the filtrate. Measure the RNA concentration using a Nanodrop analyzer and store at -80°C.

[0303] ⑤ Binding of linear siPcsk9 and circular circ-siPcsk9 positive and negative strands

[0304] Mix equal amounts of circular circ-siPcsk9 sense and linear antisense strands, and linear siPcsk9 sense and linear antisense strands, and bring the volume up to 60 μL with enzyme-free water. Heat at 95°C for 5 minutes to fully denature the strands, then gradually cool to room temperature to allow for full complementary pairing of the sense and antisense strands. Briefly centrifuge for 10 seconds to collect the liquid at the bottom of the tube. Store at 4°C and use within 24 hours.

[0305] Example 11 Preparation of LNP / circ-siPcsk9 and the effect of LNP / circ-siPcsk9 on ApoE in high-fat fed mice - / - Experimental study on lipid metabolism and atherosclerosis in mice

[0306] ①LNP preparation and characterization

[0307] LNP is composed of P6-Cit-100 (structural formula see Figure 14 C, where n = 5-50), cholesterol, DSPC, and DMG-PEG2000 were mixed at a molar ratio of 4.5:31:10:0.4 (mass ratio 16:12:8:1) and dialyzed overnight. LNPs were mixed with the cyclic siPcsk9 prepared in Example 10 at a mass ratio of 10:1 on ice for 30 minutes and protected from light until use.

[0308] The preparation method of P6-Cit-100 can refer to the patent document with application number CN202310278694.4. Specifically, the method comprises the following steps: weighing 40 mg PEI600 (structural formula see Figure 14 B) and 202 mg of citronellol acrylate (structural formula see Figure 14 A), heated to 75°C, stirred and reacted for 3 days. The product was separated by column chromatography to obtain P6-Cit-100, with a theoretical molecular weight of approximately 3544.2 and a yield of 39%. The H NMR spectrum of P6-Cit-100 is shown in Figure 14 D.

[0309] ② Feeding ApoE with a high-fat diet - / - mice

[0310] Male ApoE - / - All mice were of C57BL6 background and purchased from Guangdong Yaokang Biotechnology Co., Ltd. (SCXK (Yue) 2020-0054). The housing environment was controlled at a temperature of 20–26°C and a humidity of 40–70%. Animals had free access to water and feed.

[0311] A total of 24 experimental animals were included. After 1 week of quarantine, they were placed in a barrier environment. They were divided into 6 groups according to the experimental purpose: (1) PBS group (n = 6): 200 μL PBS; (2) LNP group (n = 6): 150 μg LNP; (3) LNP / siPcsk9 group (n = 6): 150 μg LNP + 10 μg siPcsk9; (4) LNP / circ-siPcsk9 group (n = 6): 150 μg LNP + 15 μg circ-siPcsk9. Each mouse was injected with 200 μL of liquid. After injection, mice in all groups were uniformly fed a high-fat diet (40% fat, 20% carbohydrates, 20% protein, 1.25% cholesterol) for 12 weeks without water restriction. Body weight was measured on the day of injection and at weeks 2, 4, 8, and 12 after injection, and 50 μL of blood was collected from the eye sockets. The mice were euthanized at week 12, and the liver, heart, kidney, and aorta tissues were collected for the next experiment.

[0312] ③ Detection of PCSK9 concentration in mouse serum by enzyme-linked immunosorbent assay (ELISA)

[0313] (1) Place the PCSK9 ELISA kit at room temperature for 15 minutes to rewarm;

[0314] (2) Add 100 μL of PCSK9 standard (0.00 ng / ml, 1.56 ng / ml, 3.13 ng / ml, 6.25 ng / ml, 12.50 ng / ml, 25.00 ng / ml, 50.00 ng / ml, and 100.00 ng / ml) and 95 μL of universal diluent + 5 μL of serum to the ELISA microplate, mix gently, seal the plate with sealing film, and incubate at 37°C for 1 hour;

[0315] (3) Discard the liquid and add 100 μL of biotinylated detection antibody working solution to each well, mix gently, seal the plate with a sealing film, and incubate at 37°C for 1 hour;

[0316] (4) Discard the liquid in the microplate and add 300 μL of 1× washing solution to each well. Let it stand for 1 minute and then discard it. Pat it dry and repeat this three times.

