Osteoarthritis and rheumatoid arthritis mRNA medicine and application

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to an osteoarthritis and rheumatoid arthritis mRNA (messenger Ribonucleic Acid) medicine and application. Specifically, a protein factor mRNA capable of stimulating cartilage proliferation and a protein factor mRNA capable of reducing cartilage cell inflammatory response are successfully prepared, and after the pharmaceutical preparation for osteoarthritis and rheumatoid arthritis is delivered into target cells, proliferation of cartilage cells and generation of extracellular matrixes can be promoted, and the inflammatory response of the cartilage cells can be reduced. The pathological processes of osteoarthritis and rheumatoid arthritis can be effectively reversed; the preparation method of the pharmaceutical preparation for arthritis is simple, convenient and rapid, the expression quantity of active ingredients is high, the immunogenicity is low, and bone articular cartilage growth can be rapidly and effectively promoted, so that the purpose of treating osteoarthritis and rheumatoid arthritis is achieved, and the pharmaceutical preparation has good practical application value.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an mRNA drug for osteoarthritis and rheumatoid arthritis and applications thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Osteoarthritis (OA) is a chronic degenerative disease characterized by damage to articular cartilage and affecting the entire joint. There are many factors that may trigger OA, such as aging, obesity, genetics, gender, joint injury and other factors. Its pathological characteristics mainly include cartilage damage, synovial inflammation, destruction of subchondral bone and periarticular tissue, accompanied by joint dysfunction, which is clinically manifested as swelling, pain and limited joint movement in the joint area. Osteoarthritis causes joint pain, discomfort and limited movement, which seriously affects the quality of life of patients and brings great economic and medical burdens to families and society.

[0004] The specific pathological progression of osteoarthritis is manifested by the destruction of the cartilage matrix with the occurrence of various damaging factors, which releases inflammatory factors and triggers an inflammatory response. For example, the expression of interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6) is highly upregulated, inducing the production of reactive oxygen species and the expression of matrix-degrading proteases, leading to degradation of the cartilage extracellular matrix and joint dysfunction. Inflammatory stimulation plunges the cartilage matrix into a vicious cycle of damage, causing the originally smooth cartilage surface to become rough and the joint lubrication function to decline. Due to the loss of chondrocytes, the synthesis and metabolism of the cartilage matrix cannot proceed, ultimately leading to the formation of permanent damaged areas of cartilage.

[0005] Currently, there is no specific treatment for osteoarthritis. Most clinical treatments use nonsteroidal anti-inflammatory drugs (NSAIDs) such as diclofenac and celecoxib. Opioids, such as tramadol, are also used to alleviate severe joint pain. Furthermore, even after joint replacement surgery, most patients experience limited relief from their disease symptoms. Therefore, there is an urgent need for an osteoarthritis treatment that can reduce inflammation in the joint cavity and restore chondrocyte proliferation to achieve better therapeutic outcomes.

[0006] Rheumatoid arthritis (RA) is a chronic, systemic autoimmune disease with erosive, symmetrical polyarthritis as its main clinical manifestation. Its core pathological change is chronic inflammation of the synovium, which gradually progresses to synovial hyperplasia and pannus formation, ultimately leading to the destruction of articular cartilage and subchondral bone. Its pathological characteristics mainly include synovial inflammation, pannus formation, erosion of cartilage and bone, accompanied by joint deformity and loss of function. Clinically, it manifests as persistent swelling, pain, morning stiffness (significant joint stiffness after getting up in the morning, relieved by activity) and limited joint movement of the affected joints. Rheumatoid arthritis not only causes joint pain and discomfort, leading to limited movement and seriously affecting the patient's quality of life, but may also involve multiple organ systems outside the joints, bringing heavy economic and medical burdens to families and society.

[0007] The specific pathological progression of rheumatoid arthritis is manifested by the immune system mistakenly attacking its own joint tissues, especially the synovium. Under chronic inflammatory conditions, synovial cells are activated and proliferate massively, releasing a variety of proinflammatory cytokines, such as IL-1β, TNF-α, and IL-6. These factors interact with each other to form a complex inflammatory network, further exacerbating the inflammatory response. At the same time, these cytokines also induce the production of cartilage and bone-degrading enzymes such as matrix metalloproteinases (MMPs) and promote osteoclast activation, leading to articular cartilage destruction and subchondral bone resorption, ultimately causing joint structural damage and dysfunction. Continuous inflammatory stimulation causes synovial hyperplasia and pannus to continuously erode the joints, forming a destructive vicious cycle that leads to joint deformity and loss of function.

[0008] Currently, the treatment goals for rheumatoid arthritis are to control inflammation early, alleviate symptoms, prevent or delay joint destruction, and maintain joint function as much as possible. Clinical treatment often adopts a "pyramid" or "step-down" approach, with early use of nonsteroidal anti-inflammatory drugs (NSAIDs) (such as diclofenac and celecoxib) and NSAIDs to relieve pain and inflammation, while simultaneously initiating early combined use of disease-modifying antirheumatic drugs (DMARDs) such as methotrexate, leflunomide, and sulfasalazine to control disease progression. For patients who respond poorly to or are intolerant of traditional DMARDs, biologic DMARDs (such as TNF-α inhibitors and IL-6 receptor antagonists) and small molecule targeted drugs (such as JAK inhibitors) have become important treatment options. Although existing treatments can significantly improve symptoms and prognosis in most patients, some still struggle to achieve complete remission or low disease activity, and the disease may still progress and lead to joint damage. Therefore, efforts are underway both domestically and internationally to explore more effective and precise treatment strategies for rheumatoid arthritis that can achieve long-term remission or even cure. Summary of the Invention

