Pirna markers for diagnostic assessment of vascular aging, kits and uses thereof

By detecting the piRNA biomarker hsa_piR_017724, the sensitivity and specificity issues in vascular aging detection have been resolved, enabling efficient diagnosis of vascular aging and discovery of therapeutic targets, and providing new diagnostic and therapeutic methods.

CN120519565BActive Publication Date: 2026-06-26SECOND MEDICAL CENT OF CHINESE PLA GENERAL HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510472024.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-15
Publication Date
2026-06-26
Estimated Expiration
2045-04-15

AI Technical Summary

Technical Problem

The lack of highly sensitive and specific biomarkers for vascular aging makes it difficult to assess the degree of vascular aging and prognosis through peripheral blood testing, and existing methods such as pulse wave velocity (PWV) have limitations in clinical application.

Method used

Using the piRNA biomarker hsa_piR_017724, the expression level of hsa_piR_017724 in plasma was detected by RT-PCR, real-time quantitative PCR, in situ hybridization or high-throughput sequencing platforms, and kits and primers for diagnosis, screening, treatment and prognostic assessment were developed.

Benefits of technology

hsa_piR_017724 is significantly upregulated in patients with vascular aging, exhibiting high sensitivity and specificity. It can reflect the severity of vascular aging and can be used for prognostic assessment and therapeutic targets, providing new diagnostic and therapeutic methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519565B_ABST
    Figure CN120519565B_ABST
Patent Text Reader

Abstract

The application discloses a kind of detection piRNA marker material, including one or more of the following applications: A1) in the application in the preparation of diagnostic blood vessel senile product;A2) in the application in the preparation of screening blood vessel senile product;A3) in the application in the preparation of evaluating blood vessel senile risk product;A4) in the application in the preparation of blood vessel senile prognosis evaluation product;A5) in the application in the preparation of distinguishing blood vessel senile and other diseases product;PiRNA marker is hsa_piR_017724, nucleotide sequence is as shown in SEQ ID No.1.The hsa_piR_017724 marker provided by the application is significantly increased in the expression amount in the plasma of blood vessel senile patient compared with healthy control, indicating that hsa_piR_017724 is a potential blood vessel senile biomarker.The ROC curve of the efficiency in diagnosing blood vessel senile patient shows that hsa_piR_017724 has good diagnostic efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a biomarker for diagnosing vascular aging, specifically a piRNA biomarker, and also to a kit for detecting the piRNA biomarker and its application, belonging to the field of medical molecular diagnostics. Background Technology

[0002] With advancements in medical technology, cardiovascular disease is a leading cause of death among the elderly, and vascular aging is a significant contributing factor. Aging blood vessels lead to multifaceted structural and functional impairments, including those affecting tissue oxygenation, nutrient delivery, and local regulation of microvascular perfusion. Furthermore, vascular aging negatively impacts the immune system (e.g., leukocyte adhesion and chemotaxis) and the endocrine system (e.g., insulin signaling), and impairs barrier function and stem cell physiology. These changes make vascular aging a crucial pathogenic factor for various age-related diseases, such as heart failure, Alzheimer's disease, vascular cognitive impairment, age-related macular degeneration, sarcopenia, and kidney disease. Simultaneously, vascular aging is closely associated with high hospitalization rates, increased mortality, and rising healthcare costs.

[0003] Vascular aging has unique histological and biochemical characteristics, including oxidative stress, protein misfolding, cell death, and mitochondrial abnormalities. Its main changes manifest as luminal dilation, increased arterial stiffness, endothelial dysfunction, and diffuse intimal thickening, with increased arterial stiffness being the most characteristic feature. This change is caused by multiple factors, including accelerated elastin breakdown and depletion, and collagen deposition. Increased arterial stiffness leads to premature return of systolic reflection waves, thereby triggering elevated blood pressure.

