Gene methylation marker and application thereof

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to a gene methylation marker and application thereof. The invention discloses the ELTD1 gene methylation marker for the first time, the ELTD1 gene methylation marker can be used for diagnosis, screening, monitoring, curative effect evaluation or prognosis evaluation of the lung cancer, the sensitivity is high, and the detection rate of the lung cancer is greatly improved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and particularly relates to gene methylation markers and applications thereof. Background Art

[0002] The pathological process of lung cancer is complex and highly heterogeneous. Based on different pathological features, lung cancer is divided into two types: non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC). The former accounts for approximately 85% of cases. NSCLC has a high incidence and is relatively insidious. Early patients often have no obvious symptoms, and most patients are already in the advanced stage when they present with symptoms. The overall five-year survival rate is only around 20%. Although medical imaging technologies (such as chest X-rays and CT scans) play an important role in the early detection of lung cancer, traditional imaging methods can only identify malignant pulmonary nodules with typical features, such as lobulation, spiculation, pleural traction, air bronchioles and alveoli, and eccentric thick-walled cavities. These methods also have a high false-positive rate, exposing non-tumor subjects to the risk of invasive testing. Early lung cancer lesions consist of only a few layers of cells, 0.2-1 mm thick and several millimeters in diameter, making them difficult to detect visually. Currently, the gold standard lung biopsy technique, invasive as it is, does not allow for serial sampling, makes multiple biopsies difficult to assess intratumor heterogeneity, and patient compliance with multiple biopsies is often poor. Furthermore, the probability of pneumothorax during biopsy collection is as high as 15%. Given the current inadequacy of early lung cancer diagnosis strategies, liquid biopsy (LB) offers a safer and faster diagnostic strategy.

[0003] Circulating free DNA (cfDNA) methylation and exosomal DNA methylation are emerging biomarkers that have received widespread attention in the field of early tumor diagnosis in recent years. cfDNA refers to DNA fragments that circulate in the blood and originate from apoptotic or necrotic cells. Its methylation pattern can reflect the epigenetic state of the primary tumor. It has the advantages of being non-invasive, highly sensitive, and highly specific. It can provide real-time biological information about the tumor, facilitating early detection and monitoring of its dynamic changes. Exosomes are nanoscale vesicles secreted by cells that contain biological molecules such as proteins, RNA, and DNA. The methylation pattern of exosomal DNA can also serve as a biomarker for tumor diagnosis. Exosomal DNA methylation can detect more abundant mutation sites and numbers. Therefore, detection of exosomal DNA methylation markers is expected to become an important tool for the early diagnosis of lung cancer, providing a new strategy for improving the survival rate and quality of life of lung cancer patients.

[0004] DNA methylation is an important epigenetic modification that refers to the addition of methyl groups to DNA molecules, usually occurring on cytosine bases. Studies have found that the DNA methylation patterns of tumor cells are significantly different from those of normal cells, and changes in DNA methylation can occur, especially in the early stages of cancer development. Compared with traditional imaging and tumor marker testing, DNA methylation testing has significant advantages in the early diagnosis of tumors. Changes in methylation patterns can reflect the occurrence of lesions before cancer cells appear, and its high sensitivity and specificity enable it to detect tiny traces of cancer. In addition, DNA methylation testing is not limited by tissue sampling and can be performed using non-invasive samples such as blood and urine, which greatly facilitates the diagnosis of lung cancer. In recent years, multiple studies have demonstrated that the methylation patterns of specific genes have important potential in the diagnosis of lung cancer and are expected to become an important auxiliary diagnostic tool. Summary of the Invention

[0005] The first aspect of the present invention aims to provide gene methylation markers.

[0006] The purpose of the second aspect of the present invention is to provide use of a substance for detecting the marker of the first aspect of the present invention in preparing a product.

[0007] The third aspect of the present invention aims to provide a product.

[0008] The fourth aspect of the present invention aims to provide a device or system.

[0009] A fifth aspect of the present invention is to provide a computer device.

[0010] The sixth aspect of the present invention aims to provide a computer storable medium.

[0011] The seventh aspect of the present invention aims to provide a method.

[0012] In order to achieve the above object, the technical solution adopted by the present invention is:

[0013] In a first aspect of the present invention, a gene methylation marker is provided, wherein the gene is the ELTD1 gene.

[0014] In some embodiments, the sequence of the ELTD1 gene is the sequence corresponding to chr1:79472381-79472580, i.e., GAGTGAGTGCGGCTGTGGACCCGGGACCGGGCGCCGCTGGGCGGGCGCGGCAGGGTCCCGGATCCGTCCTCCGTGACGCGCCGGCTTCCTCCGGACACTTTCCGGCCTCTTTTGTGTGAGTGTGTGAGTCAAGCCCTGAATCCGCTGGCCACGTCCGGCCTCCATCCCCTTTCCCCACGCCTCCTGGGCTCCATTCCCTG.