[0009] In response to the deficiencies in the prior art, the present invention aims to provide an mRNA drug for the treatment of osteoarthritis and rheumatoid arthritis. Specifically, the present invention successfully prepared mRNA for a protein factor that stimulates cartilage proliferation and mRNA for a protein factor that reduces the inflammatory response of chondrocytes. After the osteoarthritis drug preparation is delivered into target cells, it can promote the proliferation of chondrocytes and the production of extracellular matrix, as well as reduce the inflammatory response of chondrocytes, and can effectively reverse the pathological process of osteoarthritis. The preparation method of the osteoarthritis drug preparation is simple and fast, with high expression of active ingredients and low immunogenicity, and can quickly and effectively promote the growth of osteoarticular cartilage, thereby achieving the purpose of treating osteoarthritis. Based on the above research results, the present invention is completed.

[0010] In order to achieve the above technical objectives, the technical solutions provided by the present invention are as follows:

[0011] In a first aspect of the present invention, mRNA is provided, wherein the mRNA comprises a first mRNA encoding an interleukin-1 receptor antagonist (IL-1ra) and / or a second mRNA encoding a human angiopoietin-like protein 3 derivative (ANGPTL3-D);

[0012] Furthermore, the first mRNA includes any one of (a1) to (a3):

[0013] (a1) an mRNA molecule having the nucleotide sequence shown in SEQ ID NO.1;

[0014] (a2) an mRNA molecule derived from (a1) which has the function of encoding an interleukin-1 receptor antagonist and has the same GC base pair percentage content as the original nucleotide sequence, by substitution, deletion or addition of one or more nucleotides in the nucleotide sequence defined in (a1);

[0015] (a3) An mRNA molecule that hybridizes with the mRNA molecule defined in (a1) or (a2) under stringent conditions and has the function of encoding an interleukin-1 receptor antagonist.

[0016] The second mRNA includes any one of (b1) to (b3):

[0017] (b1) an mRNA molecule having the nucleotide sequence shown in SEQ ID NO. 2;

[0018] (b2) an mRNA molecule derived from (b1) which has the function of encoding a human angiopoietin-like protein 3 derivative and has the same GC base pair percentage content as the original nucleotide sequence, after substitution, deletion or addition of one or more nucleotides in the nucleotide sequence defined in (b1);

[0019] (b3) An mRNA molecule that hybridizes with the mRNA molecule defined in (b1) or (b2) under stringent conditions and has the function of encoding a human angiopoietin-like protein 3 derivative.

[0020] The second aspect of the present invention provides the use of the above-mentioned mRNA in the preparation of an mRNA drug, wherein the mRNA drug has at least any one of the following uses:

[0021] (c1) Promote chondrocyte proliferation and extracellular matrix production;

[0022] (c2) reduce the inflammatory response of chondrocytes;

[0023] (c3) Promote cartilage repair;

[0024] (c4) Reverse the pathological process of osteoarthritis and rheumatoid arthritis;

[0025] (c5) Treatment of osteoarthritis and rheumatoid arthritis.

[0026] The third aspect of the present invention provides an mRNA drug, which comprises at least the above-mentioned mRNA;

[0027] Furthermore, the mRNA drug also includes lipid nanoparticles (LNPs) encapsulating the mRNA. The lipid nanoparticles contain a novel lipid material, FS01, as an ionizable lipid, which improves the delivery efficiency of mRNA into the joint cavity compared to commercially available ionizable lipids. The structural formula of FS01 is shown below:

[0028]

[0029] Furthermore, the lipid nanoparticles are composed of FS01, DSPC, cholesterol and mPEG2000-DMG.

[0030] Furthermore, the molar ratio of FS01, DSPC, cholesterol and mPEG2000-DMG is 30-80:1-20:20-50:0.1-10; preferably 50:10:38.5:1.5.

[0031] A fourth aspect of the present invention provides a method for preparing the above-mentioned mRNA drug, which comprises: mixing a solution containing the above-mentioned mRNA with a lipid solution.

[0032] Wherein, in the solution containing mRNA, the solution may be a citric acid buffer solution, further a 20 mM citric acid buffer solution with a pH of 4.0;

[0033] The lipid solution is prepared by dissolving the FS01, DSPC, cholesterol and mPEG2000-DMG in an ethanol solution.

[0034] The mixing can be performed using a microfluidic method.

[0035] Furthermore, the preparation method further comprises the steps of centrifuging and ultrafiltration the mRNA-containing lipid nanoparticle solution obtained after mixing, and replacing the phosphate buffer solution to obtain the product.

[0036] Beneficial technical effects of one or more of the above technical solutions:

[0037] 1) Compared to other methods for producing therapeutic protein drugs, the mRNA drug formulations for osteoarthritis and rheumatoid arthritis provided by the above technical solution can be prepared by in vitro transcription, independent of cell amplification, making it easy to monitor and control all production processes. Furthermore, it eliminates the need for cell culture, protein extraction, and purification, further saving time and money.

[0038] 2) The endogenously expressed therapeutic proteins in the mRNA pharmaceutical preparations for osteoarthritis and rheumatoid arthritis provided by the above technical solutions have higher fidelity in spatial structure and post-translational modifications such as glycosylation than heterologously produced therapeutic proteins, resulting in better therapeutic effects.