[0317] (5) Add 100 μL of enzyme conjugate working solution to each well, mix gently, seal the plate with a sealing film, and incubate at 37°C for 30 minutes;

[0318] (6) Discard and dry the microplate liquid, fill each well with 1× wash solution, let it stand for 30 seconds, then discard it. Repeat 5 times and pat dry.

[0319] (7) Add 90 μL of TMB substrate to each well, gently shake to mix, seal the plate with a sealing film, and incubate at 37°C for 15 minutes;

[0320] (8) Add 50 μL of stop solution to each well and measure the absorbance (OD450) of each well on a multifunctional microplate reader set at a wavelength of 450 nm. The measurement should be performed within 15 minutes after adding the stop solution.

[0321] (9) Calculate the difference between the OD values of the standard and serum samples and the OD value of the blank well as the correction value. Fit the standard curve and equation using ELISACalc software (v 0.2) with concentration as the horizontal axis and correction value as the vertical axis. Substitute the serum correction value and multiply the result by 20 to calculate the PCSK9 concentration of the serum sample.

[0322] ④ Serum LDL-C concentration measurement

[0323] (1) Add 2.5 μL of serum sample, 2.5 μL of LDL-C standard (4.10 mmol / L), or 2.5 μL of ultrapure water to each well of a 96-well plate;

[0324] (2) Add 180 μL of reagent 1 to each well, incubate at 37°C for 5 minutes, and measure the absorbance OD1 at a wavelength of 600 nm using a multifunctional microplate reader;

[0325] (3) Add 60 μL of reagent 2 to each well, incubate at 37°C for 5 minutes, and measure the absorbance OD2 at 600 nm using a multifunctional microplate reader;

[0326] (4) Calculate the corrected value ΔOD = OD2 - OD1. Serum LDL-C concentration = [(serum ΔOD - ultrapure water ΔOD) / (standard ΔOD - ultrapure water ΔOD)] × 4.10 mmol / L.

[0327] ⑤Aorta gross oil red O staining and plaque area analysis

[0328] (1) Remove the whole aorta of the mouse fixed with 4% paraformaldehyde for 24 hours and wash it twice with PBS;

[0329] (2) Carefully cut the blood vessel longitudinally along the vessel wall using dissecting scissors and wash it with tap water for 5 seconds;

[0330] (3) Immerse the blood vessels in 60% isopropyl alcohol for 3 seconds, then immerse them in Oil Red O staining solution and stain at 37°C in the dark for 1 hour;

[0331] (4) Immerse the blood vessels in 60% isopropanol for differentiation until the intraluminal fat plaques turn bright red, and then wash with ultrapure water to terminate the differentiation;

[0332] (5) Use filter paper to absorb excess water, keep the length of the scale and the height of the camera unchanged, and capture the image with the camera;

[0333] (6) ImageJ was used to count the overall aorta area and the plaque area when the Saturation in ColorThreshold was 0 and 70, respectively, and the percentage of plaque in the overall aorta area was calculated.

[0334] Under dynamic light scattering detection, the particle size of LNP was mainly distributed at 78.88nm. After LNP encapsulated linear siPcsk9, the particle size increased to 204.91nm, while after LNP encapsulated circ-siPcsk9, the particle size increased to 602.42nm ( Figure 15 ). This indicates that LNP successfully encapsulated siRNA and caused the particle size to increase.

[0335] The average potential of LNP was 25.33Mv. After LNP encapsulated linear siPcsk9, the potential dropped to 0.352mV, while after LNP encapsulated circ-siPcsk9, the particle size dropped to -0.539mV, indicating that positively charged LNP can effectively encapsulate negatively charged siRNA ( Figure 16 ). This indicates that LNPs with cationic lipids successfully encapsulated negatively charged siRNA.

[0336] Under negative staining electron microscopy, it can be seen that the morphology of LNP, LNP / siPcsk9, and LNP / circ-siPcsk9 are all spherical, and the particle size distribution is uniform ( Figure 17 ).

[0337] LNP / circ-siPcsk9 can inhibit ApoE expression in high-fat diet - / - The PCSK9 level of mice continued to remain the lowest among the four groups of mice, and at week 8 was reduced by 27% compared with the LNP group with the highest level. However, the PCSK9 level of LNP / siPcsk9 was only reduced by 9% compared with the LNP group with the highest level. Figure 18 ).

[0338] LNP / circ-siPcsk9 can inhibit ApoE expression in high-fat diet - / - The LDL-C level of mice was maintained at the lowest level among the four groups of mice, and was reduced by 70% compared with the highest level in the PBS group at week 8. However, the LNP / siPcsk9 group only reduced the LDL-C level by 42% compared with the highest level in the LNP group ( Figure 19 ).

