Pharmaceutical composition for treating atopic dermatitis as well as preparation method and application thereof

Abstract

The invention discloses a medicine composition for treating atopic dermatitis, a preparation method and application, the medicine composition comprises inactivated malassezia sphaeroides, and the strain preservation number of the malassezia sphaeroides is ATCC 96807. The cream composition disclosed by the invention is externally applied to local treatment of skin lesions of specific dermatitis, supplements skin symbiotic bacteria, assists in recovering skin barriers of patients, remarkably inhibits growth and proliferation of staphylococcus aureus at the skin lesions of dermatitis and exocrine toxins, remarkably relieves inflammatory response, reduces the thickness of cuticles and reduces inflammatory cell infiltration; the traditional Chinese medicine composition assists the treatment of atopic dermatitis through the effects of the proinflammatory factors and the expression and secretion of the proinflammatory factors, has a remarkable treatment effect on the atopic dermatitis, is quick to take effect, small in toxic and side effects and good in safety, and has a good medicinal prospect.

Description

Technical Field

[0001] The present invention relates to an external-use pharmaceutical composition for treating skin diseases and a preparation method, and particularly relates to an external-use pharmaceutical composition for treating atopic dermatitis, a preparation method and application, and belongs to the field of medicine. Background Art

[0002] Atopic dermatitis (AD) is a common chronic, recurrent, non-infectious inflammatory skin disease, also known as atopic eczema. The occurrence of the disease is related to factors such as genetic susceptibility, immune imbalance, damage to the skin barrier function, and disturbance of the skin flora. At present, the treatment of atopic dermatitis mainly includes: topical emollients as basic care, topical glucocorticoids and oral antihistamines for skin lesions, and systemic use of glucocorticoids or immunosuppressants, biological agents, and small molecule inhibitors for severe cases. However, drug treatments have the problem of increased adverse reactions and weakened efficacy with long-term use.

[0003] The basic clinical features of atopic dermatitis are recurrent attacks, polymorphic lesions, dry skin, and severe itching. The occurrence of the disease is related to factors such as genetic susceptibility, immune imbalance, damage to the skin barrier function, and disturbance of the skin flora. Disturbances in the skin flora play an important role in the occurrence and development of inflammatory skin diseases such as atopic dermatitis. In AD patients, pathogenic Staphylococcus aureus is dominantly colonized, and the diversity of commensal bacteria in the skin decreases, leading to damage to the host skin barrier and imbalance of the immune system. Staphylococcus aureus in the skin lesions of AD patients uses the ceramidase in the bacteria to stimulate the self-hydrolysis of skin ceramides, which reduces ceramide expression and causes an increase in transepidermal water loss (TEWL), leading to dry skin and easy formation of Staphylococcus aureus colonization.

[0004] The treatment principles of atopic dermatitis are to restore the normal barrier function of the skin, relieve or eliminate clinical symptoms, identify and eliminate inducing and / or aggravating factors, reduce and prevent recurrence, and improve the patient's quality of life.

[0005] Currently, the treatment of atopic dermatitis mainly includes: topical moisturizers as a basic care method, topical glucocorticoids and oral antihistamines on the skin lesions, and systemic glucocorticoids or immunosuppressants, biological agents, and small molecule inhibitors in severe cases. However, long-term use of drug treatments has the problem of increased adverse reactions and weakened efficacy. In particular, there is a lack of targeted treatments for the disturbance of the skin flora in patients with atopic dermatitis. Traditional hormone drugs are unable to restore the skin microbial barrier, which is one of the important factors leading to recurrence and aggravation of the disease. Although topical antimicrobial preparations can partially correct flora disorders and control secondary bacterial infections, long-term topical antimicrobial drugs are not recommended to reduce the risk of antibiotic resistance and sensitization.

[0006] The applicant's research found that Malassezia globosa is the most abundant resident yeast in the skin of healthy adults. The content of Malassezia globosa in the skin lesions of AD patients decreased significantly and was negatively correlated with the severity of the disease. After the treatment alleviated the condition, the content of this fungus increased, suggesting that Malassezia globosa has a potential protective effect. The applicant established an AD-like dermatitis animal model and found that external application of Malassezia globosa can significantly alleviate the inflammatory response, reduce the thickness of the stratum corneum, reduce the infiltration of inflammatory cells and the expression and secretion of pro-inflammatory factors. In addition, both active and inactivated Malassezia globosa have the effect of inhibiting the growth, proliferation and exocytosis of Staphylococcus aureus in vitro. The above results indicate that external application of Malassezia globosa has potential clinical application value for atopic dermatitis.

[0007] This invention provides a targeted treatment for the disturbed skin flora in AD. By supplementing with Malassezia globosa topically, it leverages its potential protective effects to alleviate inflammation, reduce reliance on traditional medications, and thus mitigate the adverse reactions associated with long-term use of traditional medications. Furthermore, this invention addresses the pathological mechanisms of disturbed skin flora in AD patients, helping to restore the skin's microbial barrier and reduce Staphylococcus aureus colonization, thus addressing the shortcomings of traditional medications in this regard.

[0008] The topical cream of the present invention has the advantages of strong targeting, high safety, significant efficacy, and strong innovation. The present invention directly targets the pathological mechanism of skin flora disorder in patients with atopic dermatitis. By supplementing with Malassezia globosa, it helps to restore the skin microbial barrier and reduce the colonization of Staphylococcus aureus. Malassezia globosa is the most abundant resident yeast in the skin of healthy adults. Topical supplementation of Malassezia globosa is relatively safe and can reduce the adverse reactions caused by long-term use of traditional drugs. Studies on animal models of AD-like dermatitis established by the applicant have shown that topical application of Malassezia globosa can significantly alleviate inflammatory reactions, reduce stratum corneum thickness, reduce inflammatory cell infiltration, and reduce the expression and secretion of pro-inflammatory factors. At the same time, the present invention provides new ideas and methods for the treatment of atopic dermatitis, which is expected to overcome the problems of drug resistance and adverse reactions caused by long-term use of traditional drugs. Summary of the Invention

[0009] The present invention aims to provide a topical cream for treating atopic dermatitis and a preparation method thereof, in view of the defects and shortcomings of existing topical therapeutic drugs for treating atopic dermatitis, such as the disorder of the patient's skin flora, the lack of targeted treatment, and the inability to restore the skin microbial barrier. The cream of the present invention is an inactivated Malassezia globosa preparation, which is used externally for local treatment of skin lesions of atopic dermatitis, replenishes skin commensal bacteria, helps restore the patient's skin barrier, significantly inhibits the growth, proliferation and exocytosis of Staphylococcus aureus in dermatitis lesions, significantly alleviates inflammatory reactions, reduces the thickness of the stratum corneum, and reduces inflammatory cell infiltration; and plays a role in the expression and secretion of pro-inflammatory factors, thereby assisting in the treatment of atopic dermatitis and having a significant therapeutic effect on atopic dermatitis. The topical cream of the present invention has a rapid effect on atopic dermatitis, few toxic and side effects, and good safety, and has good medicinal prospects.