[0015] In some embodiments, the marker comprises at least one methylation site; further comprises one methylation site.

[0016] In some embodiments, the methylation site is chr1:79472428.

[0017] In some embodiments, the reference genome of chr1:79472381-79472580 and chr1:79472428 is hg19.

[0018] In some embodiments, the gene methylation marker is used for diagnosis, screening, monitoring, efficacy evaluation, or prognosis evaluation of lung cancer.

[0019] In some embodiments, the marker is derived from at least one of body fluids, tissues, cells, and excretions of the subject to be tested; further, the marker is derived from body fluids.

[0020] In some embodiments, the body fluid comprises at least one of blood, lymph, pleural effusion, cerebrospinal fluid, joint fluid, ascites, saliva, lymph, and body fluid; further comprising blood.

[0021] In some embodiments, the tissue comprises lung.

[0022] In some embodiments, the blood comprises at least one of serum, plasma, dried blood spots, and whole blood; further comprises plasma.

[0023] In some embodiments, the excreta comprises at least one of urine, feces, tears, and sweat.

[0024] In some embodiments, the marker is exosomal DNA.

[0025] The second aspect of the present invention provides use of a substance for detecting the marker of the first aspect of the present invention in the preparation of a product for diagnosis, screening, monitoring, efficacy evaluation, or prognosis evaluation of lung cancer.

[0026] In some embodiments, a substance for detecting ELTD1 gene methylation is used in the preparation of a product for diagnosis, screening, monitoring, efficacy evaluation, or prognosis evaluation of lung cancer.

[0027] In some embodiments, the substance is a substance for detecting the methylation level of the marker (preferably the ELTD1 gene according to the first aspect of the present invention).

[0028] In some embodiments, the substance comprises substances for one or more detection techniques or methods selected from the following groups: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrophosphate sequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-sensitive restriction endonuclease method and fluorescence quantitative PCR; and further comprises substances for fluorescence quantitative PCR.

[0029] In some embodiments, the fluorescent quantitative PCR method is quantitative methylation-specific PCR based on bisulfite treatment.

[0030] In some embodiments, the substance for fluorescent quantitative PCR comprises: a reagent for detecting the sequence of the marker (preferably the ELTD1 gene according to the first aspect of the present invention) modified by a conversion reagent.

[0031] In some embodiments, the sequence of the marker (preferably the ELTD1 gene according to the first aspect of the present invention) after modification by the transformation reagent is as shown in SEQ ID NO: 1.

[0032] In some embodiments, the reagent comprises: specific primers for amplifying the sequence of the marker (preferably the ELTD1 gene according to the first aspect of the present invention) modified by the conversion reagent.

[0033] In some embodiments, the specific primers used to amplify the sequence of the marker (preferably the ELTD1 gene of the first aspect of the present invention) modified by the conversion reagent include: a forward primer and a reverse primer; the sequence of the forward primer is shown in SEQ ID NO: 2; the sequence of the reverse primer is shown in SEQ ID NO: 3.

[0034] In some embodiments, the reagent further comprises: a probe for detecting the sequence of the marker (preferably the ELTD1 gene according to the first aspect of the present invention) modified by the conversion reagent.

[0035] In some embodiments, the sequence of the probe for detecting the marker (preferably the ELTD1 gene according to the first aspect of the present invention) after modification by the conversion reagent is as shown in SEQ ID NO: 4.

[0036] In some embodiments, the material for fluorescent quantitative PCR further comprises: a detection reagent for an internal reference gene.

[0037] In some embodiments, the internal reference gene is actin ACTB.

[0038] In some embodiments, the detection reagent for the internal reference gene comprises: specific primers for amplifying the internal reference gene.

[0039] In some embodiments, the specific primers for amplifying the internal reference gene include: a forward primer and a reverse primer; the sequence of the forward primer is shown in SEQ ID NO: 5; the sequence of the reverse primer is shown in SEQ ID NO: 6.

[0040] In some embodiments, the detection reagent for the internal reference gene further comprises: a probe for detecting the internal reference gene.

[0041] In some embodiments, the sequence of the probe for detecting the internal reference gene is shown in SEQ ID NO:7.

[0042] In some embodiments, the probe for detecting the sequence of the marker (preferably the ELTD1 gene of the first aspect of the present invention) modified by the conversion reagent and the probe for detecting the internal reference gene are respectively modified at both ends (5' end and 3' end) with a fluorescent reporter group and a fluorescent quencher group (preferably the probe for detecting the sequence of the marker (preferably the ELTD1 gene of the first aspect of the present invention) modified by the conversion reagent and the probe for detecting the internal reference gene are modified at the 5' end with a fluorescent reporter group and at the 3' end with a fluorescent quencher group).