[0004] In clinical diagnosis, pulse wave velocity (PWV) is the most commonly used method for assessing arteriosclerosis. The World Health Organization (WHO) recommends evaluating the effectiveness of antihypertensive drugs by the degree of improvement in PWV, and PWV measurement is currently used in various clinical trials. However, there is still a lack of ideal biomarkers with high sensitivity and specificity obtained from peripheral blood. Therefore, discovering new biomarkers for vascular aging has become an important direction for clinical research. PIWI-interacting RNAs (piRNAs) are the largest family of non-coding small RNAs in animal cells, and their main functions include silencing transposon factors, regulating gene expression, and defending against viral infections. piRNAs were first discovered in the testes of Drosophila melanogaster in 2001 and were initially thought to be RNAs that maintain male fertility. Subsequently, piRNAs have been identified in various species, including worms, zebrafish, mice, and humans, and are now found in nearly 44 species. Notably, piRNAs are not only present in germ cells but also widely distributed in somatic cells. Although piRNAs play important roles in various biological processes, research on their application in cardiovascular diseases, especially vascular aging, is still in its early stages. Developing a biomarker that is highly sensitive, easy to detect, has a short detection window, and can assess different stages of vascular aging remains a hot research topic. Summary of the Invention

[0005] The primary technical problem to be solved by this invention is to provide a new application of piRNA biomarkers, which can be used for diagnosis, screening, as therapeutic targets, prognostic assessment of vascular aging, and to differentiate vascular aging from other disease substances.

[0006] Another technical problem to be solved by the present invention is to provide a kit for detecting novel piRNA biomarkers, which can be used for diagnosis, screening, as a therapeutic target, for prognostic assessment of vascular aging, and to differentiate vascular aging from other diseases.

[0007] Another technical problem to be solved by the present invention is to provide a primer for detecting novel piRNA biomarkers.

[0008] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution:

[0009] According to a first aspect of the present invention, an application of a substance for detecting piRNA biomarkers is provided, comprising one or more of the following applications:

[0010] A1) Application in the preparation of diagnostic products for vascular aging;

[0011] A2) Application in the preparation of products for screening vascular aging;

[0012] A3) Application in the preparation of products for treating vascular aging;

[0013] A4) Application in the preparation of products for assessing the prognosis of vascular aging;

[0014] A5) Application in the preparation of products for differentiating vascular aging from other diseases;

[0015] The piRNA marker is hsa_piR_017724, and its nucleotide sequence is shown in SEQ ID No. 1.

[0016] The "products" described above can be products used to diagnose vascular aging by detecting the expression level of hsa_piR_017724 through RT-PCR, real-time quantitative PCR, in situ hybridization, microarray or high-throughput sequencing platforms.

[0017] In the above applications, hsa_piR_017724 was significantly upregulated in plasma samples from patients with vascular aging; the expression level of hsa_piR_017724 in healthy individuals was significantly lower than that in aging patients.

[0018] Preferably, the substance is a reagent for detecting the expression level of hsa_piR_017724, or for specifically recognizing hsa_piR_017724, or for detecting the content of hsa_piR_017724.

[0019] Preferably, the substance is a substance used to detect hsa_piR_017724, specifically a), b), or c) below.

[0020] a) Primers used for detecting or specifically recognizing hsa_piR_017724;

[0021] b) A reagent group containing the reagents described in a);

[0022] c) A kit containing either a) or b).

[0023] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0024] According to a second aspect of the present invention, a kit for detecting piRNA biomarkers is provided, the kit comprising one or more of the following applications:

[0025] A1) Application in the preparation of diagnostic products for vascular aging;

[0026] A2) Application in the preparation of products for screening vascular aging;

[0027] A3) Application in the preparation of products for treating vascular aging;

[0028] A4) Application in the preparation of products for assessing the prognosis of vascular aging;

[0029] A5) Application in the preparation of products for differentiating vascular aging from other diseases;

[0030] The piRNA marker is hsa_piR_017724, and its nucleotide sequence is shown in SEQ ID No. 1. The kit includes reagents for detecting or specifically recognizing hsa_piR_017724, or reagents for detecting the expression level of hsa_piR_017724.

[0031] Using the kit provided by this invention, the expression of the hsa_piR_017724 characteristic gene sequence shown in SEQ ID NO.1 in the peripheral blood of the subject can be detected. Then, based on the information of upregulation or downregulation of these gene expressions, the probability of vascular aging in the subject can be determined, thereby realizing the diagnosis of vascular aging.

[0032] The kit provided by this invention may include appropriate packaging and instructions for use in the methods disclosed herein. The detection kit provided by this invention is a nucleic acid detection kit, including reagents required for RNA extraction and quantitative real-time PCR (qRT-PCR). The kit may further include appropriate buffers and polymerases, and may also include control primers and / or probes.