[0010] To achieve the object of the present invention, the present invention provides a pharmaceutical composition for treating atopic dermatitis, comprising inactivated Malassezia globosa, wherein the strain deposit number of the Malassezia globosa is ATCC 96807.

[0011] ATCC: full name American Type Culture Collection.

[0012] Wherein, the pharmaceutical composition is an external cream composition.

[0013] Particularly, the cream composition comprises 1.5-3.5 parts by weight of inactivated Malassezia globosa.

[0014] Particularly, the weight proportion of the inactivated Malassezia globosa in the cream composition is preferably 1.5-2.5 parts, more preferably 2 parts.

[0015] Particularly, the amount of the inactivated Malassezia globosa in the cream composition is 1.5-3.5, preferably 1.5-2.5, and more preferably 2.

[0016] In particular, it further includes an oil phase component, a moisturizer, a thickener, an emulsifier, a preservative, a pH adjuster, and a solvent, wherein the solvent is pure water.

[0017] In particular, the weight proportions of the oil phase component, moisturizer, thickener, emulsifier, preservative, pH adjuster, and solvent per 100 parts by weight of the cream composition are as follows:

[0018]

[0019] Particularly, the weight proportion of the solvent is 40-70 parts.

[0020] In particular, the weight ratio of the oil phase component, moisturizer, thickener, emulsifier, preservative, and solvent per 100 parts by weight of the cream composition is preferably:

[0021]

[0022]

[0023] In particular, the moisturizer includes glycerin and sodium hyaluronate; the oil phase ingredients include white petrolatum, lanolin, and stearic acid; the emulsifier includes glyceryl monostearate and polysorbate 80; the thickener is carbomer; the preservative is sodium benzoate, potassium sorbate, methylparaben, ethylparaben, or phenoxyethanol, preferably phenoxyethanol; and the pH adjuster is triethanolamine.

[0024] In particular, the weight ratio of glycerin to sodium hyaluronate in the moisturizer is 100:(4-6), preferably 100:5; the weight ratio of white petrolatum, lanolin, and stearic acid in the oil phase is 100:(40-60):(40-60), preferably 100:50:50; the weight ratio of glyceryl monostearate to polysorbate 80 in the emulsifier is 100:(10-30), preferably 100:20. The weight ratio of the preservative is further preferably 0.5; and the pH adjuster is used to adjust the pH value of the cream to 4.5-5.5.

[0025] In particular, the inactivated Malassezia globosa is prepared according to the following method:

[0026] A) Preparation of Malassezia suspension

[0027] First, Malassezia was cultured, and then sterile water for injection was added to prepare (0.5-2)×10 6 CFU / mL Malassezia suspension;

[0028] B) Inactivation treatment

[0029] The Malassezia suspension is heated to 70-90° C. (preferably 80° C.) and maintained at 70-90° C. for 60-120 minutes (preferably 80 minutes) to inactivate the bacteria, thereby obtaining an inactivated Malassezia sphaeroides suspension.

[0030] C) Centrifugation:

[0031] The inactivated Malassezia globosa suspension was cooled to room temperature and then centrifuged at a speed of (3000 ± 100) rpm for (15 ± 5) minutes.

[0032] D) Precipitation washing:

[0033] The centrifugal supernatant was removed and the centrifugal precipitate was washed 4-6 times with sterile water for injection to remove the residual culture medium components to obtain a suspension of inactivated Malassezia bacteria;

[0034] E) Drying treatment:

[0035] The inactivated Malassezia bacterial suspension is dried to obtain the product.

[0036] Particularly, the expanded culture in step A) is to inoculate Malassezia globosa into ATCC medium: 2693 modified Dixon (mDixon), and culture at 25±2° C. for 40-56 h (preferably 48 h).

[0037] In particular, the method further comprises transferring the Malassezia on the surface of the culture medium after the expanded culture into a sterile conical flask; and then adding sterile water for injection to prepare the (0.5-2)×10 6 CFU / mL of Malassezia suspension.

[0038] In particular, after the inactivation treatment in step B), the method further includes verifying whether the Malassezia has been inactivated, i.e., taking out 100uL of the inactivated bacterial suspension and smearing it on a Dixon plate culture medium. If no colonies grow after one week, it is confirmed that all the Malassezia have been inactivated.

[0039] In particular, in step D), the centrifuged precipitate is washed with sterile water for injection until the supernatant is colorless and transparent to remove residual culture medium components.

[0040] By washing, the residual culture medium components in the precipitate are significantly reduced, and the residual culture medium amount in the final obtained inactivated Malassezia suspension is lower than the detection limit, thereby obtaining the inactivated Malassezia suspension.

[0041] In particular, the drying process in step E) comprises:

[0042] E1) rapidly freezing the inactivated Malassezia bacteria suspension in a refrigerator at -75°C to -85°C (preferably -80°C) for 7-15 hours (preferably 10 hours) to prepare pre-frozen Malassezia bacteria;

[0043] E2) The pre-frozen Malassezia cells were placed in a freeze dryer and dried at a temperature of (-50±1)°C and a low vacuum (absolute pressure of 10±5 Pa) for 24 hours to obtain freeze-dried Malassezia cells.

[0044] Another aspect of the present invention provides a method for preparing a cream composition for treating atopic dermatitis, comprising the following steps:

[0045] 1) Prepare the raw materials according to the following weight ratio per 100 weight parts of the cream:

[0046]

[0047] 2) adding the moisturizing agent to the first pure water under stirring to prepare an aqueous phase mixture, wherein the ratio of the first pure water to the total amount of pure water is (70-80):100;

[0048] 3) Adding a thickener to the aqueous phase mixture under stirring and stirring to dissolve the thickener to prepare an aqueous phase;

[0049] 4) After the oil phase components are heated and melted, an oil phase emulsifier is added while stirring, and the mixture is stirred and mixed while maintaining the temperature at 70-90°C (preferably 80°C) to prepare the oil phase;

[0050] 5) While maintaining the temperature at 75-80° C., slowly add the aqueous phase to the oil phase while stirring to perform a first emulsification and stirring process; when the temperature of the mixed system drops to 40-45° C., add polysorbate 80 (an aqueous emulsifier) to perform a second emulsification and stirring process, stirring uniformly to prepare a cream precursor;

[0051] 6) While stirring, add a pH adjuster to the cream precursor to adjust the pH of the mixture to 5.5-6.5, and then add the remaining purified water;

[0052] 7) While stirring, add preservatives, stir evenly, then add inactivated Malassezia sphaeroides and stir evenly.