[0339] Oil red O staining of aorta showed that LNP / circ-siPcsk9 could significantly reduce ApoE in mice fed with high-fat diet for 12 weeks - / - The number of aortic plaques in mice was significantly reduced by LNP / siPcsk9, while ApoE was significantly reduced in mice fed with high-fat diet for 12 weeks. - / - The effect of LNP / circ-siPcsk9 on the plaque burden in the mouse aorta was weaker than that in LNP / circ-siPcsk9 ( Figure 20 ).

[0340] Example 12 Delivery of circ-siPcsk9 using lipid nanoparticles

[0341] Nine female C57BL / 6 mice fed with a normal diet for 12 weeks were divided into three groups: (1) PBS group (n = 3): 200 μL PBS; (2) naked circ-siPcsk9 group (n = 3): 15 μg circ-siPcsk9; (3) LNP / siPcsk9 group (n = 3): 150 μg LNP + 15 μg circ-siPcsk9 (the mass ratio of the circular sense chain to the linear antisense chain was 2:1, and the molar ratio was 1:4). LNP was composed of ALC-0315, cholesterol, DSPC, and DMG-PEG at a molar ratio of 50:38:10:1.5, and then mixed with / C-4×-siPcsk9 at a mass ratio of 10:1. The antisense chain sequence of mouse Pcsk9 is (SEQID NO.41), positive chain sequence (SEQ ID NO.42). The volume of liquid injected into each mouse was 200 μL. All groups of mice were fed with normal feed. 50 μL of blood was collected from the eye socket on the day of injection and at the 2nd, 4th, 8th and 12th weeks after injection. The blood samples to be processed were centrifuged at 5500 rpm for 15 minutes, and the mouse serum was collected and stored at -80°C. The serum PCSK9 level was detected using the mouse PCSK9 ELISA kit according to the instructions. The serum LDLR was detected using the LDL-C detection kit. The serum ALT and creatinine levels at week 12 were detected using the alanine aminotransferase (ALT) and creatinine detection kits.

[0342] After LNP / circ-siPcsk9 injection, serum PCSK9 levels in C57BL6 mice continued to decrease in the first four weeks, and at the second week, it was significantly reduced by 52% compared with the naked 15μg circ-siPcsk9 group and the PBS group. From 8 to 12 weeks, serum PCSK9 levels in the three groups continued to increase, and there was no significant difference among the three groups. After LNP / circ-siPcsk9 injection, the LDL-C levels of C57BL6 mice continued to decrease, while the LDL-C levels in the other two groups did not change significantly. From 8 to 12 weeks, the LDL-C levels in the LNP / circ-siPcsk9 group were significantly lower than those in the other two groups, up to 85% ( Figure 21 There was no significant difference in serum ALT and creatinine levels among the three groups of mice at week 12. Figure 22 ). These results indicate that LNP / circ-siPcsk9 can effectively reduce the LDL-C level in C57BL6 mice without obvious hepatotoxicity or renal toxicity.

[0343] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A pharmaceutical composition comprising a circular RNA and a drug delivery vector, wherein the circular RNA comprises two or more RNA sense strand sequences connected in series, and any two adjacent RNA sense strand sequences in the RNA sense strand sequences are separated by at least one spacer sequence.

2. The pharmaceutical composition of claim 1, wherein the drug delivery vehicle is selected from one or more of nanosuspensions, nanoparticles, micelles, liposomes, nanoemulsions, lipid nanoparticles, and in situ gels, preferably nanoparticles, and further preferably, the nanoparticles are selected from lipid nanoparticles, core-shell nanoparticles, biodegradable nanoparticles, biodegradable lipid nanoparticles, polymer nanoparticles, polyplexes, or biodegradable polymer nanoparticles.

3. The pharmaceutical composition of claim 1, wherein the circular RNA is combined with a drug delivery carrier, and the combination includes filling, embedding, coating, covalent conjugation or non-covalent conjugation.

4. The pharmaceutical composition of claim 1, wherein the drug delivery vehicle is selected from lipid nanoparticles, the lipid nanoparticles comprising: 1) cationic lipids or lipid polymers, 2) non-cationic lipids, 3) PEG-modified lipids, and 4) sterols; Preferably, in the lipid nanoparticles, the molar ratio of cationic lipid:sterol:non-cationic lipid:PEG-modified lipid is (25-100):(20-80):(5-20):(0.4-5), preferably 50:38:10:1.5; Alternatively, preferably, in the lipid nanoparticles, the molar ratio of lipid polymer:sterol:non-cationic lipid:PEG-modified lipid is (1-20):(20-80):(5-20):(0.2-5), preferably 4.5:31:10:0.