[0043] In some embodiments, the fluorescence quenching group is selected from BHQ, BHQ1, BHQ2, TAMRA, and MGB.

[0044] In some embodiments, the fluorescent reporter group is selected from VIC, FAM, CY3, CY5, HEX, ROX, and TET.

[0045] In some embodiments, the fluorescence quenching group of the probe for detecting the marker (preferably the ELTD1 gene of the first aspect of the present invention) sequence modified by the conversion reagent is different from the fluorescence quenching group of the probe for detecting the internal reference gene.

[0046] In some embodiments, the fluorescent reporter group of the probe for detecting the marker (preferably the ELTD1 gene of the first aspect of the present invention) sequence modified by the conversion reagent is different from the fluorescent reporter group of the probe for detecting the internal reference gene.

[0047] In some embodiments, the material for fluorescent quantitative PCR further comprises: the conversion reagent.

[0048] In some embodiments, the conversion reagent is selected from at least one of hydrazine salts, bisulfite salts, and bisulfite salts; further selected from bisulfite salts.

[0049] In some embodiments, the material for fluorescent quantitative PCR further comprises: at least one of an amplification reagent, a DNA extraction reagent, a DNA purification reagent, and a quality control product.

[0050] In some embodiments, the amplification reagents include amplification buffer, dNTPs, DNA polymerase, and Mg 2+ At least one of .

[0051] In some embodiments, the product is a reagent, a kit, a test plate, a test paper, a device, a system, or a chip.

[0052] In some embodiments, the product further comprises substances for detecting other markers used for diagnosis, screening, monitoring, efficacy evaluation, or prognosis evaluation of lung cancer.

[0053] In some embodiments, the product further comprises a plasma exosome DNA extraction reagent and a plasma exosome DNA conversion reagent.

[0054] In some embodiments, the test sample of the product is plasma exosomal DNA.

[0055] In some embodiments, the diagnostic criteria for lung cancer are: comparing the methylation results of the test sample with those of a healthy person sample; when there is a significant or extremely significant difference in methylation between the test sample and the healthy person sample (preferably, when the methylation level of the test sample is higher than that of the healthy person sample), the result determines that the test sample is diseased; further, if the methylation gene Ct of the test subject is <30.54, the test subject is a lung cancer patient or suspected of being a lung cancer patient; if the methylation gene Ct of the test subject is ≥30.54, the test subject is a non-lung cancer patient or suspected of being a non-lung cancer patient.

[0056] The third aspect of the present invention provides a product comprising a substance for detecting the marker of the first aspect of the present invention.

[0057] In some embodiments, a product comprises a substance for detecting methylation of the ELTD1 gene.

[0058] In some embodiments, the product is used for diagnosis, screening, monitoring, efficacy evaluation, or prognosis evaluation of lung cancer.

[0059] In some embodiments, the substance is a substance for detecting the methylation level of the marker (preferably the ELTD1 gene according to the first aspect of the present invention).

[0060] In some embodiments, the substance comprises substances for one or more detection techniques or methods selected from the following groups: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrophosphate sequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-sensitive restriction endonuclease method and fluorescence quantitative PCR; and further comprises substances for fluorescence quantitative PCR.

[0061] In some embodiments, the fluorescent quantitative PCR method is quantitative methylation-specific PCR based on bisulfite treatment.

[0062] In some embodiments, the substance for fluorescent quantitative PCR comprises: a reagent for detecting the sequence of the marker (preferably the ELTD1 gene according to the first aspect of the present invention) modified by a conversion reagent.

[0063] In some embodiments, the sequence of the marker (preferably the ELTD1 gene according to the first aspect of the present invention) after modification by the transformation reagent is as shown in SEQ ID NO: 1.

[0064] In some embodiments, the reagent comprises: specific primers for amplifying the sequence of the marker (preferably the ELTD1 gene according to the first aspect of the present invention) modified by the conversion reagent.

[0065] In some embodiments, the specific primers used to amplify the sequence of the marker (preferably the ELTD1 gene of the first aspect of the present invention) modified by the conversion reagent include: a forward primer and a reverse primer; the sequence of the forward primer is shown in SEQ ID NO: 2; the sequence of the reverse primer is shown in SEQ ID NO: 3.

[0066] In some embodiments, the reagent further comprises: a probe for detecting the sequence of the marker (preferably the ELTD1 gene according to the first aspect of the present invention) modified by the conversion reagent.

[0067] In some embodiments, the sequence of the probe for detecting the marker (preferably the ELTD1 gene according to the first aspect of the present invention) after modification by the conversion reagent is as shown in SEQ ID NO: 4.