[0053] Wherein, the moisturizing agent in step 1) includes glycerin and sodium hyaluronate; the oil phase ingredients include white petrolatum, lanolin, and stearic acid; the emulsifier includes glyceryl monostearate and polysorbate 80; the thickener is carbomer; the preservative is sodium benzoate, potassium sorbate, methylparaben, ethylparaben, or phenoxyethanol, preferably phenoxyethanol; and the pH adjuster is triethanolamine.

[0054] In particular, the weight ratio of glycerin to sodium hyaluronate in the moisturizer is 100:(4-6), preferably 100:5; the weight ratio of white petrolatum, stearic acid, and lanolin in the oil phase is 100:(40-60):(40-60), preferably 100:50:50; the weight ratio of glyceryl monostearate to polysorbate 80 in the emulsifier is 100:(10-30), preferably 100:20. The weight ratio of the preservative is further preferably 0.5; and the pH adjuster is used to adjust the pH value of the cream to 4.5-5.5.

[0055] In particular, the amount of pure water in step 1) is 40-70, preferably 49-60.1.

[0056] In particular, the emulsifier in step 1) includes an oil phase emulsifier and a water phase emulsifier, wherein the oil phase emulsifier is glyceryl monostearate; and the water phase emulsifier is polysorbate 80.

[0057] Particularly, the weight ratio of the oil phase emulsifier to the water phase emulsifier is 100:(10-30), preferably 100:20.

[0058] In particular, step 3) further comprises heating and maintaining the temperature at 70-90° C. (preferably 80° C.) after adding the thickener to dissolve the thickener, wherein the heating rate is 2-5° C. / min, preferably 5° C. / min.

[0059] In particular, in step 5), the aqueous phase is added to the melted oil phase at a storage temperature of 75-80° C.; the stirring rate of the first emulsification is 500-800 rpm, and the stirring time is 5-7 min.

[0060] In particular, in step 5), the aqueous emulsifier is added under the condition that the temperature is lowered to 40-45° C.; the stirring rate of the second emulsification is 500-800 rpm, and the stirring time is 5-7 min.

[0061] In particular, in step 6), the pH of the mixed system is adjusted to 6.0.

[0062] Particularly, the stirring rate for adding the pH adjuster is 500-800 rpm, and the stirring time is 5-7 min.

[0063] In particular, after the remaining pure water was added, the viscosity of the cream precursor was measured and found to be 1500-2500 mPa·s.

[0064] In particular, in step 7), the temperature of the mixed system is lowered to 40-50° C. before adding the preservative; the stirring rate is 500-800 rpm, and the stirring time is 5-7 min.

[0065] In particular, the inactivated Malassezia globosa was added after the temperature was lowered to room temperature (20±5°C).

[0066] In another aspect, the present invention provides a use of Malassezia globosa in preparing a medicament for treating atopic dermatitis, wherein the strain deposit number of the Malassezia globosa is ATCC 96807.

[0067] This study uses topical inactivated bacteria to supplement skin commensal bacteria and help restore the patient's skin barrier, thereby achieving a therapeutic effect.

[0068] This product is used externally on atopic dermatitis lesions (erythema, scales) that are not damaged or suspected of infection, as well as the surrounding dry skin, to evaluate whether it can alleviate the severity of the disease.

[0069] The cream for treating atopic dermatitis of the present invention is applied externally to the atopic dermatitis lesions and surrounding skin once a day. After applying the cream of the present invention, moisturizer can be used normally.

[0070] 1. The cream for treating atopic dermatitis of the present invention restores normal skin flora by supplementing the skin-colonizing yeast Malassezia globosa, has a simple medication method, and is easy to store.

[0071] 2. In the cream of the present invention, the inactivated Malassezia globosa powder is the main active ingredient, which regulates and balances the skin microbial ecology; glycerol and sodium hyaluronate are moisturizers, which enhance the skin's moisture retention ability and enhance the skin's barrier function; stearic acid in the oil phase component is used to enhance the emulsification effect, white vaseline is used to increase the moisturizing properties of the cream, and lanolin is used to enhance the skin affinity of the cream; glyceryl monostearate in the emulsifier is used to enhance the stability of the cream, polysorbate 80 is used to enhance the stability of the cream, and triethanolamine is used to adjust the pH of the cream, while optimizing the texture of the cream and improving its safety in use.

[0072] 3. The stability of the emulsifiable paste of the present invention is good. The stability of the inactivated Malassezia spherica dry powder is good, is not affected by environmental changes, and does not require cold chain storage. This makes the emulsifiable paste more convenient during storage and use, and is not easily invalidated by environmental changes. Moreover, the inactivated Malassezia spherica cell structure remains intact, which can be verified by calcofluor white staining. In addition, cell integrity also affects the stability and efficacy of the emulsifiable paste. No viable bacteria remain in the inactivated bacteria by culture medium coating and MTT test verification.

[0073] 4. The cream of the present invention has good safety. The inactivated Malassezia globosa dry powder is highly safe and will not cause phage contamination or outbreak. It is also relatively safe for special groups such as immunodeficient patients, pregnant women and young children.

[0074] 5. The cream of the present invention can significantly improve immune performance. The inactivated Malassezia sphaeroides can regulate the skin microecology by competitively excluding pathogens and adsorbing mycotoxins, thereby enhancing the nonspecific immune function of the skin.

[0075] 6. The cream of the present invention has good adhesion to the skin, and the inactivated Malassezia globosa dry powder can adhere to the skin surface to form a biofilm, thereby effectively protecting the skin.

[0076] 7. The cream of the present invention has high antioxidant properties, inactivates the antioxidant activity of Malassezia sphaeroides, can scavenge free radicals, and can be used to prepare antioxidants.

[0077] The pH value of the cream of the present invention is 5.5-6.5, which is close to the natural pH value of human skin and has little irritation to the skin. The viscosity is 1500-2500 mPa·s, ensuring that the cream has good spreadability and stability. In addition, the microbial content meets relevant national standards, and no pathogenic bacteria are detected, ensuring the safety of the product. After the cream is left standing at room temperature for 24 hours, there is no obvious stratification or precipitation, ensuring the long-term stability of the product. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] Figure 1 (A) Structure of the dermatophyte flora in the antecubital fossa (non-seborrheic area).

[0079] Figure 1 (B) Structure of the fungal flora on the back of the neck (seborrheic area).

[0080] Figure 1C The changes in the content of Malassezia (C) in AD lesional areas (AD.LS), AD non-lesional areas (AD.NLS) and the skin of the elbows and back of the neck of healthy subjects (Control).

