Construction and application of lnc30 overexpression strain

By constructing an lnc30-overexpressing strain, the unclear regulatory mechanism of gene expression in Plasmodium falciparum was resolved, the invasion ability of merozoites was enhanced, and a new approach and tool for antimalarial drug screening was provided.

CN120607966APending Publication Date: 2025-09-09INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510779035.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-12
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

The gene expression regulation mechanism of Plasmodium falciparum is still not fully understood, especially the functional research of long non-coding RNA (lncRNA) is relatively limited, which has affected the development and mechanism research of antimalarial drugs.

Method used

An lnc30-overexpressing strain was constructed. The lnc30 gene was overexpressed in the Plasmodium falciparum 3D7 strain, high expression was achieved using the U6 promoter, and the overexpression of lnc30 was detected by transfection using the electroporation method.

Benefits of technology

It significantly enhances the growth advantage of Plasmodium falciparum and the ability of merozoites to invade red blood cells, participates in regulating the development process of the erythrocytic stage of Plasmodium, provides a new molecular tool for the screening and diagnosis of antimalarial drug targets, and reveals the key role of lnc30 in the development of Plasmodium falciparum.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120607966A_ABST
    Figure CN120607966A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to construction and application of an lnc30 overexpression strain. Comprising the following steps: (1) carrying out enzyme digestion on an original plasmid pLN-ENR-GFP by utilizing Hind III restriction enzyme, recovering a larger fragment, and then carrying out fragment self-connection to obtain a pBSD plasmid; (2) construction of a pBSD-30 plasmid: carrying out PCR (Polymerase Chain Reaction) to obtain and purify a U6 promoter gene, and connecting the gene between a 5'cloning site ApaI and a 3 'cloning site Avr II of the PLN-ENR-GFP plasmid; the method comprises the following steps: synthesizing an lnc30 full-length gene, and connecting the lnc30 gene between a 5'cloning site Avr II and a 3 'cloning site Afl II of a PLN-ENR-GFP plasmid; the lnc30 is connected with a U6 promoter, so that high expression of the lnc30 in cells is ensured. Experiments prove that lnc30 overexpression can significantly enhance the growth advantage of plasmodium falciparum and the ability of merozoite invading erythrocytes and participate in regulation of the erythroid stage development process of plasmodium, but knock-down of lnc30 may cause death of plasmodium, which indicates that the lnc30 overexpression strain is successfully constructed and can be used for research of a plasmodium falciparum gene expression regulation mechanism, and the lnc30 overexpression strain can be used for preparing the plasmodium falciparum gene expression regulation mechanism. The method is used for screening and researching drugs for inhibiting growth and development of plasmodium falciparum, and has remarkable scientific value and application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the construction and application of an lnc30 overexpressing insect strain. Background Art

[0002] Malaria is a serious infectious disease caused by Plasmodium parasites and is one of the three most serious infectious diseases worldwide. The pathogen that causes malaria is Plasmodium. There are five species of Plasmodium that can parasitize humans: Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, Plasmodium ovale, and Plasmodium knowlesi. Among these, Plasmodium falciparum is the most virulent and has the highest mortality rate. The erythrocytic stage of Plasmodium falciparum, during its development within human erythrocytes, is the only pathogenic stage that results in clinical symptoms. The erythrocytic stage of Plasmodium falciparum undergoes multiple morphological changes, including rings, macrotrophozoites, schizonts, and merozoites, and its antigens are expressed in mutually exclusive ways. This suggests that the erythrocytic stage of Plasmodium falciparum possesses sophisticated gene expression regulation mechanisms, however, these mechanisms remain incompletely understood. Long noncoding RNAs (lncRNAs) play an important role in regulating gene expression in organisms, but the functions of lncRNAs in Plasmodium falciparum, particularly those derived from intergenic regions, are poorly understood. Therefore, it is necessary to explore the functions and regulatory mechanisms of key lncRNAs in Plasmodium falciparum and construct lnc30 overexpression strains targeting the promoter region of the Plasmodium lnc30 gene for application in the development and mechanism research of antimalarial drugs. Summary of the Invention

[0003] The present invention provides a method for constructing an lnc30 overexpressing insect strain, wherein the nucleotide sequence of the lnc30 gene is shown in SEQ ID NO.1.