[0039] 3) Compared with DNA drugs, the mRNA drugs for osteoarthritis and rheumatoid arthritis provided by the above technical solution do not need to enter the cell nucleus to translate therapeutic proteins, which increases the production of therapeutic proteins while avoiding the risk of genomic integration. In addition, as a common transient component in the body, mRNA is more easily cleared by the body's physiological metabolic pathways and will not add additional metabolic burden to the recipient's body.

[0040] 4) The osteoarthritis and rheumatoid arthritis mRNA drug preparations provided by the above technical solutions have untranslated region modifications and nucleotide modifications to achieve the optimal therapeutic effect of mRNA drugs, including 5' capping modification by co-transcriptional method, introduction of 5' and 3' untranslated region sequences, introduction of 3' polyadenylation sequence, and nucleotide modifications including pseudouridine replacing uridine, which can further improve mRNA stability, increase protein translation efficiency, and enhance drug therapeutic effects;

[0041] 5) The sequences used in the osteoarthritis and rheumatoid arthritis mRNA pharmaceutical preparations provided by the above technical solution have been modified, and a new cap structure is used to enhance the expression efficiency of mRNA in chondrocytes.

[0042] 6) The osteoarthritis and rheumatoid arthritis mRNA drug preparations provided by the above technical solution use the new lipid material FS01 as an ionizable lipid in the lipid nanoparticle (LNP) formulation. Compared with the ionizable lipids already on the market, this improves the delivery efficiency of mRNA in the joint cavity and therefore has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0044] Figure 1 The structure of the mRNA sequence encoding interleukin-1 receptor antagonist (IL-1ra) and human angiopoietin-like protein 3 derivative (ANGPTL3-D) was designed.

[0045] Figure 2 ELISA was used to detect the expression of IL-1ra protein in HEK-293T cells after IL-1ra mRNA molecules were transfected.

[0046] Figure 3 Western blot was used to detect the expression level of ANGPTL3-D protein after ANGPTL3-D mRNA molecules were transfected into HEK-293T cells.

[0047] Figure 4 This figure shows the effect of drug treatment in an early osteoarthritis mouse model (4 weeks after modeling). The cartilage repair was observed by sectioning the joints of mice in different treatment groups and staining with HE and safranin fast green.

[0048] Figure 5 This figure shows the effect of drug treatment in a late-stage osteoarthritis mouse model (8 weeks after modeling). The cartilage repair was observed by sectioning the joints of mice in different treatment groups and staining with HE and safranin fast green.

[0049] Figure 6 This figure shows the effect of drug treatment in a collagen-induced rheumatoid arthritis mouse model. The therapeutic effect was evaluated by observing the degree of joint swelling and HE and safranin fast green staining.

[0050] Figure 7 This figure shows the effect of drug treatment in a spontaneous mouse model of rheumatoid arthritis induced by TNF transgenic cells. The therapeutic effect was evaluated by observing the degree of joint swelling and HE and Safranin Fast Green staining. DETAILED DESCRIPTION

[0051] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.

[0052] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should also be understood that when the terms "comprising" and / or "including" are used in this manual, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof. The present invention has used conventional techniques and methods in the field of genetic engineering and molecular biology. Those skilled in the art can adopt other conventional techniques, methods and reagents in this area on the basis of the embodiments provided by the present invention, without being limited to the limitation of the specific embodiments of the present invention.

[0053] The present invention is described in detail below with reference to the accompanying drawings and specific examples. In the following examples, the materials and reagents used were obtained from commercial sources unless otherwise specified. The experimental methods described are conventional methods in the art unless otherwise specified.

[0054] Example 1 Design of mRNA Drugs

[0055] Since the original protein sequence has low expression levels in vivo, codon optimization is used to increase its expression. The optimization scheme is mainly based on two parameters: the Codon Adaption Index (CAI) and the Minimum Free Energy (MFE). The CAI can be used as an indicator of codon bias. It refers to the degree of consistency between the frequency of synonymous codons in the coding region and the optimal codon usage. The higher the CAI value, the higher the gene expression level in vivo. In recent years, another factor affecting expression has been proposed, namely the secondary structure of mRNA. The more compact the structure, the lower the corresponding MFE, the minimum folding free energy, and the higher the stability of the mRNA. With the help of the codon optimization algorithm, the mRNA sequence corresponding to the target protein is designed.

[0056] In addition, the mRNA sequence of the corresponding protein was analyzed as follows: Figure 1 The modification shown encodes the full-length interleukin receptor antagonist (IL-1ra) and human angiopoietin-like protein 3 (Angptl3) modified (ANGPTL3-D) protein; the original signal peptide is replaced by the signal peptide of human Igk.

[0057] Example 2 mRNA Preparation

[0058] Linearized DNA template preparation: The antigen's ORF (open reading frame) sequence is concatenated with the T7 promoter sequence, 5'UTR sequence, 3'UTR sequence, and polyA sequence. Full gene synthesis is then performed using the Puc57 vector to generate a template plasmid. Using the plasmid as a template, a long polyT primer, a high-fidelity DNA polymerase (purchased from Thermo Scientific Phusion), dNTPs, and other raw materials, a PCR cycle is performed using the appropriate protocol to generate the transcription template DNA.

[0059] Prepare mRNA using an in vitro transcription reaction (using a 40 μL reaction system as an example): Mix the prepared IVT template with T7 RNA polymerase (purchased from Sungene Biotech), rNTPs, and other raw materials according to the recommended ratios in the manufacturer's instructions. Transcribe using the co-transcription capping method at 37°C for 2 hours. After the transcription reaction, digest the IVT template with DNase (purchased from Novozymes) to reduce the risk of residual DNA template.