[0081] Figure 1D The changes in the content of Malassezia globosa (D) in AD lesional areas (AD.LS), AD non-lesional areas (AD.NLS) and the skin of the elbows and back of the neck of healthy subjects (Control).

[0082] Figure 2A Schematic diagram of the process for constructing AD animal models.

[0083] Figure 2B The clinical manifestations of mice in each group are shown in Figure 1, where a is the blank control group (PBS group alone); b is the control group 1 (MC903+PBS group); and c is the experimental group 1 (MC903+Malassezia globosa suspension group).

[0084] Figure 2C The following are the skin pathological manifestations and HE staining results of each group of mice at the completion of the experiment, among which a is the blank control group mice (PBS group alone (Blank)); b is the control group 1 mice (MC903 + PBS group); c is the experimental group 1 mice (MC903 + Malassezia globosa suspension group).

[0085] Figure 2D Epidermal thickness (a), infiltration levels of IL-1β (b), IL-6 (c), IL-4 (d), IL-31 (e) and TSLP (f) in the blank control group, control group 1 and experimental group 1 at the completion of the experiment.

[0086] Figure 2E Schematic diagram of the process for constructing AD animal models.

[0087] Figure 2FThese are the clinical manifestations of the two groups of mice (experimental group and control group) at the completion of the experiment.

[0088] Figure 2G The figure shows the histopathological manifestations and HE staining results of the two groups of mice (experimental group and control group) at the completion of the experiment.

[0089] Figure 2H The infiltration status of IL-1β, IL-4, IL-6 and IL-31 in the two groups of mice (experimental group and control group) at the completion of the experiment. DETAILED DESCRIPTION

[0090] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.

[0091] The beneficial effects of the drug of the present invention are further illustrated below through test examples, which include pharmacodynamic tests of the drug of the present invention.

[0092] Example 1 Preservative Screening

[0093] The Microbial Challenge Test is used to verify the dosage and uniformity of preservatives (such as phenoxyethanol). This method evaluates the effectiveness of preservatives by inoculating specific microorganisms into cosmetics and observing the inhibitory effect of preservatives on microbial growth. The specific steps are as follows:

[0094] 1. Prepare test strains: Select common microbial strains of the skin. In the specific embodiment of the present invention, the test strains selected are Staphylococcus aureus (ATCC 25923) and Malassezia globosa (ATCC 96807).

[0095] 2. Prepare bacterial suspension: Cultivate each strain to the logarithmic growth phase and prepare a concentration of 1×10 6 CFU / mL of bacterial suspension.

[0096] 3. Sample preparation: Different preservatives with a concentration of 0.25%-0.5% were added to the cream samples. The preservatives were: phenoxyethanol, sodium benzoate, potassium sorbate, and the concentrations of each preservative were 0.25%, 0.30%, 0.35%, 0.40%, 0.45%, and 0.50%, respectively.

[0097] 4. Inoculation of microorganisms: Inoculate each bacterial suspension into samples containing different types and concentrations of preservatives. For each strain (Staphylococcus aureus, Malassezia globosa), inoculate 1 mL of bacterial suspension. Culture conditions: 35°C ± 2°C, aerobic culture.

[0098] 5. Culture and detection: On the 0th, 1st, 7th, 14th, 21st and 28th day after inoculation, samples were taken for plate count (APC) to detect the number of microorganisms.

[0099] 6. Result determination: According to the European Pharmacopoeia standards, the total bacterial colony count should decrease by 99.9% on the 7th day and show no growth on the 28th day; the fungal colony count should decrease by 99.0% on the 14th day and show no growth on the 28th day.

[0100] Screening results: At an addition amount of 0.5% phenoxyethanol, phenoxyethanol showed a good preservative effect on all test strains. The total bacterial colony count decreased by 100% on the 7th day, and the fungus decreased by 100% on the 14th day, and there was no growth on the 28th day.

[0101] At an addition amount of 0.25%, the inhibitory effect of phenoxyethanol on some strains is slightly weaker, but still meets the preservation requirements.

[0102] Experimental results show that the preservative phenoxyethanol, at a 0.5% addition level, effectively inhibits microbial growth in cosmetics, with uniform distribution, meeting preservation requirements and achieving optimal results. This experimental method can scientifically evaluate the efficacy of preservatives and ensure the safety of cosmetics. The preservative dosage of the present invention is 0.25-1.5%, preferably 0.5%.

[0103] Example 2 Preparation of Malassezia dry fungus powder

[0104] 1. Expand cultivation:

[0105] First, Malassezia globosa (ATCC 96807) was inoculated into a culture dish containing sterile ATCC medium: 2693 modified Dixon (mDixon) (purchased from Qingdao Haibo Biological) and cultured at 25±2°C for 48 hours (usually 40-56 hours) to expand the culture of Malassezia. Then, the Malassezia on the surface of the culture medium was transferred to a sterile conical flask using a spatula. Then, sterile water for injection was added to the conical flask, and 1×10 6 CFU / mL (range 0.5-2.0×10 6 CFU / mL) Malassezia suspension;

[0106] 2. Bacteria inactivation

[0107] The prepared Malassezia suspension is heated to 80°C (usually 70-90°C) and maintained at 80°C for 80 minutes (usually 60-120 minutes) to inactivate the bacteria. 100 μL of the inactivated bacterial suspension is aspirated and spread on a Dixon plate. If no colonies grow after one week, the Malassezia species are confirmed to be inactivated. The inactivated bacterial suspension is cooled to room temperature and then centrifuged (3000 rpm, 15 minutes). After removing the supernatant, the centrifugal pellet is repeatedly washed five times (usually 4-6 times) with sterile water for injection. After each centrifugation, the supernatant is discarded and the pellet is washed with sterile water for injection to remove any residual culture medium in the pellet. The supernatant is washed until the supernatant is colorless and transparent to obtain an inactivated Malassezia suspension.

[0108] 3. Freeze drying

[0109] 3-1) Freezing treatment: The inactivated Malassezia suspension is dispensed into freeze-dried vials and rapidly frozen in a -80°C (usually -75 to -85°C) freezer for 10 hours (usually 7 to 15 hours) to produce pre-frozen Malassezia cells;

[0110] 3-2) Vacuum Drying: The pre-frozen Malassezia cells were placed in a freeze dryer and dried at a temperature of (-50±1)°C and a low vacuum (absolute pressure of 10±5 Pa) for 24 hours to obtain freeze-dried Malassezia cells.

[0111] 4. Collect dry powder

[0112] After drying, the inactivated Malassezia globosa dry powder was obtained and collected directly.