[0004] The method for constructing a lnc30 overexpressing strain includes the following steps:

[0005] (1) Construction of pBSD plasmid: The original plasmid pLN-ENR-GFP was digested with HindIII restriction endonuclease, the larger fragments were recovered, and then the fragments were self-ligated to obtain the pBSD plasmid;

[0006] (2) Construction of the pBSD-30 plasmid: The U6 promoter gene was obtained by PCR and purified, and this gene was ligated between the 5' cloning site ApaⅠ and the 3' cloning site AvrⅡ of the PLN-ENR-GFP plasmid; the full-length lnc30 gene was synthesized and ligated between the 5' cloning site AvrⅡ and the 3' cloning site AflⅡ of the PLN-ENR-GFP plasmid; by ligating lnc30 to the U6 promoter, high expression of lnc30 in cells was ensured;

[0007] (3) Transfection of parasites: The constructed plasmid described in (2) was transformed into the ring stage Plasmodium falciparum 3D7 strain by electroporation, and qRT-PCR was used to detect whether lnc30 was overexpressed.

[0008] The electroporation transfection parameters are 310V / 950uf.

[0009] The primers for lnc 30 are:

[0010] qPCR30-5': 5'TTATTGTAAAGATAAAATTTGTCTGTAGTG 3' (SEQ ID NO. 2);

[0011] qPCR30-3': 5'ATTTATGTAAAAAAATTTATTGATATACATGT 3' (SEQ ID NO. 3).

[0012] The primers for U6 are:

[0013] U6-5': 5'GGCTCTCTTCGGAGATGCCGTT 3' (SEQ ID NO.4);

[0014] U6-3': 5'AAAAAATTACATTCCTTCTCGAACG 3' (SEQ ID NO. 5).

[0015] The PCR program for U6 was as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 68°C for 30 s, for 35 cycles; and 68°C for 5 min.

[0016] The lnc30 overexpressing strain constructed by the method is used in the study of the gene expression regulation mechanism of Plasmodium falciparum.

[0017] The lnc30 overexpressing strain constructed by the method is used in screening or preparing drugs for inhibiting the growth and development of Plasmodium falciparum.

[0018] The present invention, for the first time, discovered a previously unreported lncRNA, lnc30, in the Plasmodium falciparum 3D7 strain. Its overexpression significantly enhances the growth advantage of Plasmodium falciparum and the ability of merozoites to invade erythrocytes, participating in the regulation of the erythrocytic development of Plasmodium. Knockdown of lnc30 may lead to the death of the parasite, revealing the key role of lnc30 in the development of Plasmodium falciparum. This provides a new molecular tool for antimalarial drug target screening, malaria diagnosis, and pathogenesis research, with significant scientific value and application prospects. The present invention further constructed an lnc30-overexpressing strain. Experimental verification showed that lnc30 overexpression significantly enhances the growth advantage of Plasmodium falciparum and the ability of merozoites to invade erythrocytes, participating in the regulation of the erythrocytic development of Plasmodium. Knockdown of lnc30 may lead to the death of the parasite. This indicates that the lnc30-overexpressing strain of the present invention was successfully constructed and can be used to study the gene expression regulation mechanism of Plasmodium falciparum and for drug screening research to inhibit the growth and development of Plasmodium falciparum, with significant scientific value and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 .Identification and intracellular localization of full-length lnc30.

[0020] in Figure 1 Figure A is a 5'RACE PCR agarose gel image; M is a 5000 bp ladder; 1 is a positive control PCR product; 2 is a no-template control PCR product; 3 is a no-enzyme control PCR product; 4 is a lnc30 5'RACE PCR product; the white arrow indicates that the positive control product is 2.1 kb in length; the black arrow indicates that the lnc30 PCR product is 1 kb in length.

[0021] in Figure 1 Figure B is a 3'RACE PCR agarose gel image: M is a 5000 bp ladder; 1 is a no-template control; 2 is a no-enzyme control; 3 is the 3'RACE PCR product of lnc30; the black arrow indicates that the PCR product of lnc30 is 150 bp in length.

[0022] in Figure 1 C in the figure is the length of lnc30 verified by Northern Blot; M is the RNA marker; 1 is the northern blot product of lnc30; the black arrow indicates the length of lnc30.

[0023] in Figure 1 D in the figure is the predicted secondary structure of lnc30.