[0060] Purification: Use an RNA purification kit (purchased from NEB) to purify the mRNA after the IVT reaction. Dissolve the purified mRNA in TE buffer and use it for subsequent formulation coating.

[0061] Example 3 Expression of different mRNA sequences in HEK-293T cells

[0062] In a 6-well plate, 5 × 10 5 HEK-293T cells were incubated at 37°C for 24 hours. 2 μg of interleukin receptor antagonist (IL-1ra) and human angiopoietin-like protein 3 (Angptl3) modified form (ANGPTL3-D) mRNA were transfected using jetMESSENGER transfection reagent. To determine the procedure, 2 μg of mRNA was added to 200 μl of mRNA buffer and mixed thoroughly. Then, 4 μl of jetMESSENGER reagent was added and mixed thoroughly. After incubation at room temperature for 15 minutes, the cells were added dropwise to the cells and incubated at 37°C. After 48 hours, the cell culture supernatant was aspirated, centrifuged at 3000 rpm at 4°C for 5 minutes, and the supernatant was aspirated. The cells were rinsed with PBS, transferred to a 1.5 ml microcentrifuge tube, and centrifuged at 1500 rpm at 4°C for 5 minutes. The supernatant was discarded, and cell lysis buffer (purchased from Beyotime) was added. The cells were lysed on ice for 20 minutes, centrifuged at 13000 rpm at 4°C for 10 minutes, and the supernatant was aspirated.

[0063] The IL-1ra concentration of the above cell culture supernatant samples was detected using a commercial ELISA kit (purchased from Lianke Bio).

[0064] GraphPad Prism 8.0 software was used to perform statistical analysis of the data obtained from the above experiments using the T-test method, where p ≥ 0.05 indicated no significant difference, which was marked as ns; p < 0.05 was marked as *, p < 0.01 was marked as **, p < 0.001 was marked as ***, and p < 0.0001 was marked as ****.

[0065] Western blot analysis was performed on the cell culture supernatant and cell lysate samples. A BCA kit (purchased from Norvegian) was used to detect the protein content of the samples. 50 μg of protein was taken and diluted to 20 μl with lysis buffer. 5× Loading buffer (purchased from Sangon Biotechnology) was added, mixed, and a total of 25 μL was added. The mixture was heated at 95°C for 10 min. A 10% SDS-PAGE separation gel and a 5% SDS-PAGE stacking gel were prepared, and the sample and protein marker (purchased from Thermo) were added. Electrophoresis was performed at 80V for 30 min, followed by electrophoresis at 120V for 60 min. The membrane was then transferred to a membrane at 200 mA for 60 min. After transfer, the ANGPTL3-D and GADPH bands were cut and blocked in 5% skim milk for 2 h. After washing with TBST, the membrane was incubated with the primary antibody: 3 μl of human angiopoietin-like protein 3 (Angptl3) / GADPH primary antibody (purchased from Abcam) was diluted into 6 ml of 5% skim milk (dilution ratio 1:2000) and incubated overnight at 4°C on a shaker. After washing with TBST, the membrane was incubated with the secondary antibody: 1 μl of HRP-conjugated Affinipure Goat Anti-Mouse IgG (H+L) (Proteintec) was diluted into 5 ml of 5% skim milk (dilution ratio 1:5000) and incubated at room temperature for 2 h. After washing with TBST, 500 μl of developer solution A and 500 μl of developer solution B (purchased from Norvegian) were mixed, the membrane was placed in a tray, 500 μl of the developer mixture was poured onto the surface, the reaction was allowed to proceed for 1 min, and the membrane was imaged using an imager.

[0066] like Figure 2 、 3 As shown, the designed IL-1ra mRNA (SEQ ID NO.1) and ANGPTL3-D mRNA (SEQ ID NO.2) were normally expressed in HEK-293T cells.

[0067] Example 4: Preparation of osteoarthritis mRNA pharmaceutical preparation

[0068] Preparation of lipid solution: FS01:DSPC:cholesterol:mPEG2000-DMG were dissolved in ethanol solution at a molar ratio of 50:10:38.5:1.5; the molar concentration of FS01 in the ethanol solution was controlled to be 0.866 mmol / L.

[0069] The specific synthesis method of FS01 is as follows:

[0070] 1. Preparation of Compound 2

[0071]

[0072] To a solution of dichloromethane (150 mL) containing compound 1 (30.0 g, 117 mmol, 1.00 equivalent) and 8-bromooctanoic acid (28.7 g, 129 mmol, 1.10 equivalent) was added DMAP (1.43 g, 11.7 mmol, 0.10 equivalent) and EDCI (24.7 g, 129 mmol, 1.10 equivalent) and stirred at 25-35 ° C for 16 hours. TLC showed the formation of new spots. The solution was concentrated under reduced pressure to obtain a residue. The residue was purified by column chromatography to obtain compound 2 (43.7 g, crude product) as a colorless oil.

[0073] 1 H-NMR: (400MHz, CDCl3) δ 4.87 (t, 1H), 3.40 (t, 2H), 2.29 (t, 2H), 1.86 (quin, 2H), 1.69-1.60 (m, 2H), 1.56-1.16 (m, 34H), 0.88 (t, 6H).

[0074] 2. Preparation of Compound 3

[0075]

[0076] At 25-35 DEG C, to i-PrOH (100mL) solution containing compound 2 (20.0g, 43.3mmol, 1.00 equivalent) add N- (3-aminopropyl) tert-butyl carbamate (37.8g, 217mmol, 37.8mL, 5.00 equivalent), then the solution is stirred at 55-65 DEG C for 16 hours. TLC shows that compound 2 is completely consumed to obtain the desired compound. The reaction is cooled to 20-35 DEG C and concentrated under reduced pressure to obtain residue. The residue is purified by column chromatography to obtain compound 3 (13.0g, crude product) as a yellow oil.