[0113] Example 3 Preparation of cream

[0114] 1. Prepare the following raw materials in the following weight ratio per 100g of cream (g):

[0115]

[0116] Among them, the inactivated bacterial powder is the inactivated Malassezia powder (the main active ingredient of the cream of the present invention), and the inactivated Malassezia spherica dry powder prepared in Example 2 is used as an example for illustration; glycerin and sodium hyaluronate are moisturizers; carbomer is a thickener; white petrolatum, lanolin, and stearic acid are oil phase components; glyceryl monostearate and polysorbate 80 are emulsifiers; phenoxyethanol is a preservative; purified water is a solvent; and triethanolamine is a pH regulator.

[0117] This embodiment is described by taking the preparation of 100g of emulsifiable paste as an example, i.e., the total amount of raw materials is 100g, and the amount of purified water is about 60.5g (i.e. 60.5ml).

[0118] 2. Prepare oil phase

[0119] Put the oil phase components stearic acid, white vaseline and lanolin in a container, add the oil phase emulsifier glyceryl monostearate, heat and maintain the temperature at 80°C (usually 70-90°C), stir evenly to prepare the oil phase;

[0120] 3. Prepare the aqueous phase

[0121] 3-1) Glycerin and sodium hyaluronate are added to first purified water and stirred evenly to completely dissolve the sodium hyaluronate, thereby preparing an aqueous phase mixture. The amount of first purified water is 46 g, and the amount of first purified water accounts for 76.0% (typically 70%-80%) of the total amount of purified water; i.e., the amount of first purified water used is approximately 46 ml (i.e., 46 g).

[0122] 3-2) Adding a thickener, carbomer, to the aqueous phase mixture and continuing to stir until the carbomer fully absorbs water and expands to form a uniform gel solution;

[0123] 3-3) Slowly heating to 80°C (typically 70-90°C), maintaining the temperature at 80°C to completely dissolve the carbomer in the gel solution, thereby obtaining an aqueous phase; the heating rate is 5°C / min (typically 2-5°C / min).

[0124] 4. Emulsification treatment

[0125] 4-1) Slowly add the aqueous phase to the oil phase while stirring at a temperature of 75-80°C to perform a first emulsification stirring process at a stirring rate of 700 rpm (typically 500-800 rpm) for 6 minutes (typically 5-7 minutes);

[0126] 4-2) Continue stirring, and when the temperature of the mixture gradually decreases to 40-45°C during stirring, add the emulsifier polysorbate 80 (Tween 80) and perform a second emulsification stirring process. Stir evenly at a stirring rate of 700 rpm (usually 500-800 rpm) for 6 minutes (usually 5-7 minutes).

[0127] 4-3) While continuing to stir, add triethanolamine (to neutralize carbomer) as a pH adjuster to adjust the pH of the cream to 6.0 (usually 5.5-6.5);

[0128] 4-4) Continue stirring and slowly add the remaining purified water (approximately 14.5 ml, i.e., 14.5 g) until the total volume reaches 97.5 g. Observe the texture of the cream and measure its viscosity until the viscosity reaches 2000 mPa·s (typically 1500-2500 mPa·s) and the following consistency and uniformity are achieved to prepare a cream precursor:

[0129] The viscosity of the cream was measured using a Brookfield viscometer; the final consistency was 1500-2500 mPa·s. The cream should have a uniform milky white appearance, without obvious stratification or precipitation. After standing at room temperature for 24 hours, no obvious stratification or precipitation was observed. Microscopic observation showed that the inactivated Malassezia globosa in the cream was evenly distributed, without aggregation.

[0130] 5. Add preservatives

[0131] After the temperature of the cream precursor drops to 45°C (usually 40-50°C), add the preservative phenoxyethanol and stir evenly;

[0132] 6. Add inactivated dry bacteria powder

[0133] After the temperature of the cream precursor with the preservative added is lowered to room temperature (usually 20±5° C.), the inactivated dried Malassezia bacteria powder is added to the cream precursor with the preservative added and stirred evenly to obtain the cream precursor.

[0134] Fill the prepared cream into a sterile container and seal it for storage.

[0135] Example 4 Preparation of cream

[0136] 1. Prepare the raw materials according to the following weight ratio per 100g of cream (g):

[0137]

[0138] 2. Prepare oil phase

[0139] Same as Example 3.

[0140] 3. Prepare the aqueous phase

[0141] The process is the same as in Example 3 except that the amount of the first pure water is 51 g and the amount of the first purified water is 75% (usually 70%-80%) of the total amount of purified water.

[0142] 4. Emulsification treatment

[0143] Same as Example 3.

[0144] 5. Add preservatives

[0145] Same as Example 3.

[0146] 6. Add inactivated dry bacteria powder

[0147] Same as Example 3.

[0148] Example 5 Preparation of cream

[0149] 1. Prepare the raw materials according to the following weight ratio per 100g of cream (g):

[0150]

[0151] 2. Prepare oil phase

[0152] Same as Example 3.

[0153] 3. Prepare the aqueous phase

[0154] The process is the same as in Example 3 except that the amount of the first pure water is 26.5 g and the amount of the first purified water is 75% (usually 70%-80%) of the total amount of purified water.

[0155] 4. Emulsification treatment

[0156] Same as Example 3.

[0157] 5. Add preservatives

[0158] Same as Example 3.

[0159] 6. Add inactivated dry bacteria powder

[0160] Same as Example 3.

[0161] Comparative Example 1: Excipient Cream without Malassezia

[0162] Except that step 6) is not performed, the rest is the same as Example 3.

[0163] Test Example 1 Microbial Limit Test of Cream (To Ensure No Viable Bacteria Residue)

[0164] 1. Sample preparation

[0165] Randomly select 3 individually packaged cream samples from the same batch, taking 10g of each sample and placing them in sterile containers.

[0166] Three samples were randomly taken from the cream prepared in Example 3, each sample being 10 g.

[0167] 2. Preparation of dilution solution

[0168] The cream sample was mixed with a diluent (sterile phosphate buffered saline, PBS) at a ratio of 1:10 (sample to diluent), and stirred thoroughly to prepare a 10-1 dilution; the dilution was then graded diluted to prepare 10-2 and 10-3 dilutions.

[0169] 3. Inoculation and cultivation

[0170] Take 100 μL each of the 10-1, 10-2, and 10-3 dilutions and inoculate them into sterile mDixon plates, with 3 plates inoculated for each dilution; use a spreader to evenly spread the dilutions on the plates; turn the plates upside down and place them in a constant temperature incubator at 30℃±1℃ for 14 days.

[0171] 4. Counting and result determination

[0172] After the incubation, observe the morphology of the colonies on the plate and count the total number of colonies; calculate the colony forming unit (CFU / mL) in the sample according to the dilution multiple.

[0173] 5. Test results and conclusions

[0174] The colony counts of 10-1, 10-2, and 10-3 dilutions were all 0 CFU / mL.