[0024] in Figure 1Figure E shows the localization information of lnc30 in Plasmodium falciparum 3D7 detected by FISH: DAPI is a fluorescent dye indicating the cell nucleus; Scramble is a negative control probe; U4 (U4 snRNA) is a positive control probe.

[0025] Figure 2 .Construction diagram of overexpression plasmid: A is the PLN-30 overexpression plasmid map; B is the control plasmid PLN map.

[0026] Figure 3 .Figure 1 shows the results of identification of lnc30 overexpressing insect strains.

[0027] in Figure 3 A in the figure is PCR identification of the BSD resistance gene; M is DL2000 DNA Marker; 1 is the 3D7 strain without plasmid transfection; 2 is the strain transfected with the control plasmid (con); 3 is the strain transfected with the overexpression plasmid (lnc30oe); the arrow indicates the BSD resistance gene, which is 399 bp in length.

[0028] in Figure 3 Figure B shows the qPCR verification of lnc30 transcription levels at different stages: the horizontal axis represents the different time points of the control and overexpression plasmid-transfected insect strains; the vertical axis represents the relative expression level of lnc30.

[0029] Figure 4 .Growth curve results of lnc30 overexpressing and control insect strains.

[0030] in Figure 4 A in the figure is the growth curve of the transfected worm strain. The horizontal axis is the number of days, and the vertical axis is the blood rate.

[0031] in Figure 4 B in the figure is the experiment of the number of merozoites of the transfected strain: the horizontal axis is the group, and the vertical axis is the number of merozoites;

[0032] in Figure 4 C in the figure is the merozoite invasion experiment of the transfected strain: the horizontal axis is the time for counting the parasitic blood rate, and the vertical axis is the parasitic blood rate;

[0033] in Figure 4 D in the figure is the relative expression level of the Var gene in the transfected strain; the horizontal axis is the gene number of the 58 var genes; the vertical axis is the relative expression level of the var gene; U6 snRNA was used as the internal reference gene in the qRT-PCR experiment to calculate the relative expression level of each lncRNA at different stages (2-ΔΔCt);

[0034] in Figure 4Figure E shows the adhesion experiment of the transfected parasite strain: the black arrow indicates HUVEC (human umbilical vein endothelial cells); the red arrow indicates the red blood cells infected with Plasmodium adhered to HUVEC; the parasite blood rate is * represents P < 0.05, represents P < 0.01, and * represents P < 0.001; the parasite blood rate is the ratio of red blood cells infected with Plasmodium falciparum to all red blood cells.

[0035] Figure 5 .Construction of lnc30 low-expression plasmid and identification of BSD-resistant gene in control insect strain.

[0036] in Figure 5 A in the figure is the knockdown plasmid map of low-expression lnc30; Figure 5 B in the figure is the agarose gel electrophoresis result of the BSD drug screening gene of the control insect strain; M is the DL2000 DNA Marker; 1 is the 3D7 insect strain without plasmid transfection; 2 is the insect strain transfected with the control plasmid; the arrow indicates that the BSD resistance gene PCR product is 399 bp in length. DETAILED DESCRIPTION

[0037] Our laboratory previously predicted 55 previously unannotated lncRNAs using a combination of RNA-Seq and bioinformatics analysis. This study validated these predictions using RT-PCR, confirming the existence of 31 of these lncRNAs, including the lnc30 described in this study.

[0038] The erythrocytic development of Plasmodium falciparum can be divided into four stages based on their morphology: the ring stage (rs), the trophozoite stage (ts), the schizont stage (ss), and the merozoite stage (ms). The ring stage (rs) and the schizont stage (ss), respectively, represent the early and late stages of the erythrocytic development. The two stages exhibit significant morphological differences, and the formation of mature schizonts requires repeated nuclear divisions, making them the most active stages. This study used qRT-PCR to analyze the expression profiles of 31 validated novel lncRNAs during the ring and schizont stages. The results showed that, among these 31 novel lncRNAs, lnc30 was significantly more highly expressed in the schizont stage compared to the ring stage.

[0039] Experimental Materials:

[0040] The parasite strain involved in the present invention is the MR4: Plasmodium falciparum 3D7 parasite strain belonging to the American ATCC.

[0041] The primers involved in the present invention are synthesized by Sangon Bioengineering Co., Ltd.