4.

5. The pharmaceutical composition of claim 4, wherein the cationic lipid is selected from the group consisting of: ALC-0315, N,N-dioleoyl-N,N-dimethylammonium chloride, N,N-distearoyl-N,N-dimethylammonium bromide, 1,2-dioleoyltrimethylammonium chloride propane, C12-200, DLin-KC2-DMA, DODAP, or HGT4003; and / or, The sterol is selected from the group consisting of cholesterol, lanosterol, 5α-cholestane-3β-ol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid or α-tocopherol; and / or, The non-cationic lipid comprises a neutral lipid and is selected from distearoylphosphatidylcholine, dioleoylphosphatidylcholine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, dioleoylphosphatidylethanolamine, palmitoyloleoylphosphatidylcholine, palmitoyloleoylphosphatidylethanolamine, dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate, dipalmitoylphosphatidylethanolamine, or dimyristoylphosphatidylethanolamine; and / or, The PEG-modified lipid is selected from DSPE-PEG or DMG-PEG; and / or, The lipid polymer is obtained by reacting a compound of formula (I) or polyethyleneimine with a compound of formula (II). The compound of formula (II) is selected from:

6. The pharmaceutical composition of claim 4, wherein the lipopolymer is P6-Cit-100, which is obtained by reacting polyethyleneimine and citronellol acrylate, preferably, the polyethyleneimine is a branched polyethyleneimine.

7. The pharmaceutical composition of claim 6, wherein the molecular weight of the branched polyethyleneimine is 300-10000, preferably 400-2000, more preferably 500-1800, more preferably 500-700, more preferably 600.

8. The pharmaceutical composition according to claim 5, characterized in that The reaction feed ratio of the compound of formula (I) or polyethyleneimine and the compound of formula (II) is 40 mg:0.4-1.8 mmoL, preferably 40 mg:0.7-1.5 mmoL, more preferably 40 mg:0.8-0.9 mmoL, or 40 mg:1.3-1.4 mmoL.

9. The pharmaceutical composition of claim 1, wherein the lipid nanoparticles comprise: (1) C12-200, DOPE, cholesterol, DMG-PEG; or (2) ALC-0315, cholesterol, DSPC, and DMG-PEG; or (3) P6-Cit-100, cholesterol, DSPC, and DMG-PEG.

10. The pharmaceutical composition of claim 1, wherein the mass ratio of the drug delivery vector to the circular RNA is selected from 5:1 to 20:1, more preferably 10:

1.

11. The pharmaceutical composition of claim 1, wherein the circular RNA anneals with at least one linear antisense strand to form a circular siRNA, preferably, the molar ratio of the linear antisense strand to the circular RNA in the composition is selected from 1:1 to 8:

1.

12. The pharmaceutical composition of claim 11, wherein the sense strand sequence has a length of 18 to 24 nucleotides, for example, 18, 19, 20, 21, 22, 23, 24, preferably 21 nucleotides, and / or the linear antisense strand has a length of 21 to 27 nucleotides, for example, 21, 22, 23, 24, 25, 26, 27, preferably 24 nucleotides; Preferably, the positive sense strand sequence comprises an RNA sequence corresponding to the DNA sequence shown in SEQ ID NO. 6 or 42, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto, and / or the linear antisense strand sequence comprises an RNA sequence corresponding to the DNA sequence shown in SEQ ID NO. 36 or 41, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

13. The pharmaceutical composition of claim 11, wherein the circular RNA and / or the at least one linear antisense strand sequence comprises at least one nucleotide modification and / or at least one chemical modification.

14. The pharmaceutical composition of claim 1, wherein the circular RNA further comprises a 5' exonic element and a 3' exonic element, wherein the 5' exonic element and the 3' exonic element are derived from natural exons of the same self-splicing intron, preferably, the self-splicing intron is selected from Anabaena group I introns, T4 phage group I introns, or Azotobacter sp. BH72 group I introns.