[0068] In some embodiments, the material for fluorescent quantitative PCR further comprises: a detection reagent for an internal reference gene.

[0069] In some embodiments, the internal reference gene is actin ACTB.

[0070] In some embodiments, the detection reagent for the internal reference gene comprises: specific primers for amplifying the internal reference gene.

[0071] In some embodiments, the specific primers for amplifying the internal reference gene include: a forward primer and a reverse primer; the sequence of the forward primer is shown in SEQ ID NO: 5; the sequence of the reverse primer is shown in SEQ ID NO: 6.

[0072] In some embodiments, the detection reagent for the internal reference gene further comprises: a probe for detecting the internal reference gene.

[0073] In some embodiments, the sequence of the probe for detecting the internal reference gene is shown in SEQ ID NO:7.

[0074] In some embodiments, the probe for detecting the sequence of the marker (preferably the ELTD1 gene of the first aspect of the present invention) modified by the conversion reagent and the probe for detecting the internal reference gene are respectively modified at both ends (5' end and 3' end) with a fluorescent reporter group and a fluorescent quencher group (preferably the probe for detecting the sequence of the marker (preferably the ELTD1 gene of the first aspect of the present invention) modified by the conversion reagent and the probe for detecting the internal reference gene are modified at the 5' end with a fluorescent reporter group and at the 3' end with a fluorescent quencher group).

[0075] In some embodiments, the fluorescence quenching group is selected from BHQ, BHQ1, BHQ2, TAMRA, and MGB.

[0076] In some embodiments, the fluorescent reporter group is selected from VIC, FAM, CY3, CY5, HEX, ROX, and TET.

[0077] In some embodiments, the fluorescence quenching group of the probe for detecting the marker (preferably the ELTD1 gene of the first aspect of the present invention) sequence modified by the conversion reagent is different from the fluorescence quenching group of the probe for detecting the internal reference gene.

[0078] In some embodiments, the fluorescent reporter group of the probe for detecting the marker (preferably the ELTD1 gene of the first aspect of the present invention) sequence modified by the conversion reagent is different from the fluorescent reporter group of the probe for detecting the internal reference gene.

[0079] In some embodiments, the material for fluorescent quantitative PCR further comprises: the conversion reagent.

[0080] In some embodiments, the conversion reagent is selected from at least one of hydrazine salts, bisulfite salts, and bisulfite salts; further selected from bisulfite salts.

[0081] In some embodiments, the material for fluorescent quantitative PCR further comprises: at least one of an amplification reagent, a DNA extraction reagent, a DNA purification reagent, and a quality control product.

[0082] In some embodiments, the amplification reagents include amplification buffer, dNTPs, DNA polymerase, and Mg 2+ At least one of .

[0083] In some embodiments, the product is a reagent, a kit, a test plate, a test paper, a device, a system, or a chip.

[0084] In some embodiments, the product further comprises substances for detecting other markers used for diagnosis, screening, monitoring, efficacy evaluation, or prognosis evaluation of lung cancer.

[0085] In some embodiments, the product further comprises a plasma exosome DNA extraction reagent and a plasma exosome DNA conversion reagent.

[0086] In some embodiments, the test sample of the product is plasma exosomal DNA.

[0087] A fourth aspect of the present invention provides an apparatus or system comprising:

[0088] Detection module: used to detect the methylation level of the marker of the first aspect of the present invention (preferably the ELTD1 gene of the first aspect of the present invention) in a test sample; and

[0089] Analysis module: used for diagnosing, screening, monitoring, evaluating the efficacy, or evaluating the prognosis of lung cancer based on the detection results.

[0090] In some embodiments, the device or system is used for diagnosis, screening, monitoring, efficacy evaluation, or prognosis evaluation of lung cancer.

[0091] In some embodiments, the test sample is from at least one of body fluids, tissues, cells, and excretions of the subject to be tested; further, it is body fluid.

[0092] In some embodiments, the body fluids, tissues, cells, and excretions are the body fluids, tissues, cells, and excretions in the first aspect of the present invention.

[0093] In some embodiments, the test sample is exosomal DNA.

[0094] In some embodiments, the device or system further includes: an output module that outputs information according to the analysis results obtained by the analysis module.

[0095] In some embodiments, the diagnostic criteria for lung cancer are: comparing the methylation results of the test sample with those of a healthy person sample; when there is a significant or extremely significant difference in methylation between the test sample and the healthy person sample (preferably, when the methylation level of the test sample is higher than that of the healthy person sample), the result determines that the test sample is diseased; further, if the methylation gene Ct of the test subject is <30.54, the test subject is a lung cancer patient or suspected of being a lung cancer patient; if the methylation gene Ct of the test subject is ≥30.54, the test subject is a non-lung cancer patient or suspected of being a non-lung cancer patient.