[0042] The primers for lnc30 are as follows:

[0043] qPCR30-5': 5'TTATTGTAAAGATAAAATTTGTCTGTAGTG 3';

[0044] qPCR30-3': 5'ATTTATGTAAAAAAATTTATTGATATACATGT 3'.

[0045] The primers for U6 are as follows:

[0046] U6-5': 5'GGCTCTCTTCGGAGATGCCGTT 3';

[0047] U6-3': 5'AAAAAATTACATCCTTCTCGAACG 3'.

[0048] The empty overexpression plasmid was PLN-ENR-GFP plasmid.

[0049] The knockdown empty plasmid is Crispr-dCas9 plasmid.

[0050] Primer sequence analysis: Primer5.0;

[0051] Statistical analysis: GraphPad Prism5, Excel, SPSS;

[0052] Sequence alignment analysis: DNAMAN, SeqMan;

[0053] Plasmid mapping: SnapGene.

[0054] Experimental methods

[0055] 1. Construction of Overexpression Plasmid

[0056] 1.1 Construction of pBSD plasmid

[0057] The original plasmid pLN-ENR-GFP was digested with HindⅢ restriction endonuclease, the larger fragments were recovered, and then the fragments were self-ligated to obtain the pBSD plasmid.

[0058] 1.2 Construction of pBSD-30 plasmid

[0059] The U6 promoter gene was obtained by PCR and purified, and then ligated into the 5' cloning site ApaⅠ and the 3' cloning site AvrⅡ of the PLN-ENR-GFP plasmid.

[0060] The full-length gene 30 was synthesized and ligated between the 5' cloning site AvrⅡ and the 3' cloning site AflⅡ of the PLN-ENR-GFP plasmid.

[0061] (The U6 gene promoter is a strong RNA polymerase III promoter specifically designed for efficient transcription of non-coding RNAs. The U6 promoter has high expression capacity. Connecting lncRNA30 to the U6 promoter can ensure that lncRNA30 reaches a high expression level in cells, which is conducive to functional research.)

[0062] 2. Construction of gene knockout plasmid

[0063] Crispr rgentool software was used to design sgRNA targeting lnc30.

[0064] The target sequence of sgRNA-1 is: 5'-ATGCATGTTTCCGCTGCTTG-3'

[0065] The target sequence of sgRNA-2 is: 5'-TTCATAAACAAGTATATGTG-3'.

[0066] After adding 20-25bp of sequence homologous to the ends of the plasmid to be connected, PCR is used to generate a double-stranded sgRNA. The sgRNA PCR product is directly connected to the vector using a seamless ligation method. The ligation product is transformed, a single clone is picked, and the plasmid is extracted and sent to a sequencing company for sequencing. Once the sequencing results are correctly aligned, the entire plasmid can be sequenced and transfection can be performed.

[0067] 3. Plotting the Growth Curve

[0068] After successful large-scale culture, pBSD, a control group (p30), a weak promoter experimental group (pU6+30), and a strong promoter experimental group (pU6+30) were synchronized twice during the ring stage to achieve high synchronization. After calculating the hemophilia, the cells were diluted to 0.5% with fresh red blood cells. Three replicate wells were constructed for each group. For the next five days, only the medium was changed without adding blood. Slides were stained daily, and the hemophilia was calculated. Graphs were generated using GraphPad Prism 5 software.

[0069] 4. Counting the number of merozoites

[0070] After successful large-scale culture, pBSD, a control group (pBSD), a weak promoter experimental group (p30), and a strong promoter experimental group (pU6+30) were synchronized twice at the ring stage to achieve high synchronization. After calculating parasite blood counts, the cells were diluted to 1% with fresh red blood cells at the schizont stage. Three replicate wells were constructed for each group. After 24 hours, parasites were transformed into ring-stage parasites, and slides were smeared for blood count calculation. GraphPad Prism 5 software was used for graphing.

[0071] 5. Adhesion Assay

[0072] 1) Cell Slides: When the cells have grown to about 90%, digest them with trypsin. After complete digestion, pipette and evenly inoculate them into a 24-well plate with cell slides placed in advance and culture for 1-2 days (add a drop of culture medium to the well before placing the slides, otherwise the cells will grow all over the plate and it will be impossible to count them).