[0033] Preferably, the reagent used for detecting or specifically identifying hsa_piR_017724 is a specific primer, which is the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0034] According to a third aspect of the present invention, a primer for detecting piRNA biomarkers is provided, the primer comprising one or more of the following applications:

[0035] A1) Application in the preparation of diagnostic products for vascular aging;

[0036] A2) Application in the preparation of products for screening vascular aging;

[0037] A3) Application in the preparation of products for treating vascular aging;

[0038] A4) Application in the preparation of products for assessing the prognosis of vascular aging;

[0039] A5) Application in the preparation of products for differentiating vascular aging from other diseases;

[0040] The primers are used to detect the expression level of hsa_piR_017724 or to specifically recognize hsa_piR_017724.

[0041] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0042] Compared with the prior art, the present invention has the following technical effects:

[0043] (1) This invention provides a novel piRNA (hsa_piR_017724) biomarker that can be used as a diagnostic biomarker for vascular aging. In clinical validation trials, the expression level of hsa_piR_017724 in the plasma of patients with vascular aging was significantly higher than that in healthy controls, indicating that hsa_piR_017724 is a potential biomarker for vascular aging.

[0044] (2) The efficacy of hsa_piR_017724 in diagnosing patients with vascular aging was evaluated using ROC curves, and the results showed that it has high sensitivity and specificity. This finding indicates that hsa_piR_017724 has good diagnostic efficacy as a diagnostic tool.

[0045] (3) In clinical trials, researchers explored the relationship between PWV (pulse wave velocity) and hsa_piR_017724 expression levels, finding a positive correlation between the two. PWV is an important clinical indicator for assessing vascular stiffness and aging; therefore, the level of hsa_piR_017724 in plasma can reflect the severity of vascular aging and can be used for prognostic assessment of vascular aging.

[0046] (4) In in vitro cell experiments, vascular smooth muscle cells (VSMCs) treated with the aging inducer D-gal showed increased expression of hsa_piR_017724. This finding provides a cellular and molecular basis for hsa_piR_017724 as a biomarker for vascular aging diagnosis.

[0047] (5) Further experiments showed that knocking down hsa_piR_017724 reduced the mRNA expression levels of senescence-related P21 and IL-1β, indicating that knocking down hsa_piR_017724 can slow down the cellular senescence process. Furthermore, knocking down hsa_piR_017724 also reduced the expression level of galactosidase, further confirming that knocking down hsa_piR_017724 can alleviate D-gal-induced cellular senescence, thus demonstrating the potential of hsa_piR_017724 as a therapeutic target for vascular aging at the cellular level. Attached Figure Description

[0048] Figure 1 A heatmap showing the difference in piRNA expression between senescent VSMCs and normal controls obtained from sequencing.

[0049] Figure 2 To determine the hsa_piR_017724 content in the plasma of patients with vascular aging and normal controls using qRT-PCR;

[0050] Figure 3 ROC curve for diagnosing vascular aging patients with hsa_piR_017724;

[0051] Figure 4 To further determine the hsa_piR_017724 content in the plasma of patients with vascular aging and normal controls in the external validation population using qRT-PCR;

[0052] Figure 5 ROC curves for diagnosing hsa_piR_017724 in an external validation population of patients with vascular aging;

[0053] Figure 6 The relationship between PWV and hsa_piR_017724 expression levels in patients;

[0054] Figure 7 The relationship between the positive rate of galactosidase, a marker of aging, and the expression level of hsa_piR_017724 in D-gal-induced VSMCs;

[0055] Figure 8A The graph shows the expression level of hsa_piR_017724 after transfection of VSMCs with hsa_piR_017724 small interfering RNA (siRNA);

[0056] Figure 8B The graph shows the expression levels of messenger RNA (mRNA) after VSMCs were transfected with hsa_piR_017724 siRNA.

[0057] Figure 9A The expression of P21 mRNA in D-gal-induced VSMCs after siRNA knockdown of hsa_piR_017724 in VSMCs;

[0058] Figure 9B The expression of IL-1β mRNA in D-gal-induced VSMCs after siRNA knockdown of hsa_piR_017724;

[0059] Figure 10ATo determine the expression of galactosidase (a marker protein of cellular senescence) in control VSMCs after D-gal treatment using immunofluorescence assays;

[0060] Figure 10B The expression of galactosidase (a marker protein of cellular senescence) in the knockdown hsa_piR_017724 group after D-gal treatment was determined by immunofluorescence assay. Detailed Implementation

[0061] The present invention is further illustrated below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0062] First, total RNA was extracted from three senescent VSMCs and three normal control VSMCs and sent to Guangzhou Epigenetics Co., Ltd. for piRNA sequencing. piRNAs with significantly different expression levels (Fold change ≥ 2.0, P < 0.05) were screened. Then, the levels of the top 10 piRNAs in the patient plasma were measured using qRT-PCR, and the most significantly elevated piRNA was used for subsequent experiments. Next, the relationship between hsa_piR_017724 expression and vascular aging was further verified at the in vitro cellular level. Specific data are as follows.