[0096] According to a fifth aspect of the present invention, a computer device is provided. The computer device includes a memory and a processor. The memory stores a program. When the processor executes the program, the following method is implemented:

[0097] S1: obtaining the methylation level of the marker of the first aspect of the present invention (preferably the ELTD1 gene of the first aspect of the present invention) in the test sample; and

[0098] S2: Diagnosis, screening, monitoring, efficacy evaluation, or prognosis assessment of lung cancer based on the data obtained in S1.

[0099] In some embodiments, the test sample is the test sample in the fourth aspect of the present invention.

[0100] In some embodiments, the method further comprises the step of outputting information based on the obtained analysis results.

[0101] In some embodiments, the diagnostic criteria for lung cancer are: comparing the methylation results of the test sample with those of a healthy person sample; when there is a significant or extremely significant difference in methylation between the test sample and the healthy person sample (preferably, when the methylation level of the test sample is higher than that of the healthy person sample), the result determines that the test sample is diseased; further, if the methylation gene Ct of the test subject is <30.54, the test subject is a lung cancer patient or suspected of being a lung cancer patient; if the methylation gene Ct of the test subject is ≥30.54, the test subject is a non-lung cancer patient or suspected of being a non-lung cancer patient.

[0102] A sixth aspect of the present invention provides a computer-storable medium, wherein the computer-readable storage medium includes a stored computer program; wherein, when the computer program is running, the computer-readable storage medium is controlled to implement the method in the fifth aspect of the present invention.

[0103] The seventh aspect of the present invention provides a method for detecting the methylation status or level of the marker of the first aspect of the present invention for non-diagnostic purposes, comprising the step of using the product of the third aspect of the present invention.

[0104] In some embodiments, the method comprises the step of using the substance for fluorescent quantitative PCR method according to the third aspect of the present invention.

[0105] In some embodiments, the method comprises the steps of:

[0106] 1) DNA methylation conversion;

[0107] 2) Perform fluorescent quantitative PCR amplification reaction on the methylated DNA.

[0108] In some embodiments, the concentration of the forward primer and / or reverse primer used to amplify the sequence of the marker (preferably the ELTD1 gene of the first aspect of the present invention) modified by the conversion reagent and the primer for amplifying the internal reference gene in the fluorescent quantitative PCR amplification reaction system is 0.2-0.4 μM.

[0109] In some embodiments, the concentration of the probe for detecting the marker (preferably the ELTD1 gene of the first aspect of the present invention) sequence modified by the conversion reagent and the probe for detecting the internal reference gene in the fluorescent quantitative PCR amplification reaction system is 0.08-0.2 μM.

[0110] In some embodiments, the reaction procedure of the fluorescent quantitative PCR amplification reaction is: 95°C for 5-10 min; 95°C for 15-20 s, 65-75°C for 15-20 s, 60-70°C for 15-30 s, 65-75°C for 10-20 s, 50 cycles.

[0111] In some embodiments, the method further comprises a sample quality control step (ie, selecting samples with an internal reference gene Ct ≤ 33).

[0112] In some embodiments, the DNA is derived from a test sample, which is the test sample in the fourth aspect of the present invention.

[0113] A method comprising the step of detecting the methylation level of the marker of the first aspect of the present invention (preferably the ELTD1 gene of the first aspect of the present invention) in a test sample;

[0114] The method is used for: diagnosis, screening, monitoring, efficacy evaluation, or prognosis evaluation of lung cancer.

[0115] In some embodiments, the product of the third aspect of the present invention is used to detect the methylation level of the marker of the first aspect of the present invention (preferably the ELTD1 gene of the first aspect of the present invention) in a test sample.

[0116] In some embodiments, the method further comprises the step of performing diagnosis, screening, monitoring, efficacy evaluation, or prognosis evaluation of lung cancer based on the detection result.

[0117] In some embodiments, the method further comprises the step of outputting information based on the obtained analysis results.

[0118] In some embodiments, the diagnostic criteria for lung cancer are: comparing the methylation results of the test sample with those of a healthy person sample; when there is a significant or extremely significant difference in methylation between the test sample and the healthy person sample (preferably, when the methylation level of the test sample is higher than that of the healthy person sample), the result determines that the test sample is diseased; further, if the methylation gene Ct of the test subject is <30.54, the test subject is a lung cancer patient or suspected of being a lung cancer patient; if the methylation gene Ct of the test subject is ≥30.54, the test subject is a non-lung cancer patient or suspected of being a non-lung cancer patient.

[0119] In some embodiments, the test sample is the test sample in the fourth aspect of the present invention.