[0073] 2) When the cells reach 80%-90% growth, inoculate each tube with 500 μl of red blood cells infected with the transfected Plasmodium falciparum strain 3D7. Incubate at 37°C for 1 hour, shaking every 15 minutes. Resuspend the infected red blood cells in complete medium containing 1640 for the growth of Plasmodium falciparum and add them to HUVEC cells that have been pre-washed with 1640.

[0074] 3) Gently wash three times with PBS or use 1640 complete medium to wash away non-adherent red blood cells.

[0075] 4) Fix the slides with 1% glutaraldehyde for 1 hour at room temperature.

[0076] 5) After fixation, rinse thoroughly and stain with Giemsa for approximately 1 hour at room temperature. Observe adhesion under a microscope.

[0077] 6) Count the number of infected erythrocytes adhered to 300-500 HUVECs (human umbilical vein endothelial cells). Design three parallel wells and calculate the average number of infected erythrocytes adhered to each HUVEC (human umbilical vein endothelial cell). Take photos and prepare graphs.

[0078] 6. Gametophyte Experiment

[0079] Gametocyte culture method:

[0080] 1) Maintain a hematocrit of 4% with a parasite blood rate of less than 6%

[0081] 2) When the blood rate of the ring stage reaches 3%-5%, synchronization is carried out. This is recorded as day 0

[0082] 3) On the second day (recorded as day 1), only change the medium without adding blood. When changing the medium, be sure to preheat it to 37℃ in advance.

[0083] 4) When the ring stage is reached (usually the second day), dilute the blood rate to 0.1%

[0084] 5) Change the fluid every day but do not add blood

[0085] 6) Sexual parasites can be observed around day 9, which are in stages III-IV, and stage V parasites can be observed around day 10-12

[0086] Example 1: Identification and sequence analysis of lnc30 ( Figure 1 )

[0087] We used RACE (rapid-amplification of cDNA ends) to identify the full-length sequences of late highly expressed lncRNAs. Only the 5'RACE and 3'RACE of lnc30 were successfully obtained, while the others were unsuccessful. The 5' sequence of lnc30 was extended by 267 bp (see Figure 1 A in the ), the 3' sequence was extended by 30 bp (see Figure 1 Finally, by sequencing the complete clone, we determined that the full length of lnc30 was 705 nt. We further used the Northern Blot method to detect and verify lnc30, and the results showed that a clear and highly specific band appeared at 705 nt. Figure 1 C in the figure, which is consistent with the RACE results. The secondary structure of lnc30 was then analyzed, and the results showed that the secondary structure of lnc30 is complex, with multiple stem-loop structures (see Figure 1 D in the figure) indicates that it can form a relatively stable structure, thus laying the foundation for its function. In order to clarify the localization of lnc30 in Plasmodium falciparum cells, we used FISH (fluorescence in situ hybridization) technology to detect it. The results showed that the signal of lnc30 completely overlapped with DAPI, indicating that lnc30 is located in the cell nucleus (see Figure 1 E).

[0088] RACE assay: SMARTer RACE kits were used for rapid cloning of the 5' and 3' ends. Sequencing confirmed the full length of lnc30 to be 705 nt, with a 267 bp extension at the 5' end and a 30 bp extension at the 3' end. Sequencing confirmed the sequence of lnc30 as shown in SEQ ID NO: 1.

[0089] Northern Blot verification: prepare 6% polyacrylamide-urea denaturing gel, separate RNA by electrophoresis and transfer to membrane, hybridize with digoxigenin-labeled specific probe (5'-CGTTATAATAAGTACGTACATAACTATCTAAATATACTTACAACACTGGA-3'), and chemiluminescence detection shows a specific band at 705 nt.

[0090] The SEQ ID NO: 1 sequence is:

[0091] Example 2: Construction, identification and phenotypic study of lnc30 overexpressing insect strains

[0092] 1. Construction of lnc30 overexpression plasmid

[0093] 1.1 Construction of pBSD plasmid

[0094] The original plasmid pLN-ENR-GFP was digested with HindⅢ restriction endonuclease, the larger fragments were recovered, and then the fragments were self-ligated to obtain the pBSD plasmid.

[0095] 1) Enzyme digestion:

[0096]

[0097] The above system was added into a sterile Epp tube and reacted at 37°C for 2 h.

[0098] 2) Prepare a 1% small-well agarose gel and add the enzyme digestion system and 10× Loading Buffer at a ratio of 10:1 to the agarose gel wells, approximately 10 μl per well.