[0063] Example 1: Screening and Correlation Study of piRNA Biomarkers for Vascular Aging

[0064] 1. Clinical Samples:

[0065] Venous blood was collected at admission to the General Hospital of the People's Liberation Army from 2020 to 2023 from 50 patients aged 60–90 years who were hospitalized after excluding other vascular diseases. Venous blood was also collected from 50 healthy individuals aged ≤30 years during physical examinations. The participants were divided into a control group and an aging group for subsequent measurement of plasma piRNA levels.

[0066] The external validation population consisted of 52 inpatients aged 60-90 years at Fuwai Hospital, Chinese Academy of Medical Sciences, in 2022-2023, excluding patients with other vascular diseases. Additionally, 44 healthy individuals aged ≤30 years were included in the study. Venous blood samples were collected upon admission, and participants were divided into a control group and an aging group. Clinical data were recorded for all participants.

[0067] Inclusion criteria:

[0068] (1) Inpatients aged 60 to 90 years with PWV > 1800 cm / s;

[0069] (2) Healthy individuals aged ≤30 years undergoing physical examinations with PWV <1400cm / s;

[0070] (3) Complete blood sample data is available.

[0071] Exclusion criteria: malignant tumors, severe liver and kidney dysfunction, severe autoimmune diseases, severe hematologic diseases or other cardiovascular diseases such as coronary heart disease, valvular heart disease and peripheral vascular disease.

[0072] 2. Plasma extraction:

[0073] Human peripheral blood was collected using EDTA anticoagulant blood collection tubes. The tubes were centrifuged at 2500g for 15 minutes, and the supernatant plasma was transferred to a 2ml sterile tube and stored at -80℃.

[0074] 3. RNA extraction and qRT-PCR:

[0075] 3.1. RNA Extraction

[0076] Total RNA was extracted from plasma using the RNA Simple Total RNA Kit (DP419, TIANGEN). 1 ml of TRIZOL Reagent and 200 μL of chloroform were added to the plasma, vortexed for 20 seconds, and incubated at room temperature for 10 minutes. The plasma was then centrifuged at 13000 rpm for 15 minutes at 4°C. The supernatant was carefully aspirated, and 800 μL of isopropanol was added. The mixture was gently mixed by inverting the container and incubated at -20°C for 1 hour. The supernatant was then discarded. 1 ml of 75% ethanol was added to gently wash the precipitate. The precipitate was centrifuged at 4°C for 13000 rpm for 5 minutes, and the supernatant was removed. The precipitate was dried. An appropriate amount of enzyme-free water was added, and the RNA was dissolved at 65°C for 10 minutes. The OD value and concentration of the RNA were then measured. The RNA was stored at -80°C for later use.

[0077] 3.2. RNA reverse transcription to synthesize cDNA

[0078] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara RR037A).

[0079] 3.3. Reverse transcription of piRNA:

[0080] Perform the operation on ice, using 20 μL for each reaction system, as shown in the table below:

[0081] Table 1

[0082]

[0083] 3.4. Reverse transcription of mRNA:

[0084] Perform the operation on ice, using 20 μL for each reaction system, as shown in the table below:

[0085] Table 2

[0086]

[0087] The reaction procedure was: 37℃ for 45 min, 85℃ for 5 min, and maintained at 4℃.

[0088] 3.5. qRT-PCR

[0089] piRNA primer sequences were designed according to the principles of piRNA primer design. The cDNA obtained from the reverse transcription reaction was diluted 1:10 and subjected to the following qRT-PCR reaction.

[0090] Perform the operation on ice, using 20 μL for each reaction system, as shown in the table below:

[0091] Table 3

[0092]

[0093] After mixing the reaction solution, the Real-time PCR program is as follows:

[0094] Stage 1: 95℃ for 2 minutes;

[0095] Stage 2: Cycle 35, 94℃ for 5s, 60℃ for 1min;

[0096] Stage 3: 95℃15s, 60℃1min, 95℃5s;

[0097] The relative levels of each mRNA were quantified using GAPDH and expressed as relative ratios.