[0120] The beneficial effects of the present invention are:

[0121] The present invention discloses for the first time an ELTD1 gene methylation marker, which can be used for the diagnosis, screening, monitoring, efficacy evaluation, or prognosis evaluation of lung cancer, and has high sensitivity, greatly improving the detection rate of lung cancer.

[0122] Furthermore, the fluorescence quantitative PCR method was used to detect ELTD1 gene methylation markers, which is simple to operate and the results are relatively simple to interpret. BRIEF DESCRIPTION OF THE DRAWINGS

[0123] Figure 1 The figure shows the difference in methylation levels of the ELTD1 gene in lung cancer tissues and adjacent adjacent tissues.

[0124] Figure 2 The Ct values of the methylation levels of plasma exosomal DNA (ELTD1 gene) in the lung cancer group (LC) and the healthy control group (HD) are shown.

[0125] Figure 3 The Ct values of the lung cancer group (LC) and the healthy control group (HD) in Example 1 are shown.

[0126] Figure 4 The ROC curve of the exosomal DNA (ELTD1 gene) methylation level in the diagnosis of lung cancer in Example 1 is shown. DETAILED DESCRIPTION

[0127] The present invention is further described in detail below through specific examples.

[0128] It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0129] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions or those recommended by the manufacturer. Materials and reagents used in these examples were commercially available unless otherwise specified. Where the manufacturer of the reagent is indicated, similar products from other manufacturers are considered substitutes.

[0130] Example 1. Application of exosomal DNA (ELTD1 gene) methylation level in the diagnosis of lung cancer

[0131] (1) Experimental methods

[0132] 1. Methylation marker screening

[0133] The present invention combines the results of Illumina HumanMet hylation 450K chip sequencing of 25 pairs of lung cancer tissues and 25 pairs of adjacent normal control tissues submitted for examination in the early stage, compares and analyzes the differences in methylation levels between lung cancer tissues and non-lung cancer tissues, and selects the pos5 methylation sites ( Figure 1 ), and this site can be detected in 25 lung cancer plasma exosome DNAs and the methylation level is higher than that of 25 healthy human samples ( Figure 2 The sample inclusion criteria were the same as those in 2.1). The gene corresponding to the hypermethylated site was ELTD1, and its sequence was the sequence corresponding to chr1:79472381-79472580, i.e., GAGTGAGTGCGGCTGTGGACCCGGGACCGGGCGCCGCTGGGCGG GCGCGGCAGGGTCCCGGATCCGTCCTCCGTGACGCGCCGGCTTCCTCCGGACACTTTC CGGCCTCTTTTGTGTGAGTGTGTGAGTCAAGCCCTGAATCCGCTGGCCACGTCCGGCC TCCATCCCCTTTCCCCACGCCTCCTGGGCTCCATTCCCTG, SEQ ID NO: 8. The methylated site was chr1:79472428 (i.e., nucleotide 48 of SEQ ID NO: 8). The reference genome was hg19.

[0134] 2. Methylation Marker Verification

[0135] 2.1. Sample Collection: Plasma samples from lung cancer patients (numbered LC001-LC040) and healthy individuals (numbered HD001-HD040) were obtained from the First Affiliated Hospital of Guangzhou Medical University. This project was approved by the Medical Ethics Committee of the First Affiliated Hospital of Guangzhou Medical University, and informed consent was obtained from each patient. The 40 lung cancer samples included 19 females and 21 males, ranging in age from 29 to 78 years (mean age, 49 years). Among them, 28 cases were lung adenocarcinoma, 10 were lung squamous cell carcinoma, and 2 were large cell carcinoma. Pathological staging included 17 cases of stage I-II and 23 cases of stage III-IV. The 40 healthy individual cancer samples included 22 females and 18 males, ranging in age from 29 to 73 years (mean age, 45 years). All 40 lung cancer samples were first-time hospitalized patients who had not received any prior treatment, including surgery, radiotherapy, chemotherapy, or immunotherapy. Pathological types were confirmed by postoperative pathological examination. All peripheral blood samples were obtained from patients before they were first admitted to the hospital and received any treatment. None of the 40 healthy subjects had a history of malignant tumors, autoimmune diseases, or other major diseases such as heart, liver, or kidney disease.

[0136] 2.2. Extraction of plasma exosomes from 80 cases

[0137] (1) Take 500 μl of plasma into a 1.5 mL ultracentrifuge tube and fill the remaining part of the tube with PBS;

[0138] (2) 100,000 × g, 4°C, 70 min;

[0139] (3) Remove the supernatant and refill the centrifuge tube with PBS;

[0140] (4) 100,000 × g, 4°C, 70 min;

[0141] (5) Remove the supernatant;

[0142] (6) Resuspend the pellet in 50 μl of PBS.