[0077] 1H-NMR: (400MHz, CDCl3) δ5.19(br s, 1H), 4.86(t, 1H), 3.19(br d, 2H), 2.66 (t, 2H), 2.57 (t, 2H), 2.27 (t, 2H), 1.73-1.57 (m, 4H) 1.55-1.39 (m, 17H), 1.38-1.14 (m, 31H), 0.87 (t, 6H)

[0078] 3. Preparation of Compound 6

[0079]

[0080] To a mixed solution of dichloromethane (100 mL) and water (10.0 mL) containing compound 4 (10.0 g, 43.65 mmol, 1.00 equivalent), cyclopentyl (diphenyl) phosphine dichloropalladium catalyst (3.19 g, 4.37 mmol, 0.10 equivalent), butyl boronic acid (6.68 g, 65.5 mmol, 1.50 equivalent) and potassium carbonate (18.1 g, 131 mmol, 3.00 equivalent) was added. The mixture was stirred at 90-110 ° C for 14 hours. TLC showed that compound 4 was completely consumed. The reaction mixture was quenched by adding water (50 mL) and extracted with ethyl acetate. After the combined organic compound layer was washed with saturated NaCl solution (100 mL), it was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to obtain a residue. Compound 6 (20.0 g, crude product) was obtained as a black solid. Compound 6 was purified by column chromatography to obtain compound 6 (7.30 g) as a yellow oil.

[0081] 1 H-NMR: (400MHz, CDCl3) δ7.23 (br d, 4H), 3.79-3.61 (m, 5H), 2.77-2.54 (m, 2H), 1.65-1.53 ​​(m, 2H), 1.50-1.37 (m, 2H), 0.98 (t, 3H)

[0082] 4. Preparation of Compound 7

[0083]

[0084] To a THF (73.0 mL) solution containing compound 6 (7.30 g, 35.4 mmol, 1.00 equivalent) was added LAH (2.5 M, 14.2 mL, 1.00 equivalent) at -5-5 ° C. The mixture was stirred at 20-30 ° C for 3 hours. TLC showed that compound 6 was completely consumed. The reaction mixture was quenched by adding 30.0 mL of saturated potassium sodium tartrate solution and extracted with ethyl acetate. The combined organic layer compound was washed with 50.0 mL of saturated NaCl solution, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give compound 7 (5.88 g, 33.0 mmol, 93.2%) as a yellow oil.

[0085] 1 H-NMR: (400MHz, CDCl3) δ7.23-7.10 (m, 4H), 3.85 (br d, 2H), 2.93 (t, 2H), 2.75-2.59 (m, 2H), 1.64-1.53 ​​(m, 3H), 1.49-1.36 (m, 2H), 0.95-0.93 (m, 1H), 0.97 (t, 2H)

[0086] 5. Preparation of Compound 8

[0087]

[0088] To a DCM (30.0 mL) solution containing compound 7 (5.88 g, 33.0 mmol, 1.00 equiv) and compound 7A (8.09 g, 36.3 mmol, 1.10 equiv) was added DMAP (403 mg, 3.30 mmol, 0.10 equiv) and EDCI (6.96 g, 36.3 mmol, 1.10 equiv), and the solution was stirred at 25-35 ° C for 7 hours. TLC showed that the starting material was completely consumed. The reactant was concentrated under reduced pressure to obtain a residue. After the residue was purified by column chromatography, compound 8 (9.52 g) was obtained as a yellow oil.

[0089] 1 H-NMR: EW43795-269-P1A (400MHz, CDCl3) δ7.24-7.11 (m, 4H), 4.27 (t, 2H), 3.41 (t, 2H), 2.98 (t, 2H), 2.71-2 .58(m,2H),2.31(t,2H),1.94-1.79(m,2H),1.68-1.55(m,4H),1.49-1.38(m,4H),1.33(td,4H),0.97(t,3H)

[0090] 6. Preparation of Compound 9

[0091]

[0092] To i-PrOH (30.0 mL) solution containing compound 8 (4.89 g, 12.8 mmol, 1.20 equivalents) and compound 3 (6.28 g, 10.6 mmol, 1.00 equivalents) was added sodium carbonate (3.38 g, 31.9 mmol, 3.00 equivalents), and the solution was then stirred at 80-90 ° C for 20 hours. LCMS showed that compound 8 was completely consumed and the desired compound was obtained. The solution was cooled to 25-35 ° C, and water (10.0 mL) was added to the solution, which was then extracted with ethyl acetate, and the combined organic layers were concentrated under reduced pressure to obtain a residue. The residue was purified by column chromatography to obtain compound 9 (5.14 g) as a light yellow oil.

[0093] 1 H-NMR: (400MHz, CDCl3) δ7.23-7.10(m, 4H), 5.66(br s, 1H), 4.87(quin, 1H), 4.26(t, 2H), 3.18(br d, 2H), 2.96(t, 2H), 2.72-2.59(m, 2H), 2.45(br t, 2H), 2.38-2.24 (m, 8H), 1.67-1.55 (m, 8H), 1.54-1.48 (m, 4H), 1.47-1.37 (m, 15H), 1.36-1.21 (m, 37H), 0.95 (t, 3H), 0.88 (t, 6H).