[0098] 4. piRNA sequencing analysis:

[0099] Total RNA was extracted from three naturally aging VSMCs and three normal control cells and sent to Guangzhou Epigenetics Co., Ltd. for piRNA sequencing. piRNAs with significantly different expression levels (Fold change ≥ 2.0, P < 0.05) were screened. The levels of the top 10 piRNAs in the patient's plasma were then measured using qRT-PCR, and the first significantly elevated piRNA was used for subsequent experiments. Figure 1 The volcano plot shows the differential expression of piRNAs between senescent VSMCs and normal controls obtained from sequencing; Table 4 shows the top 10 upregulated piRNAs obtained from sequencing, and hsa_piR_017724 with the highest expression level was selected for subsequent experiments.

[0100] Table 4 shows the top 10 upregulated piRNAs obtained from sequencing data.

[0101]

[0102] 5. ROC curve plotting:

[0103] The receiver operating characteristic (ROC) curve is a curve obtained by plotting the true positive rate and false positive rate, and it can be used to reflect the relationship between sensitivity and specificity. It is calculated by plotting sensitivity on the ordinate and 1-specificity on the abscissa, using a series of cutoff values ​​based on the measurements of the experimental and control groups. Connecting these points forms the ROC curve. The ROC curve was plotted using GraphPad Prism software. The ROC curve reflects the diagnostic efficacy of the biomarker for the disease.

[0104] 6. Statistical Analysis:

[0105] For normally distributed variables, t-tests and ANOVA were used; for non-normally distributed variables, Mann-Whitney U tests and Kruskal-Wallis tests were used. Statistical analysis was performed using R software (v 3.4.2) and GraphPad Prism (9.1.0). Biological replicates were displayed as single data points superimposed on the bar chart. P < 0.05 was considered statistically significant.

[0106] 7. Experimental Results:

[0107] like Figure 2 As shown, the hsa_piR_017724 level in the plasma of patients with vascular aging was determined using qRT-PCR. The results showed that the expression of hsa_piR_017724 in the plasma of patients with vascular aging was significantly higher than that in healthy controls, indicating that hsa_piR_017724 is a potential biomarker for vascular aging.

[0108] like Figure 3 The ROC curve of hsa_piR_017724 in diagnosing patients with vascular aging is shown; hsa_piR_017724 exhibits excellent diagnostic sensitivity and specificity, indicating that...

[0109] hsa_piR_017724 has good diagnostic efficacy.

[0110] like Figure 4As shown, after selecting an external validation population, the hsa_piR_017724 level in the plasma of patients with vascular aging was measured by qRT-PCR. The results showed that the expression level of hsa_piR_017724 in the plasma of patients with vascular aging was significantly higher than that in healthy controls, validating the reliability of hsa_piR_017724 as a biomarker for vascular aging.

[0111] like Figure 5 As shown in the figure, the ROC curve of hsa_piR_017724 in diagnosing patients with vascular aging in the external validation set has excellent specificity and sensitivity, indicating that hsa_piR_017724 also has good diagnostic efficacy in the external validation set.

[0112] Example 2: Relationship between PWV and hsa_piR_017724 expression levels

[0113] 1. Research Background:

[0114] PWV (Pulse Wave Velocity) is a non-invasive indicator reflecting arterial elasticity and dilatability. It is used to assess the degree of arterial wall hardening, which is closely related to brain and cardiovascular diseases. It refers to the speed at which a pulse wave travels from one specific location along the arterial wall to another. Utilizing the principle that the propagation speed of the pulse wave generated by the blood pumped by the heart increases during arteriosclerosis, the velocity of the pulse wave is measured between the examined sites to determine the elasticity of the blood vessel. A higher value indicates a harder arterial wall. The calculation formula and clinical judgment criteria are: Acquisition = Distance / Time Difference (Δt). A higher PWV value indicates a harder blood vessel wall. Clinically, the degree of vascular hardening is often used to represent the degree of vascular aging.

[0115] Peripheral blood vessel volume (PWV) represents the degree of vascular stiffness. An increase in PWV is an important clinical indicator for assessing vascular aging and provides a reliable indicator for evaluating the effectiveness of clinical interventions. The collected values ​​increase with age, with a baseline value of 1400 cm / s. Higher PWV indicates more severe vascular aging. According to the American College of Cardiology's Medical Science Report: a. <1400 cm / s: Normal arteriosclerosis. b. 1400 cm / s ≤ PWV ≤ 1800 cm / s: Mild peripheral arteriosclerosis. c. PWV > 1800 cm / s: Severe peripheral arteriosclerosis.