[0143] 2.3. Exosomal DNA Extraction

[0144] QIAGEN's DNA extraction kit [Nucleic Acid Extraction Kit (Cat: 69554)] was used to extract exosome DNA from peripheral blood.

[0145] 2.4. Exosomal DNA methylation conversion

[0146] The extracted 80 exosomal DNAs were bisulfite-converted using the EZ DNA Methylation-Lightning Kit (Cat: D5031) from Zymo Research and purified according to the manufacturer's instructions.

[0147] 2.5. qPCR Amplification

[0148] qPCR amplification was performed on the bisulfite-converted exosome DNA obtained in step 4 of 80 subjects (40 patients with early-stage lung cancer (numbered LC001-LC040) and 40 healthy subjects (numbered HD001-HD040)). The qPCR reaction system is shown in Table 1, and the reaction procedure is shown in Table 2. Three biological replicates were performed for each sample. The minimum Ct value among the three replicates was taken. Samples with a Ct value ≤ 33 for the internal reference gene ACTB were considered qualified quality control samples and were used for the next statistical analysis.

[0149] Table 1 Reaction system

[0150]

[0151]

[0152] Note: The amplification primers for detecting the methylation level or status of the ELTD1 gene were designed based on the bisulfite-modified methylation site nucleotide sequence of sites 79472381-79472580 on chromosome 1 of the ELTD1 gene in the hg19 genome version (5'-GAGTGAGTGC GGTTGTGGATTCGGGATCGGGCGTCGTTGGGCGGGCGCGGTAGGGTTTCGGATTCGTTTTTCGTGAC GCGTCGGTTTTTTTCGGATATTTTTCGGTTTTTTTTGTGTGAGTGTGTGAGTTAAGTTTTGAATTCGTT GGTTACGTTCGGTTTTTATTTTTTTTTTTTACGTTTTTTGGGTTTTATTTTTTG-3', SEQ ID NO: 1). The forward primer sequence of the methylation-specific primer is: 5'-GTGAGTGCGGTTGTGGATTC-3', SEQ ID NO: ID NO: 2; the reverse primer sequence of the methylation-specific primer is: 5'-AAACCGAACGTAACCAACGA-3', SEQ ID NO: 3; the methylation probe for detecting the methylation level or status of the ELTD1 gene is designed based on the sulfite-modified methylation site nucleotide sequence at position 79472428 on chromosome 1 of the hg19 genome version. The methylation probe is: 5'-FAM-CGAAACCCTACCGC GCCCGC (SEQ ID NO: 4)-BHQ1-3', wherein FAM represents a fluorescent labeling group and BHQ1 represents a fluorescence quenching labeling group;

[0153] The sequence of the forward primer for detecting the internal reference gene actin ACTB is: 5'-GTTGTGAGTCGAGGTCGTTT-3', SEQ ID NO: 5; the sequence of the reverse primer is: 5'-GACCGACCCGACTTCCTTTA-3', SEQ ID NO: 6; the probe is 5'-VIC-TCTAAACGCGCGCCGACGCC (SEQ ID NO: 7)-MGB-3'; wherein VIC represents a fluorescent labeling group and MGB represents a fluorescence quenching labeling group.

[0154] Table 2 Reaction procedure

[0155]

[0156]

[0157] 3. Experimental Results

[0158] The Ct values of DNA methylation detection in exosomes of lung cancer group (LC) and healthy group (HD) in the validation samples of Example 1 are as follows: Figure 3 As shown in the results, the methylation level of ELTD1 gene in lung cancer exosome DNA samples was significantly higher than that in healthy people; and GraphPadprism 9.0 software was used to perform ROC curve analysis on the Ct value results of methylation detection to establish a diagnostic model. The area under the ROC curve was 0.901, showing 80% sensitivity and 95% specificity ( Figure 4 ).

[0159] Reference Figure 4 , ROC curve diagram of lung cancer methylation detection in the validation sample of Example 1, the distinction criteria are as follows: if the methylation gene Ct of the subject to be tested is <30.54, the subject to be tested is a lung cancer patient or a suspected lung cancer patient; if the methylation gene Ct of the subject to be tested is ≥30.54, the subject to be tested is a non-lung cancer patient or a suspected non-lung cancer patient.

[0160] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A gene methylation marker, wherein the gene is the ELTD1 gene; Preferably, the sequence of the ELTD1 gene is the sequence corresponding to chr1:79472381-79472580.

2. Use of a substance for detecting the marker according to claim 1 in the preparation of a product for diagnosis, screening, monitoring, efficacy evaluation, or prognosis evaluation of lung cancer.