15. The pharmaceutical composition of claim 1, wherein the circular RNA is derived from a nucleic acid construct comprising, in the following order from 5' to 3' direction, a first cyclization element, optionally at least one first restriction enzyme recognition sequence, at least one target sequence, optionally at least one second restriction enzyme recognition sequence, and a second cyclization element, wherein the RNA sense strand sequence can be transcribed from the target sequence.

16. The pharmaceutical composition of claim 15, wherein the first circularization element comprises, in sequence, a 5' intronic element and a 5' exonic element, and the second circularization element comprises, in sequence, a 3' exonic element and a 3' intronic element; Preferably, the 5' intron element and the 3' intron element are derived from the same self-splicing intron, in particular, the 5' intron element is derived from or contains the 5' terminal part of the self-splicing intron, and the 3' intron element is derived from or contains the 3' terminal part of the self-splicing intron; Also preferably, the 5' intron element comprises a first portion of a group I intron from Anabaena and the 3' intron element comprises a second portion of a group I intron from Anabaena, or The 5' intron element comprises a first portion from a class I intron of bacteriophage T4, and the 3' intron element comprises a second portion from a class I intron of bacteriophage T4, or The 5' intronic element includes a first portion of a group I intron from Azotobacter sp. BH72, and the 3' intronic element includes a second portion of a group I intron from Azotobacter sp. BH72.

17. The pharmaceutical composition of claim 16, wherein the 5' intronic element comprises the sequence of SEQ ID NO. 4, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto; and / or the 5' exonic element comprises the sequence of SEQ ID NO. 5, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto; and / or the 3' intronic element comprises the sequence of SEQ ID NO. 13, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto; and / or the 3' exonic element comprises the sequence of SEQ ID NO. 12, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto.

18. The pharmaceutical composition of claim 15, wherein the first restriction enzyme recognition sequence is identical to or different from the second restriction enzyme recognition sequence, and at least one of the first and second restriction enzyme recognition sequences is selected from the group consisting of the recognition sequences of the following restriction endonucleases: Spe I, Age I, HindIII, Bgl II, Kpn I, Xho I, Sac II, Not I, BamH I, or Xba I; Preferably, at least one of the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence comprises a sequence selected from the group consisting of: ACTAGT, ACCGGT, AAGCTT, AGATCT, GGTACC, CTCGAG, CCGCGG, GCGGCCGC, GGATCC, and TCTAGA.

19. The pharmaceutical composition of claim 1, wherein the spacer sequence comprises an RNA sequence corresponding to any one of the following sequences or a combination thereof: a sequence shown in SEQ ID NOs. 7 to 11, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

20. A method for inhibiting the expression of a disease-related protein in a cell, the method comprising: The cell is contacted with the pharmaceutical composition according to any one of claims 1 to 19 and maintained for a period of time, thereby inhibiting the expression of disease-related proteins in the cell.

21. The method of claim 20, wherein the cell is in a subject; Preferably, the expression of the disease-associated protein in the cell is inhibited by at least about 50%.

22. Use of the pharmaceutical composition according to any one of claims 1 to 19 in the preparation of a medicament for treating a disease in a subject; Preferably, the drug mediates the degradation of mRNA of a disease-related protein. Also preferably, the disease-related protein is selected from PCSK9, APOC3, ANGPTL4, LPA, ATN1 protein, ataxia protein, huntingtin protein, BACE1, Also preferably, the medicament is for treating a subject suffering from a disorder mediated by PCSK9 expression.

23. The use of claim 22, wherein the disorder comprises hypercholesterolemia, atherosclerosis, hypertriglyceridemia, familial hypercholesterolemia, fatty liver disease, dyslipidemia, hyperlipoproteinemia, atherosclerosis, diabetes and its complications, metabolic syndrome, cardiovascular disease, or elevated cholesterol caused by genetic conditions.

24. The use of claim 22, wherein the subject comprises a mammal; Preferably, the mammal comprises a primate or a rodent; Preferably, the primate includes humans, orangutans or monkeys; Preferably, the rodent comprises a rat, a mouse, a guinea pig, a hamster or a vole.

25. The use according to claim 22, wherein the pharmaceutical composition has one or more of the following effects: 1) Reduce the expression level of PCSK9 gene; 2) mediate the degradation of PCSK9 protein mRNA; 3) Increase LDLR protein levels; 4) Lowering LDL-C levels; 5) reduce aortic plaque burden; 6) No obvious hepatotoxicity or renal toxicity; 7) Has low immunogenicity.

26. The use according to claim 22, wherein the administration of the drug comprises systemic administration and / or local administration.

Images