[0175] The test results showed that the Malassezia globosa content in the cream sample was 0 CFU / g, which met the microbial limit standards specified in the Chinese Pharmacopoeia. Therefore, the cream sample met the microbial limit requirements.

[0176] Test Example 2 Safety Test of Cream

[0177] 1. pH test of cream

[0178] Ensure that the pH value of the sterile preparation is within the skin-acceptable range (4.5-5.5) to reduce skin irritation.

[0179] The electrodes of the calibrated pH meter were inserted into the creams prepared in Examples 3-5, respectively. After waiting for a few seconds until the readings stabilized, the pH values of the creams were recorded.

[0180] Test results: The pH values of the creams prepared in Examples 3-5 were 5.0, 5.2, and 4.9, respectively. The pH value of the creams was within the range of 4.5-5.5. The pH value of the creams of the present invention was safe and would not cause irritation to the skin.

[0181] Test Example 2A: Stability Test of Cream

[0182] 1) Centrifugal test:

[0183] Take the cream samples (10 g each) prepared in Examples 3-5, place them in 50 mL centrifuge tubes, and mark them. Place the centrifuge tubes in a centrifuge for centrifugation (3000 rpm, 30 min). After centrifugation, observe the stratification of the cream. The cream remains uniform, with no obvious stratification or precipitation. The cream has good centrifugal stability.

[0184] 2) High temperature test:

[0185] Take the cream samples prepared in Examples 3-5 (10g each), place them in sealed containers, and label them. The samples are placed in a constant temperature (40°C ± 1°C) incubator for 1 month. The appearance, color, and texture of the creams do not change significantly. This shows that the creams have good stability under high temperature conditions.

[0186] 3) Low temperature test:

[0187] Cream samples (10 g each) prepared in Examples 3-5 were placed in sealed containers and labeled. The samples were placed in a constant temperature (-20°C ± 1°C) refrigerator for 1 month. The creams showed no significant changes in appearance, color, or texture. This indicates that the creams have good stability under low temperature conditions.

[0188] Test Example 3 Analysis of Malassezia Content in Patients with Atopic Dermatitis

[0189] 1. Experimental subjects

[0190] This study enrolled 32 adult patients with atopic dermatitis (AD) and 32 age- and sex-matched healthy controls from Peking University First Hospital. This study was approved by the Ethics Committee of Peking University First Hospital (No. 2023-075). All participants were of Chinese descent and provided written informed consent.

[0191] 2. Skin sampling and testing methods

[0192] Skin swabs were collected from the subjects' lesional areas and from nonlesional areas located 2 cm from the inner forearm (cubital fossa, non-seborrheic area) or the back of the neck (seborrheic area). Sterile cotton swabs pre-moistened with phosphate-buffered saline (PBS) were swabbed 10 times across the face (to obtain a sufficient sample of skin surface microorganisms). The tip of each swab was cut from the handle and placed in a tube containing 1.5 ml of PBS. Swab samples were stored at -20°C until DNA extraction.

[0193] DNA was extracted from skin samples using the DNease Blood and Tissue Kit (QIAGEN, Hilden, Germany). The quality and concentration of the extracted DNA were assessed using a Nanodrop 2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA). DNA was stored at −80°C.

[0194] The target DNA region was amplified using primers specific for the fungal ITS1-5.8S rDNA region (forward primer: GGAAGTAAAGTCGTAACAAGG; reverse primer: GCTGCGTTCTTCATCGATGC; purchased from Beijing Novogene Technology Co., Ltd.). The resulting PCR products were separated by electrophoresis on 2% (w / v) agarose gels and purified using a Gel Extraction Kit (QIAGEN). Amplicon libraries were prepared using the TruSeq DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA). The libraries were quantified using a fluorescence-based assay (Qubit; ThermoFisher Scientific) and quantitative PCR. Sequencing was performed by Novogene Bioinformatics Technology Co., Ltd. (Beijing, China) on an Illumina HiSeq 2500 platform.

[0195] Data quality filtering, clustering, and downstream analyses were performed using QIIME2 (version 1.9.1) software with default settings at all stages. The taxonomic annotation of fungal ITS rDNA sequences was performed using the Unite database.

[0196] The data obtained above were analyzed using the dplyr package in R software (version 4.4.1) for microbiome data analysis, and the following stacked bar charts and box plots were drawn using the ggplot2 package.

[0197] 3. Test results

[0198] The study showed that: in seborrheic areas, the levels of Malassezia and Malassezia globosa in the lesions of AD patients were significantly lower than those in healthy subjects at baseline, while there was no significant change in the levels in non-seborrheic areas ( Figure 1A 、 1B ).

[0199] Compared with the content of Malassezia (C) and Malassezia globosa (D) in the antecubital fossa and posterior neck skin of healthy subjects (Control), the content changes of AD patients in lesional and non-lesional areas are shown in Figure 2. Figure 1C 、 1D .

[0200] 4. Experimental Conclusion

[0201] The content of Malassezia globosa was significantly reduced in the lesions of AD patients, suggesting that this fungus has a potential protective effect against the disease.

[0202] Experimental Example 4: Malassezia globosa alleviates AD-like dermatitis animal model

[0203] 1. Experimental Animals

[0204] Wild-type C57BL / 6 female mice aged 6-8 weeks were purchased from Sibeifu (Beijing) Biotechnology Co., Ltd.

[0205] 2. Experimental drugs and instruments

[0206] Malassezia globosa (ATCC 96807);

[0207] Calcipotriol (MC903); phosphate buffer saline (PBS); TRIzol (RNA extraction reagent); SYBR Green Master Mix (SYBR Green premix, ThermoFisher Scientific, Waltham, MA, USA); Applied Biosystems TM ViiA TM 7 (Thermo Fisher Scientific, Waltham, MA, USA).

[0208] 3. Experimental methods

[0209] Malassezia globosa was cultured on Dixon agar at 35 ± 2 °C for one week, and then resuspended in sterile PBS and adjusted to a concentration of 1 × 10 6 CFU / mL, and Malassezia culture solution was prepared.

[0210] Prepare MC903 stock solution (450 μM): Dissolve 1 mg of calcipotriol in 5.386 ml of anhydrous ethanol and store the stock solution at -20°C. On the day of the experiment, dilute the MC903 stock solution 10-fold with anhydrous ethanol to prepare MC903 working solution (45 μM).

[0211] 1) Construction of model animals

[0212] The mouse back skin was depilated with a razor blade, and 80 μl of MC903 working solution was aspirated with a pipette tip and evenly applied to the mouse back skin for 14 consecutive days to establish an AD-like dermatitis mouse model;

[0213] like Figure 2A The model mice were randomly divided into two groups: the experimental group (MC903+Malassezia globosa suspension group) and the control group (MC903+PBS group).