[0116] 2. Experimental Methods:

[0117] PWV Measurement: PWV was measured using a fully automated arteriosclerosis detector BP-203RPEⅢ (manufactured by Omron Corporation, Japan). Blood pressure cuffs were placed on the brachial arteries of both upper arms and 2-3 cm above the ankles of both lower limbs. All four cuffs were inflated simultaneously, and the instrument automatically measured the pulse wave conduction time in the upper arms and ankles. The average pulse wave conduction velocity of both arteries was taken as the final statistical value.

[0118] 3. Experimental Results:

[0119] Figure 6 The figure shows the relationship between PWV and the expression level of hsa_piR_017724. From... Figure 6 As can be seen, plasma wave vasculature (PWV) is positively correlated with hsa_piR_017724 expression; PWV is a functional marker of vascular aging, and hsa_piR_017724 is positively correlated with PWV levels. These results indicate that plasma hsa_piR_017724 levels can reflect the severity of disease.

[0120] Example 3: In vitro cellular experiments to verify the relationship between hsa_piR_017724 expression and vascular aging.

[0121] 1. Cell culture:

[0122] Human vascular smooth muscle cell lines (VSMCs) were purchased from Wuhan Pronosai. The cells were cultured in RPMI-1640 medium with 10% fetal bovine serum at 37°C in a 5% carbon dioxide incubator.

[0123] siRNA knockdown method: siRNA was ordered from Thermo Fisher Scientific. According to the instructions, it was added when the cell confluence reached 70%, and the knockdown effect was measured by qRT-PCR after 24 hours of induction.

[0124] 2. Cell-induced senescence treatment:

[0125] Cultured VSMCs were exposed to 10 mM D-galactose (D-gal) to induce cellular senescence. D-gal is a well-established senescence model inducing agent, a more potent glycation agent than glucose, and capable of inducing oxidative stress. D-gal concentrations can induce cytotoxicity and senescence-like changes, causing VSMCs to secrete senescence-related proteins (such as p21 and IL-1β). After 24 h, the levels of piRNA and senescence-related protein mRNA in VSMCs were compared with those in the control group.

[0126] 3. The qRT-PCR method is the same as in Example 1.

[0127] 4. Galactosidase staining experiment:

[0128] Cells were stained using the Beyotime galactosidase staining kit (C0602). In 6-well plates, the cell culture medium was aspirated, and the cells were washed once with PBS. 1 mL of galactosidase staining fixative was added, and the plates were fixed at room temperature for 15 minutes. The cell fixative was then aspirated, and the cells were washed three times with PBS for 3 minutes each time. PBS was then aspirated, and 1 mL of staining working solution was added to each well. The staining working solution was prepared as follows: 10 μL of galactosidase staining solution a, 10 μL of galactosidase staining solution b, 930 μL of galactosidase staining solution c, and 50 μL of X-Gal solution. The plates were incubated overnight at 37°C, and the 6-well plates were sealed with plastic wrap to prevent evaporation. Note: Incubation at 37°C cannot be performed in a CO2 incubator. Cells were observed under a regular optical microscope.

[0129] 5. Immunofluorescence staining galactosidase experiment:

[0130] Cells were incubated in 4% paraformaldehyde for 10 minutes at room temperature. Cells were washed three times with ice-cold PBS. Cells were then incubated with 1% BSA and PBST for 30 minutes to block non-specific antibody binding. Cells were then incubated with a specific galactosidase antibody (Abcam, product number AB136775) at 4°C for 6 hours. The solution was discarded, and cells were washed three times with PBS for 5 minutes each time. Cells were then incubated with a fluorescent secondary antibody (Abcam, product number AB150113) (dissolved in 1% BSA) in the dark for 1 hour at room temperature. The secondary antibody solution was discarded, and cells were washed three times with PBS for 5 minutes each time in the dark. Finally, cell nuclei were stained with DAPI solution, and the fluorescence intensity of galactosidase was observed under a fluorescence microscope.

[0131] 6. Experimental Results:

[0132] like Figure 7 As shown, the expression levels of galactosidase, a marker of vascular cell aging, and hsa_piR_017724 showed a good correlation, indicating that hsa_piR_017724 has good diagnostic efficacy.