[0099] 3) Excise and weigh the target fragment, then add three times the volume of Buffer PG. If the gel weighs 100 mg, the volume can be considered 100 μl. Add 300 μl of Buffer PG.

[0100] 4) Mix the 50℃ sol by constantly turning it upside down to fully dissolve the lumps. After it is completely dissolved, cool it to room temperature, add one volume of isopropyl alcohol and mix well.

[0101] 5) Add 200 μl of Buffer PS to the adsorption column already loaded into the collection tube, centrifuge at 13,000 rpm for 2 minutes, and discard the waste liquid.

[0102] 6) Add the solution obtained in step 4 to the adsorption column, place it at room temperature for 2 minutes, centrifuge it at 13,000 rpm for 2 minutes, and discard the waste liquid.

[0103] 7) (Optional) Add 500 μl of Buffer PG to the column, centrifuge at 13,000 rpm for 2 min, and discard the waste liquid.

[0104] 8) Add 750 μl of Buffer PW to the column, centrifuge at 13,000 rpm for 2 min, and discard the waste liquid.

[0105] 9) Spin the tube and centrifuge at 13000 rpm for 2 min, then discard the waste liquid.

[0106] 10) Place the adsorption column in a 1.5ml EPP tube and add 15µl of sterile water heated to 60°C. Allow to stand at room temperature for 2 minutes, then centrifuge at 13,000 rpm for 2 minutes. Collect the DNA solution and store it at -20°C.

[0107] 11) Self-connected system:

[0108]

[0109]

[0110] The above system was added to a sterile Epp tube and connected at 22°C overnight.

[0111] 12) Transform the ligation product, pick a single clone, extract the plasmid and send it to a sequencing company for sequencing. Once the sequencing results are correct, the plasmid can be extracted and prepared for transfection.

[0112] 1.2 Construction of pBSD-30 plasmid

[0113] The full-length gene 30 was synthesized and ligated between the 5' cloning site AvrⅡ and the 3' cloning site AflⅡ of the PLN-ENR-GFP plasmid.

[0114] The U6 gene was obtained and purified by PCR and ligated between the 5' cloning site ApaⅠ and the 3' cloning site AvrⅡ of the PLN-ENR-GFP plasmid.

[0115] 1) Enzyme digestion:

[0116]

[0117] The above system was added into a sterile Epp tube, reacted at 37°C for 2 h, and then all of it was added into the large holes of agarose gel and tapped for recovery.

[0118]

[0119] The above system was added to a sterile EPP tube and reacted at 37°C for 2 hours. Then all of it was added to the large wells of agarose gel and the gel was tapped for recovery.

[0120] 2) Connection of 30 full-length genes:

[0121]

[0122] The above system was added to a sterile Epp tube and connected at 22°C overnight.

[0123] The ligation product is transformed, a single clone is picked, and the plasmid is extracted and sent to a sequencing company for sequencing. Once the sequencing results are correctly aligned, the next fragment can be prepared for ligation.

[0124] 3) PCR of U6 gene:

[0125] Using the U6-T Vector plasmid previously used in the laboratory as a template, an ApaⅠ restriction site was added to U6-5' and an AvrⅡ restriction site was added to U6-3'.

[0126] The PCR system is:

[0127]

[0128] The PCR program is:

[0129]

[0130] 4) After PCR is completed, the PCR products are recovered by tapping and then enzyme digestion is performed:

[0131]

[0132] The above system was added to a sterile EPP tube and reacted at 37°C for 2 hours. Then all of it was added to the large wells of agarose gel and the gel was tapped for recovery.

[0133] 5) U6 gene connection:

[0134]

[0135] The above system was added to a sterile Epp tube and connected at 22°C overnight.

[0136] The ligation product is transformed, single clones are picked, and the plasmid is extracted and sent to a sequencing company for sequencing. After the sequencing results are correctly aligned, the entire plasmid can be sequenced and prepared for transfection.

[0137] The full-length sequence of lnc30 was cloned into the original plasmid PLN-ENR-GFP, and the CAM promoter of the original plasmid was transformed into the U6 promoter suitable for Plasmodium falciparum, named PLN-30 overexpression (see Figure 2 A). PLN plasmid was used as a control plasmid (see Figure 2 B). The transformed recombinant plasmids were verified to be completely correct by sequencing.