[0214] The experimental group mice were externally coated with 100 μl of Malassezia globosa suspension, while the control group mice were externally coated with PBS solution as a control. The administration was carried out for 2 days. On the 17th day, the mice were sacrificed and the back skin was cut. The clinical manifestations of the mice in each group are as follows Figure 2B .

[0215] Normal mice were selected as the blank control group, and the back skin was depilated with a blade and evenly coated with PBS solution.

[0216] 2) RNA extraction and RT-PCR steps:

[0217] RNA extraction: Weigh 20 mg of tissue, wash with cold PBS, and mince. Place the tissue in a 1.5 mL centrifuge tube and add 1 mL of TRIzol reagent. Grind the tube at 12,000 rpm for 10 minutes. Collect the supernatant, add 200 μL of chloroform, incubate for 5 minutes, and then centrifuge at 12,000 rpm for 10 minutes. Mix the supernatant with 600 μL of isopropanol, incubate at -20°C for 15 minutes, and centrifuge again. After discarding the supernatant, wash the RNA with 1 mL of 70% ethanol, dry it, and resuspend it in 20 μL of DEPC water. Quantify the RNA using a Nanodrop.

[0218] Reverse Transcription: Mix 2 μg of RNA with 5× gDNA Eraser Buffer and gDNA Eraser, heat to 42°C, and incubate for 2 minutes to remove genomic DNA. Then, add the remaining components and incubate the mixture at 37°C for 15 minutes, followed by incubation at 85°C for 5 seconds to synthesize cDNA. Store cDNA at -20°C.

[0219] Real-time quantitative PCR: Prepare the reaction system, including 1 μL cDNA, 10 μL SYBR Green Master Mix, 1 μL each of forward and reverse primers (see Table 1), and 7 μL RNase-free water. Use Applied Biosystems TM ViiA TM PCR reactions were performed using the PCR system under the following conditions: incubation at 50°C for 2 min, incubation at 95°C for 2 min, followed by 40 cycles, each cycle consisting of 95°C for 15 s and 60°C for 1 min, and finally 95°C for 15 s and 60°C for 1 min.

[0220] Table 1 Forward and reverse primers for real-time quantitative PCR

[0221] Destination fragment Forward primer (5'-3') Reverse primer (3'-5') Gapdh CCGTAGACAAAATGGTGAAGG CGTGAGTGGAGTCATACTGGA Il6 TCTATACCACTTCACAAGTCGGA GAATTGCCATTGCACAACTCTTT Il4 GGTCTCAACCCCCAGCTAGT GCCGATGATCTCTCTCAAGTGAT Il1β GAAATGCCACCTTTTGACAGTG TGGATGCTCTCATCAGGACAG Il31 TCAGCAGACGAATCAATACAGC TCGCTCAACACTTTGACTTTCT Tslp ACGGATGGGGCTAACTTACAA AGTCCTCGATTTGCTCGAACT

[0222] The infiltration level test results of inflammatory factors L-1β, IL-6, IL-4, IL-31 and TSLP are as follows Figure 2D, where b, c, d, e, and f correspond to inflammatory factors L-1β, IL-6, IL-4, IL-31, and TSLP, respectively.

[0223] 3) HE staining steps:

[0224] 3-1) Fixation, dehydration, and embedding: Fix the tissue block in neutral formalin fixative and then rinse with running water to remove any residual fixative and crystalline precipitate. Dehydrate the tissue using ethanol solutions of varying concentrations (e.g., 75%, 85%, 95%, 100%, 100%). Use xylene as a clearing agent to displace the ethanol in the tissue. Mix xylene and paraffin wax in appropriate ratios (1:3, 1:1, 3:1) and then soak the tissue. Finally, soak the tissue in pure paraffin wax 2-3 times for 2 hours each. Orient the fully waxed tissue in an embedding mold and remove it from the mold after solidification.

[0225] 3-2) Sectioning, dewaxing, and rehydration: Shape the wax block according to the sectioning direction and fix it to the microtome. The slice thickness is 10 μm. The excised tissue is spread in warm water at 35-45°C and then dried at 40°C to obtain paraffin sections.

[0226] 3-3) Prepared paraffin sections were baked at 65°C for 2 hours, then immersed in xylene I and xylene II for 15 minutes each, followed by immersion in 100% ethanol I, 100% anhydrous ethanol II, 95% ethanol, 85% ethanol, and 75% ethanol for 5 minutes each. Finally, the sections were washed three times with distilled water for 3 minutes each.

[0227] 3-4) Stain the sections in Harris hematoxylin solution for 5 minutes, rinse with tap water, differentiate in hydrochloric acid alcohol for 5 seconds, rinse again with tap water, then soak in ammonia solution for 30 seconds, and finally rinse with tap water;

[0228] 3-5) Place the slices in eosin stain for 2 minutes, then perform gradient dehydration and xylene clearing, and finally seal with resin. Figure 2C .

[0229] 4) Skin thickness detection steps:

[0230] Epidermal thickness was measured using NDP.view2 software. Three representative points were selected for measurement on each slice to obtain a more accurate average thickness.

[0231] 4. Experimental results and conclusions

[0232] The applicant's research based on an AD-like dermatitis animal model showed that external application of Malassezia globosa suspension can significantly alleviate skin erythema and scaling ( Figure 2B ) and reduce the thickness of the epidermis. The results are as follows Figure 2D The results of real-time quantitative PCR assay of inflammatory factors were as follows: Figure 2D The test results showed that Malassezia can significantly reduce the expression of inflammatory factors such as IL-1b, IL-6, TSLP, IL-31 and IL-33 in the skin.

[0233] Conclusion: Malassezia globosa suspension can significantly alleviate the infiltration of inflammatory factors and reduce epidermal thickness in the AD-like dermatitis model in mice.

[0234] Test Example 5: Malassezia globosa dry powder cream alleviates AD-like dermatitis animal model

[0235] 1. Experimental Animals

[0236] Same as Test Example 4.

[0237] 2. Experimental drugs and instruments

[0238] Calcipotriol (MC903); phosphate buffer saline (PBS); TRIzol (RNA extraction reagent); SYBR Green Master Mix (SYBR Green premix, ThermoFisher Scientific, Waltham, MA, USA); Applied Biosystems TM ViiA TM 7 (Thermo Fisher Scientific, Waltham, MA, USA).

[0239] The cream of the present invention (prepared by the method of Example 3); the excipient cream without Malassezia (Comparative Example 1).

[0240] 3. Experimental methods

[0241] The preparation of MC903 stock solution (450 μM) and MC903 working solution (45 μM) was the same as that in Experimental Example 4.