[0133] Figure 8A The results showed that transfection of VSMCs with hsa_piR_017724 siRNA resulted in decreased hsa_piR_017724 expression. Figure 8B The results showed that the total mRNA level remained unchanged after the hsa_piR_017724 knockdown. This indicates successful transfection, and subsequent experiments were conducted based on this result.

[0134] Figure 9A and Figure 9B To detect the mRNA expression of two cell senescence markers in VSMCs after transfection with hsa_piR_017724 siRNA, Figure 9AP21 represents the expression status of a cellular senescence protein marker. Figure 9B The expression of IL-1β is a phenotypic marker related to cellular senescence secretion. It is evident that knocking down hsa_piR_017724 reduced the expression of P21 and IL-1β mRNA, indicating that knocking down hsa_piR_017724 can slow down cellular senescence, and hsa_piR_017724 may serve as a therapeutic target for vascular senescence.

[0135] Figure 10A and Figure 10B The expression levels of galactosidase (a marker protein of cellular senescence) in D-gal-treated VSMCs with hsa_piR_017724 knockdown and control groups were determined using immunofluorescence assays. Immunofluorescence assays are experiments that observe the expression levels of related proteins in cells or tissues by observing the interaction between primary and secondary antibodies and the substrate under a fluorescence microscope. Knockdown of hsa_piR_017724 resulted in decreased fluorescence intensity of galactosidase, indicating that the expression level of galactosidase in cells was lower than that in the control group. The decrease in galactosidase expression after hsa_piR_017724 knockdown suggests that the degree of D-gal-induced cellular senescence is mitigated after hsa_piR_017724 knockdown, achieving an antagonistic effect on senescence. This suggests that hsa_piR_017724 may serve as a therapeutic target for vascular senescence at the cellular level.

[0136] The above experimental results indicate that hsa_piR_017724 is significantly correlated with vascular aging, making it a novel biomarker for vascular aging. hsa_piR_017724 expression is upregulated in vascular cells treated with the aging-inducing agent D-gal; ROC curves show that hsa_piR_017724 has good diagnostic capabilities for patients with vascular aging, suggesting that hsa_piR_017724 may be involved in the aging-inducing effect of D-gal on vascular cells. In conclusion, hsa_piR_017724 shows promise as a novel diagnostic biomarker and therapeutic target for vascular aging.

[0137] Example 4: Composition of the sequence, primers, and reagent kit involved in this invention.

[0138] The nucleotide sequence of the vascular aging biomarker hsa_piR_017724 provided by this invention is shown in SEQ ID No.1, and it is derived from the piRbase database with the number piR-hsa-017724.

[0139] SEQ ID No.1: TGGATTTGGCCTGGATTGTTATGGCTTGCTT

[0140] The primer pair specifically recognizing hsa_piR_017724 provided by this invention includes the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3:

[0141] SEQ ID No.2: TGGATTTGGCCTGGATTGTTA

[0142] SEQ ID No. 3:

[0143] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGCAAG

[0144] The reagent kit provided by this invention consists of:

[0145] 5x primer buffer, reaction enzyme combination I, Random 6mers, Oligo dT primers, RNase-free purified water, SYBR probe II (Tli RNaseH Plus) (2x), PCR primers (F+R) (10μM), ROX Reference dye (50x).

Claims

1. The application of a reagent for detecting piRNA biomarkers, characterized in that... It can be one or more of the following applications: A1) Application in the preparation of diagnostic products for vascular aging; A2) Application in the preparation of products for screening vascular aging; The piRNA marker is hsa_piR_017724, and its nucleotide sequence is shown in SEQ ID No.

1.

2. The application as described in claim 1, characterized in that: The product is designed to diagnose vascular aging by detecting the expression level of hsa_piR_017724 using RT-PCR, real-time quantitative PCR, in situ hybridization, microarray, or high-throughput sequencing platforms.

3. The application as described in claim 1, characterized in that: The reagent is used to detect the expression level of hsa_piR_017724 or to specifically recognize hsa_piR_017724.

4. The application as described in claim 1, characterized in that... The reagent is specifically one of the following a), b), or c): a) Primers used for detecting or specifically recognizing hsa_piR_017724; b) A reagent group containing the reagents described in a); c) A kit containing either a) or b).

5. The application as described in claim 4, characterized in that: The primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.