[0138] 2. Transfection and Construction of Lnc30 Overexpression Strains

[0139] The constructed plasmid was transformed into the ring-stage Plasmodium falciparum 3D7 strain using electroporation (transfection parameters: 310V / 950uf). Thirty days after transfection, an increase in parasite blood count was observed. The genome was extracted and tested for BSD resistance genes. Results showed that compared to the untransfected 3D7 strain, both the control plasmid-transfected strain (con) and the overexpression plasmid-transfected strain (lnc30oe) showed the presence of the BSD gene (see ). Figure 3 A), indicating that the plasmid transfection was successful.

[0140] qRT-PCR was further used to detect whether lnc30 was overexpressed. The results showed that the expression level of lnc30 in the overexpression strain (lnc30oe) was significantly higher than that in the control group (con) (see Figure 3 B), indicating that the lnc30 overexpression strain was successfully constructed.

[0141] 3. Phenotypic Observation of Lnc30 Overexpression Strains

[0142] The overexpression plasmid transfected strain (lnc30oe) and the control plasmid transfected strain (con) were synchronized continuously and the changes in their parasite blood rate were observed for 8 consecutive days. The results are shown below. Figure 4As shown in Figure A, compared with the control plasmid transfected strain (con), although the initial blood rate was the same, the blood rate of the lnc30oe strain increased significantly after one growth cycle, indicating that the overexpression plasmid transfected strain (lnc30oe) had a significant growth advantage.

[0143] In order to clarify the reasons why the overexpression plasmid transfectant strain (lnc30oe) has a growth advantage, the present invention explored the two aspects of merozoite number and merozoite invasion ability.

[0144] (1) Merozoite number experiment

[0145] We counted the number of merozoites in 40 consecutive schizonts obtained after synchronizing the lnc30 overexpressing strain (lnc30 oe) and the control plasmid transfected strain (con). 60 schizonts were randomly selected from each group. The results showed that there was no difference in the number of merozoites between the experimental group and the control group (p = 0.2845) (see Figure 4 (B in Figure 1). Therefore, the growth advantage of the lnc30-overexpressing strain is not due to the production of more merozoites.

[0146] (2) Merozoite invasion experiment

[0147] Late schizonts were enriched to make the initial parasitic blood rate of schizonts the same. After 12 hours, all of them were ring bodies. The parasitic blood rate of lnc30oe was higher than that of the control group, and the difference was statistically significant (see Figure 4 C in the figure), therefore, the growth advantage is likely due to the increased invasion ability of merozoites. In Plasmodium, enhanced adhesion ability can lead to increased invasion ability. So does the overexpression of lnc30 affect the transcription level of var genes related to adhesion? So we tested 58 var genes in lnc30oe and con strains. qRT-PCR results showed that in the lnc30 overexpression strain, only pf3D7-0900100 in the adhesion-related var gene family increased by 3 times (see Figure 4 D), HUVEC cells were used to further detect the adhesion ability of red blood cells infected with Plasmodium (see Figure 4 However, the results showed that the adhesion ability of erythrocytes infected with the lnc30-overexpressing strain was not enhanced, suggesting that the increased merozoite invasion ability is not caused by enhanced adhesion ability.

[0148] Regarding the aforementioned studies examining merozoite number and merozoite invasion ability, the authors found that lnc30 overexpression promoted parasite growth but did not increase merozoite number or adhesion ability. This finding suggests a novel mechanism by which lncRNAs contribute to malarial parasite pathogenicity—one that transcends traditional adhesion pathways and instead achieves a growth advantage by finely regulating the host-parasite interface. This suggests a qualitative shift in invasion efficiency, rather than a quantitative dependence. For example, lnc30 may enhance the invasion success rate of individual merozoites by regulating post-translational modifications or conformational changes in parasite surface proteins (such as AMA1 and the RON complex) without altering the total number of adhesion molecules. Alternatively, lnc30 may induce the parasite to secrete specific enzymes (such as serine proteases) that pre-degrade cytoskeletal proteins in localized regions of the erythrocyte membrane, pre-softening the membrane and making it more susceptible to invasion. However, the specific mechanism of action of lnc30 in invasion requires further investigation.

[0149] Based on the experiments that have been completed, it is suggested that lnc30 can be used as a potential drug target for the development of antimalarial drugs, and the ability of merozoites to invade red blood cells can be affected by controlling the expression level of lnc30.