[0242] 1) Construction of model animals

[0243] like Figure 2E The mouse back skin was depilated with a blade, and 80 μl of MC903 working solution was aspirated with a pipette tip and evenly applied to the mouse back skin for 14 consecutive days to establish an AD-like dermatitis mouse model;

[0244] The model mice were randomly divided into two groups: an experimental group (MC903 + cream of the present invention group) and a control group (MC903 + excipient cream of the present invention not containing Malassezia group).

[0245] The experimental group of mice was externally coated with the cream prepared in Example 3 of the present invention, and the control group of mice was externally coated with the excipient cream of the present invention without Malassezia prepared in Control Example 1 of the present invention. This was done for 3 days. On the 18th day, the mice were sacrificed and the back skin was cut. The clinical manifestations of the mice in each group were as follows: Figure 2F .

[0246] 2) RNA extraction and RT-PCR steps:

[0247] The extraction and real-time quantitative PCR operation methods were the same as those in Experimental Example 4.

[0248] The infiltration level test results of inflammatory factors L-1β, IL-6, IL-4, IL-31 and TSLP are as follows Figure 2H .

[0249] 3) HE staining steps:

[0250] Same as Test Example 4. Observation under a microscope, HE staining results are as follows Figure 2G .

[0251] 4. Experimental results and conclusions

[0252] External application of Malassezia globosa dry powder cream can significantly alleviate skin erythema and scaling symptoms and reduce the infiltration levels of IL-1β and IL-4 in skin lesions.

[0253] Conclusion: Malassezia globosa dry powder cream can significantly alleviate the level of erythema and scaling in the AD-like dermatitis model in mice and reduce the infiltration of inflammatory factors.

[0254] The preferred embodiments of the present invention have been described in detail above. It should be understood that numerous modifications and variations based on the concepts of the present invention can be made by one of ordinary skill in the art without inventive effort. Therefore, any technical solution that can be derived by one of ordinary skill in the art through logical analysis, reasoning, or limited experimentation based on the concepts of the present invention and the prior art should be within the scope of protection defined by the claims.

Claims

1. A pharmaceutical composition for treating atopic dermatitis, characterized in that: The invention comprises inactivated Malassezia sphaeroides, wherein the bacterial species collection number of the Malassezia sphaeroides is ATCC 96807.

2. The pharmaceutical composition according to claim 1, wherein The weight portion of the inactivated Malassezia globosa in the cream composition is 1.5-3.

5.

3. The pharmaceutical composition according to claim 1 or 2, characterized in that It also includes oil phase ingredients, moisturizers, thickeners, emulsifiers, preservatives, pH adjusters, and purified water.

4. The pharmaceutical composition according to claim 3, wherein The weight proportions of the oil phase component, moisturizer, thickener, emulsifier, preservative, pH regulator, and solvent in every 100 parts by weight of the cream composition are as follows:

5. The pharmaceutical composition according to claim 3, wherein The moisturizing agent includes glycerin and sodium hyaluronate; The oil phase ingredients include white petrolatum, lanolin, and stearic acid; the emulsifier includes glyceryl monostearate and polysorbate 80; the thickener is carbomer; the preservative is sodium benzoate, potassium sorbate, methylparaben, ethylparaben, or phenoxyethanol, preferably phenoxyethanol; and the pH adjuster is triethanolamine.

6. The pharmaceutical composition according to claim 5, characterized in that The weight ratio of glycerol to sodium hyaluronate in the moisturizer is 100:(4-6), preferably 100:5; the weight ratio of white petrolatum, stearic acid, and lanolin in the oil phase components is 100:(40-60):(40-60), preferably 100:50:50; the weight ratio of glyceryl monostearate and polysorbate 80 in the emulsifier is 100:(10-30), preferably 100:

20.

7. The pharmaceutical composition according to claim 1 or 2, characterized in that: The inactivated Malassezia globosa is prepared according to the following method: A) Preparation of Malassezia suspension First, Malassezia was cultured, and then sterile water for injection was added to prepare (0.5-2)×10 6 CFU / mL Malassezia suspension; B) Inactivation treatment The Malassezia suspension is heated to 70-90° C. (preferably 80° C.) and maintained at 70-90° C. for 60-120 minutes (preferably 80 minutes) to inactivate the bacteria, thereby obtaining an inactivated Malassezia sphaeroides suspension. C) Centrifugation: The inactivated Malassezia globosa suspension was cooled to room temperature and then centrifuged at a speed of (3000 ± 100) rpm for (15 ± 5) minutes. D) Precipitation washing: The centrifugal supernatant was removed and the centrifugal precipitate was washed 4-6 times with sterile water for injection to remove the residual culture medium components to obtain a suspension of inactivated Malassezia bacteria; E) Drying treatment: The inactivated Malassezia bacterial suspension is dried to obtain the product.

8. A method for preparing a pharmaceutical composition for treating atopic dermatitis, characterized in that: The steps include: 1) Prepare the raw materials according to the following weight ratio per 100 weight parts of the cream: 2) adding the moisturizing agent to the first pure water under stirring to prepare an aqueous phase mixture, wherein the ratio of the first pure water to the total amount of pure water is (70-80):100; 3) Adding a thickener to the aqueous phase mixture under stirring and stirring to dissolve the thickener to prepare an aqueous phase; 4) After the oil phase components are heated and melted, an oil phase emulsifier is added while stirring, and the mixture is stirred and mixed while maintaining the temperature at 70-90°C (preferably 80°C) to prepare the oil phase; 5) While maintaining the temperature at 75-80° C., slowly add the aqueous phase to the oil phase while stirring to perform a first emulsification and stirring process; when the temperature of the mixed system drops to 40-45° C., add polysorbate 80 (an aqueous emulsifier) to perform a second emulsification and stirring process, stirring uniformly to prepare a cream precursor; 6) While stirring, add a pH adjuster to the cream precursor to adjust the pH of the mixture to 5.5-6.5, and then add the remaining purified water; 7) While stirring, add preservatives, stir evenly, then add inactivated Malassezia sphaeroides and stir evenly.

9. The preparation method according to claim 8, characterized in that: In step 1), the moisturizer includes glycerin and sodium hyaluronate; the oil phase ingredients include white petrolatum, lanolin, and stearic acid; the emulsifier includes glyceryl monostearate and polysorbate 80; the thickener is carbomer; the preservative is sodium benzoate, potassium sorbate, methylparaben, ethylparaben, or phenoxyethanol, preferably phenoxyethanol; and the pH adjuster is triethanolamine.

10. Use of Malassezia globosa in the preparation of a medicament for treating atopic dermatitis, characterized in that: The strain collection number of the Malassezia globosa is ATCC 96807.

Images