[0094] 7. Preparation of Compound 10

[0095]

[0096] At 20-30 ℃, to DCM (15.0mL) solution of compound 9 (5.14g, 6.00mmol, 1.00 equivalent), add HCl / EtOAc (2M, 30.0mL, 10.0 equivalent), then stir the solution for 1 hour.LCMS shows that compound 9 is completely consumed and is required compound. After the reaction mixture is diluted with water (50.0mL), adjust pH to 7-8 with saturated sodium bicarbonate.Mixture is extracted with DCM, the organic layer compound merged is dried with sodium sulfate, filtered and concentrated under reduced pressure to obtain yellow oily compound 10 (4.30g).

[0097] 1H-NMR: (400MHz, CDCl3) δ7.20-7.07(m, 4H), 4.86(t, 1H), 4.41(br s, 2H), 4.25 (t, 2H), 2.95 (t, 2H), 2.89 (t, 2H), 2.69-2.60 (m, 2H), 2.54 (t, 2H), 2.47-2.37 (m, 4H), 2.28 (q, 4H), 1.72 -1.65(m, 2H), 1.64-1.54(m, 6H), 1.53-1.46(m, 4H), 1.46-1.36(m, 6H), 1.35-1.13(m, 37H), 0.94(t, 3H), 0.87(t, 6H)

[0098] 8. Preparation of Compound 11

[0099]

[0100] Methylamine (2M, 21.11 mL, 1.20 equiv) was added to a solution of compound 11-1 (5.00 g, 35.2 mmol, 1.00 equiv) in EtOH (500 mL). The mixture was stirred at 20-30 ° C for 3 hours. TLC showed that compound 11-1 was completely consumed. The reaction mixture was filtered and concentrated under reduced pressure to obtain compound 11 (5.00 g, crude product) as a white solid.

[0101] 1 H-NMR: (400MHz, CDCl3) δ8.86-8.10(m, 1H), 4.39-4.10(m, 3H), 3.16-2.86(m, 3H)

[0102] 9. Synthesis of compound FS01

[0103]

[0104] To a THF (27.0 mL) solution containing compound 10 (4.00 g, 5.25 mmol, 1.00 equivalent) was added compound 11 (964 mg, 6.83 mmol, 1.30 equivalent) and sodium bicarbonate (34.8 g, 41.4 mmol, 16.1 mL, 10%, 7.89 equivalent), and the solution was stirred at 40-50 ° C for 16 hours. LCMS showed that compound 10 was completely consumed and the desired compound was obtained. After the mixture was extracted with ethyl acetate, the combined organic layer was concentrated under reduced pressure to obtain a residue. The residue was purified by column chromatography to obtain compound FS01 (2.18 g) as a gummy white solid.

[0105] 1H-NMR: (400MHz, CDCl3) δ7.22-7.10(m, 4H), 4.86(t, 1H), 4.25(t, 2H), 3.66(br s, 2H), 3.28(br d, 3H), 2.96(t, 2H), 2.70-2.59(m, 2H), 2.53(br t, 2H), 2.46-2.35 (m, 4H), 2.34-2.24 (m, 4H), 1.81-1.70 (m, 2H), 1.66-1 .47(m, 10H), 1.41(qd, 7H), 1.34-1.18(m, 36H), 0.95(t, 3H), 0.88(t, 6H)

[0106] Preparation of mRNA solution: Dissolve the mRNAs of interleukin receptor antagonist (IL-1ra) and human angiopoietin-like protein 3 (Angptl3) modified form (ANGPTL3-D) in 20 mM citric acid buffer solution at pH 4.0, and control the concentration of both mRNAs in the buffer solution to be 100 μg / ml;

[0107] Preparation of lipid nanoparticles: 1 mL of interleukin receptor antagonist (IL-1ra) and human angiopoietin-like protein 3 (Angptl3) modified form (ANGPTL3-D) mRNA solutions and 3 mL of lipid solution were drawn into a syringe, inserted into a microfluidic chip, and set to the following parameters: volume (4.0 mL); flow rate ratio (3:1); total flow rate (12 mL / min); and mixing to obtain a lipid nanoparticle solution.

[0108] Solution replacement: The lipid nanoparticle solution is added to an ultrafiltration tube for centrifugal ultrafiltration, and the phosphate buffer is replaced multiple times to obtain the finished product.

[0109] Example 5: Pharmacodynamic evaluation of the mRNA drug obtained in Example 4 in osteoarthritis mice

[0110] 1. Establishment of osteoarthritis animal model and treatment plan

[0111] C57BL / 6 mice (male, 6 weeks old, purchased from Vital River) were housed in ventilated cages under SPF conditions and maintained with a 12-h light and 12-h dark cycle. Destabilization of the medial meniscus (DMM) was used to induce osteoarticular cartilage damage in mice.

[0112] In two models, four weeks after DMM surgery (early osteoarthritis model) and eight weeks after DMM surgery (late osteoarthritis model), model mice were treated with mRNA drugs. The mRNA drug (4 μg / mouse) was injected into the joint cavity once a week for three weeks. After treatment, the mice were sacrificed for pathological examination.

[0113] 2. Safranin Fast Green and HE Staining of Mouse Knee Joint Tissue Sections

[0114] After killing the mice, the knee joints were dissected and immersed in 4% paraformaldehyde solution (purchased from Seville Biotechnology) for 24 hours. They were then transferred to 10% EDTA decalcification solution (purchased from Seville Biotechnology) and decalcified for 14 days. After decalcification, the sections were embedded in paraffin and sectioned. The paraffin sections were placed in an oven at 65°C for 40 minutes. After dehydration, they were stained with safranin fast green and hematoxylin and eosin using the corresponding kits (purchased from Bio-Toda).