[0150] Example 3: Construction and transfection of lnc30 knockdown plasmid

[0151] The original plasmid of low expression plasmid was donated by the Jiang research group of Shanghai Pasteur Institute, Chinese Academy of Sciences. Figure 5 As shown, the sgRNA targeting the lnc30 promoter region was successfully linked into the original vector, and the knockdown plasmid for low-expression lnc30 was successfully constructed (see Figure 5 After sequencing verification, the A) in the figure was transfected into the ring stage Plasmodium falciparum 3D7 strain by electroporation, and the control strain was successfully constructed. However, after repeated experiments, a low-expressing strain was still not obtained. At the same time, the control plasmid was transfected, and a transfected strain was successfully obtained 30 days after transfection. Through the detection of drug screening genes (see Figure 5 B) further demonstrates the successful generation of a control plasmid transfectant. Despite repeated experiments, the present invention failed to construct a low-expressing strain. Comparing the phenotypic observations of the production curves of the lnc30-overexpressing strain suggests that lnc30 expression may play a crucial role in the survival of Plasmodium falciparum, and knocking down lnc30 may lead to the death of Plasmodium falciparum. This further demonstrates that lnc30 is an important target for the prevention and treatment of Plasmodium falciparum.

[0152] Summary: This study identified lnc30 in the erythrocytic stage of Plasmodium falciparum for the first time and found that it is highly expressed in the schizont stage and localized in the cell nucleus. Overexpression can enhance the invasion ability of merozoites, and knockout may lead to the death of Plasmodium falciparum. Based on these findings,

[0153] Based on these findings, the present invention also constructed a strain that overexpresses the lnc30 gene, which is used to study the gene expression regulation mechanism of Plasmodium falciparum and to screen for drugs that inhibit the growth and development of Plasmodium falciparum. This provides a new approach and tool for the treatment and research of malaria, and has significant scientific value and application prospects.

Claims

1. A method for constructing an lnc30 overexpressing strain, characterized by: The nucleotide sequence of the lnc30 gene is shown in SEQ ID NO.1, The method for constructing a lnc30 overexpressing strain includes the following steps: (1) Construction of pBSD plasmid: The original plasmid pLN-ENR-GFP was digested with HindIII restriction endonuclease, the larger fragments were recovered, and then the fragments were self-ligated to obtain the pBSD plasmid; (2) Construction of the pBSD-30 plasmid: The U6 promoter gene was obtained by PCR and purified, and this gene was ligated between the 5' cloning site ApaⅠ and the 3' cloning site AvrⅡ of the PLN-ENR-GFP plasmid; the full-length lnc30 gene was synthesized and ligated between the 5' cloning site AvrⅡ and the 3' cloning site AflⅡ of the PLN-ENR-GFP plasmid; by ligating lnc30 to the U6 promoter, high expression of lnc30 in cells was ensured; (3) Transfection of parasites: The constructed plasmid described in (2) was transformed into the ring stage Plasmodium falciparum 3D7 strain by electroporation, and qRT-PCR was used to detect whether lnc30 was overexpressed.

2. The method according to claim 1, wherein: The parameters of electroporation transfection were 310V / 950uf.

3. The method according to claim 1, wherein: The primers for lnc 30 are: qPCR30-5': 5'TTATTGTAAAGATAAAATTTGTCTGTAGTG 3' (SEQ ID NO. 2); qPCR30-3': 5'ATTTATGTAAAAAAATTTATTGATATACATGT 3' (SEQ ID NO. 3).

4. The method according to claim 1, wherein: The primers for U6 are: U6-5': 5'GGCTCTCTTCGGAGATGCCGTT 3' (SEQ ID NO.4); U6-3': 5'AAAAAATTACATCCTTCTCGAACG 3' (SEQ ID NO. 5).

5. The method according to claim 4, characterized in that: The PCR program for U6 was as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 68°C for 30 s, for 35 cycles; and 68°C for 5 min.

6. Use of the lnc30 overexpressing strain constructed by the method according to any one of claims 1 to 5 in the study of gene expression regulation mechanisms of Plasmodium falciparum.

7. Use of the lnc30-overexpressing strain constructed by the method according to any one of claims 1 to 5 in screening or preparing drugs for inhibiting the growth and development of Plasmodium falciparum.