3. A product comprising: a substance for detecting the marker according to claim 1.

4. The use according to claim 2 or the product according to claim 3, characterized in that The substance comprises substances for one or more detection techniques or methods selected from the group consisting of: methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrosequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-sensitive restriction endonuclease method, and fluorescence quantitative PCR; and further comprises substances for fluorescence quantitative PCR; Preferably, the fluorescent quantitative PCR method is a quantitative methylation-specific PCR based on bisulfite treatment; Preferably, the substance used for the fluorescent quantitative PCR method comprises: a reagent for detecting the sequence of the marker modified by the conversion reagent; Preferably, the sequence of the marker after modification by the conversion reagent is as shown in SEQ ID NO:

1.

5. The use or product according to claim 4, characterized in that: The reagents include: specific primers for amplifying the sequence of the marker modified by the conversion reagent; Preferably, the specific primers for amplifying the sequence of the marker modified by the conversion reagent include: a forward primer and a reverse primer; the sequence of the forward primer is shown in SEQ ID NO: 2; the sequence of the reverse primer is shown in SEQ ID NO: 3; Preferably, the reagent further comprises: a probe for detecting the sequence of the marker modified by the conversion reagent; Preferably, the sequence of the probe for detecting the sequence of the marker modified by the conversion reagent is as shown in SEQ ID NO: 4; Preferably, the substance used for the fluorescent quantitative PCR method further comprises: a detection reagent for an internal reference gene; Preferably, the detection reagent for the internal reference gene comprises: specific primers for amplifying the internal reference gene; Preferably, the specific primers for amplifying the internal reference gene include: a forward primer and a reverse primer; the sequence of the forward primer is shown in SEQ ID NO: 5; the sequence of the reverse primer is shown in SEQ ID NO: 6; Preferably, the detection reagent for the internal reference gene further comprises: a probe for detecting the internal reference gene; Preferably, the sequence of the probe for detecting the internal reference gene is shown in SEQ ID NO:

7.

6. The use or product according to claim 5, characterized in that: The ends of the probe for detecting the sequence of the marker modified by the conversion reagent and the probe for detecting the internal reference gene are respectively modified with a fluorescent reporter group and a fluorescent quencher group; Preferably, the fluorescence quenching group is selected from BHQ, BHQ1, BHQ2, TAMRA, and MGB; Preferably, the fluorescent reporter group is selected from VIC, FAM, CY3, CY5, HEX, ROX, TET; Preferably, the fluorescence quenching group of the probe for detecting the sequence of the marker modified by the conversion reagent is different from the fluorescence quenching group of the probe for detecting the internal reference gene; Preferably, the substance for fluorescent quantitative PCR method further comprises: the conversion reagent; Preferably, the conversion reagent is selected from at least one of hydrazine salts, bisulfite and bisulfite; further bisulfite; Preferably, the substance used for the fluorescent quantitative PCR method further comprises: at least one of an amplification reagent, a DNA extraction reagent, a DNA purification reagent, and a quality control product; Preferably, the amplification reagent includes amplification buffer, dNTPs, DNA polymerase and Mg 2+ At least one of; Preferably, the product is a reagent, a kit, a test plate, a test paper, a device, a system, or a chip; Preferably, the product further comprises substances for detecting other markers used for diagnosis, screening, monitoring, efficacy evaluation, or prognosis assessment of lung cancer; Preferably, the product further comprises a plasma exosome DNA extraction reagent and a plasma exosome DNA conversion reagent; Preferably, the test sample of the product is plasma exosome DNA.

7. A device or system comprising: Detection module: used to detect the methylation level of the marker according to claim 1 in the test sample; and Analysis module: used for diagnosing, screening, monitoring, evaluating efficacy, or evaluating prognosis of lung cancer based on the test results; Preferably, the device or system further comprises: an output module for outputting information according to the analysis results obtained by the analysis module.

8. A computer device comprising a memory and a processor, wherein the memory stores a program, and when the processor executes the program, the following method is implemented: S1: obtaining the methylation level of the marker according to claim 1 in the test sample; and S2: Diagnosis, screening, monitoring, efficacy evaluation, or prognosis assessment of lung cancer based on the data obtained in S1; Preferably, the method further comprises the step of: outputting information according to the obtained analysis results.

9. A computer readable storage medium comprising a stored computer program; wherein: When the computer program is executed, the computer-readable storage medium is controlled to implement the method of claim 8.

10. A method for detecting the methylation status or level of the marker of claim 1 for non-diagnostic purposes, comprising the step of using the product of any one of claims 3 to 6.

11. The method according to claim 10, characterized in that: The method comprises the steps of using the substance for fluorescent quantitative PCR method according to any one of claims 4 to 6; Preferably, the method comprises the following steps: 1) DNA methylation conversion; 2) Perform fluorescent quantitative PCR amplification reaction on the methylated DNA.

Images