[0115] like Figure 4 and Figure 5 As shown, compared with the DMM group, the mRNA drug group (IL-1ra+ANGPTL3-D group) had a significant therapeutic effect on osteoarthritis. Specifically, the articular cartilage of the treated mice was significantly repaired, the surface of the chondrocyte area was smooth, and there was no chondrocyte hypertrophy or loss. In addition, compared with the DMM group, the Mankin score and OARSI score in the drug treatment group were significantly reduced, indicating that this mRNA drug has a significant therapeutic effect on both early and late osteoarthritis.

[0116] Example 6 Pharmacodynamic evaluation of the mRNA drug obtained in Example 4 in a rheumatoid arthritis mouse model

[0117] 1. Establishment of animal model and treatment plan for rheumatoid arthritis

[0118] Model 1: DBA / 1J mice (male, 6 weeks old, purchased from Vital River) were housed in ventilated cages under SPF conditions with a 12-hour light / dark cycle. Collagen-induced arthritis (CIA) model was established by dissolving CⅡ (type II collagen) in 0.1 M acetic acid at a concentration of 2 g / L. After overnight at 4°C, the emulsion was thoroughly emulsified with an equal volume of complete Freund's adjuvant (CFA) on ice. Six- to eight-week-old DBA / 1J mice were intradermally injected with 0.1 ml of the emulsion at the base of the tail. 21 days later, a booster injection of 0.1 ml of an emulsion of type II collagen and incomplete Freund's adjuvant (IFA) was performed. mRNA drug (4 μg / mouse) was injected into the knee joint cavity on days 25, 32, 39, and 46 after the initial immunization. Mice were sacrificed on day 55 after the initial immunization for pathological examination.

[0119] Model 2: Spontaneous arthritis TNF-Tg mice, bred and cultured under SPF conditions. These transgenic mice, on a C57 background, overexpress human TNF, causing spontaneous arthritis at 12-14 weeks of age. Mice were injected with the mRNA drug (4 μg / mouse) intra-articularly at the knee joint at 14 weeks of age, at 15, 16, and 17 weeks of age. Mice were sacrificed at 18 weeks for pathological examination.

[0120] 2. Imaging of Specific Mouse Parts

[0121] After the mice were killed, the paws and ankle joints were photographed, the paw thickness was measured, the joint score was calculated, and CT images were taken.

[0122] 3. Safranin Fast Green and HE Staining of Mouse Knee Joint Tissue Sections

[0123] After killing the mice, the knee joints were dissected and immersed in 4% paraformaldehyde solution (purchased from Seville Biotechnology) for 24 hours. They were then transferred to 10% EDTA decalcification solution (purchased from Seville Biotechnology) and decalcified for 14 days. After decalcification, the sections were embedded in paraffin and sectioned. The paraffin sections were placed in an oven at 65°C for 40 minutes. After dehydration, they were stained with safranin fast green and hematoxylin and eosin using the corresponding kits (purchased from Bio-Toda).

[0124] like Figure 6 and Figure 7 As shown, the mRNA drug group (IL-1ra+ANGPTL3-D group) showed significant therapeutic effects on rheumatoid arthritis compared to CIA-induced rheumatoid arthritis mouse models and TNF-tg spontaneous rheumatoid arthritis mouse models. Specifically, joint swelling in the treated mice was reduced, CT imaging showed smooth joint surfaces, and bone erosion was reduced; HE staining revealed a low number of inflammatory infiltrating cells in the synovium; and safranin fast green staining showed intact cartilage morphology and abundant collagen.

[0125] The above describes the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included in the scope of protection of the present invention.

[0126] Codon-optimized IL-1Ra mRNA sequence design:

[0127] TAATACGACTCACTATAAGAATAAACTAGTATTCTTCTGGTCCCCACAGAC

[0128] TCAGAGAGAACCCGCCACCATGGAGACCCCTGCTCAGCTGCTGTTCCTGC

[0129] TCCTGCTGTGGCTGCCTGACACCACCGGAAGGCCTAGCGGCAAGAGGCCT

[0130] TGCAAGATGCAAGCCTTTAGGATCTGGGACACCAATCAGAAGACCTTCTA

[0131] CCTGAGGAACAATCAGCTGATCGCCGGCTACCTGCAAGGCCCTAACATCA

[0132] AGCTGGAGGAGAAGATCGACATGGTGCCTATCGACCTGCACAGCGTGTTC

[0133] CTGGGCATCCACGGCGGCAAGCTGTGCCTGAGCTGCGCCAAGAGCGGCGA

[0134] CGACATCAAGCTGCAGCTGGAAGAGGTGAACATCACCGACCTGAGCAAG

[0135] AACAAGGAGGAGGACAAGAGGTTCACCTTCATTAGGAGCGAGAAGGGCC

[0136] CTACCACAAGCTTCGAGAGCGCCGCCTGCCCTGGCTGGTTCCTGTGCACC

[0137] ACCCTGGAGGCCGATAGGCCTGTGAGCCTGACCAACACCCCTGAGGAGCC

[0138] TCTGATCGTGACCAAGTTCTACTTCCAAGAGGATCAGTGATGACTGGTACT

[0139] GCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCT

[0140] CCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCAC

[0141] CACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAA

[0142] AACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTT

[0143] AGCAATAAACGAAAGTTTAACT(SEQ ID NO.1)

[0144] Codon-optimized ANGPT3-D mRNA sequence:

[0145] TAATACGACTCACTATAAGAATAAACTAGTATTCTTCTGGTCCCCACAGAC

[0146] TCAGAGAGAACCCGCCACCATGGAGACCCCCGCTCAGCTGCTGTTCCTGC

[0147] TCCTGCTGTGGCTGCCCGACACCACCGGCATCCCCGCCGAGTGCACCACC

[0148] ATCTACAACAGAGGCGAGCACACAAGCGGCATGTACGCCATCAGACCTA

[0149] GCAACAGCCAAGTGTTCCACGTGTACTGCGACGTGATCAGCGGCAGCCCC

[0150] TGGACCCTGATTCAGCACAGAATCGACGGCAGCCAAAACTTCAACGAGAC

[0151] CTGGGAGAACTACAAGTACGGCTTCGGCAGACTGGACGGCGAGTTCTGGC

[0152] TGGGCCTGGAGAAGATCTACAGCATCGTGAAGCAGAGCAACTACGTGCTG

[0153] AGAATCGAGCTGGAGGACTGGAAGGACAACAAGCACTACATCGAGTACA

[0154] GCTTCTACCTGGGCAACCACGAGACCAACTACACCCTGCACCTGGTGGCC

[0155] ATCACCGGCAACGTGCCCAACGCCATCCCCGAGAACAAGGACCTGGTGTT

[0156] CAGCACCTGGGACCACAAGGCCAAGGGCCACTTCAACTGCCCCGAGGGCT

[0157] ACAGCGGCGGCTGGTGGTGGCACGACGAGTGCGGCGAGAACAACCTGAA

[0158] CGGCAAGTACAACAAGCCTAGAGCCAAGAGCAAGCCCGAGAGACGGAGA

[0159] GGCCTGAGCTGGAAAGAGCCAAAACGGCAGACTGTACAGCATCAAGAGCA

[0160] CCAAGATGCTGATCCACCCACCGACAGCGAGAGCTTCGAGTGATGACTG

[0161] GTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCG

[0162] AGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCA

[0163] CTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAG

[0164] CTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAA

[0165] CCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTG

[0166] GTCAATTTCGTGCCAGCCACACC(SEQ ID NO.2)

[0167] It should be noted that the above examples are intended only to illustrate the technical solutions of the present invention and are not intended to limit the same. Although the present invention has been described in detail with reference to the examples given, those skilled in the art may modify or substitute equivalents to the technical solutions of the present invention as needed without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. An mRNA, characterized in that The mRNA includes a first mRNA encoding an interleukin-1 receptor antagonist and / or a second mRNA encoding a human angiopoietin-like protein 3 derivative.

2. The mRNA according to claim 1, wherein The first mRNA includes any one of (a1) to (a3): (a1) an mRNA molecule having the nucleotide sequence shown in SEQ ID NO.1; (a2) an mRNA molecule derived from (a1) which has the function of encoding an interleukin-1 receptor antagonist and has the same GC base pair percentage content as the original nucleotide sequence, by substitution, deletion or addition of one or more nucleotides in the nucleotide sequence defined in (a1); (a3) an mRNA molecule that hybridizes with the mRNA molecule defined in (a1) or (a2) under stringent conditions and encodes an interleukin-1 receptor antagonist function; The second mRNA includes any one of (b1) to (b3): (b1) an mRNA molecule having the nucleotide sequence shown in SEQ ID NO. 2; (b2) an mRNA molecule derived from (b1) which has the function of encoding a human angiopoietin-like protein 3 derivative and has the same GC base pair percentage content as the original nucleotide sequence, after substitution, deletion or addition of one or more nucleotides in the nucleotide sequence defined in (b1); (b3) An mRNA molecule that hybridizes with the mRNA molecule defined in (b1) or (b2) under stringent conditions and has the function of encoding a human angiopoietin-like protein 3 derivative.

3. Use of the mRNA according to claim 1 or 2 in the preparation of mRNA drugs.

4. The use according to claim 3, characterized in that The mRNA drug has at least one of the following uses: (c1) Promote chondrocyte proliferation and extracellular matrix production; (c2) reduce the inflammatory response of chondrocytes; (c3) Promote cartilage repair; (c4) Reverse the pathological process of osteoarthritis and rheumatoid arthritis; (c5) Treatment of osteoarthritis and rheumatoid arthritis.

5. An mRNA drug, characterized in that The mRNA drug at least comprises the mRNA according to claim 1 or 2.

6. The mRNA drug according to claim 5, wherein The mRNA drug further comprises lipid nanoparticles encapsulating the mRNA according to claim 1 or 2.

7. The mRNA drug according to claim 6, wherein The lipid nanoparticles are composed of FS01, DSPC, cholesterol and mPEG2000-DMG; wherein the structural formula of FS01 is as follows: Furthermore, the molar ratio of FS01, DSPC, cholesterol and mPEG2000-DMG is 30-80:1-20:20-50:0.1-10; preferably 50:10:38.5:1.

5.

8. The method for preparing the mRNA drug according to any one of claims 5 to 7, characterized in that: The preparation method comprises: mixing a solution containing the mRNA according to claim 1 or 2 with a lipid solution.

9. The preparation method according to claim 8, wherein In the mRNA-containing solution, the solution is a citric acid buffer solution, further a 20 mM citric acid buffer solution with a pH of 4.0; The lipid solution is prepared by dissolving the FS01, DSPC, cholesterol and mPEG2000-DMG in an ethanol solution; The mixing is performed using a microfluidics method.

10. The preparation method according to claim 8, characterized in that The preparation method further comprises the steps of centrifuging and ultrafiltration the mRNA-containing lipid nanoparticle solution obtained after mixing, and replacing the phosphate buffer solution to obtain the product.

Images